The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012914	Azospirillum brasilense strain Sp 7 chromosome, complete genome	3005726	601808	643782	3005726	integrase,transposase	Enterobacteria_phage(25.0%)	38	599277:599296	648931:648950
599277:599296	attL	AGGCCGCCGAGGCGCTGATC	NA	NA	NA	NA
WP_167555880.1|601808_602027_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_059398587.1|602314_602569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035683858.1|602613_603402_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.1	1.5e-28
WP_107685985.1|604073_604481_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051141069.1|604491_604920_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_051141068.1|605075_606491_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_035683850.1|606487_606823_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_051141067.1|606809_608117_+	amino acid permease	NA	NA	NA	NA	NA
WP_051141066.1|608198_608648_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059398589.1|608829_609255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059398590.1|609546_610371_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_059398591.1|610440_611091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035676969.1|611352_611997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079285244.1|612089_612773_+	thiaminase II	NA	NA	NA	NA	NA
WP_035677048.1|612830_613190_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_035677053.1|613367_613949_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	48.4	5.0e-34
WP_137165173.1|614143_614749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035677054.1|615651_616842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158283106.1|616856_618518_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_079285246.1|618502_618985_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_104675443.1|619098_620164_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_035676977.1|620301_621309_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.2	1.1e-20
WP_059398593.1|621986_623207_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	5.5e-43
WP_076612189.1|624311_625982_-|transposase	ISL3-like element ISAzba9 family transposase	transposase	NA	NA	NA	NA
WP_035683365.1|626495_628835_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_035683363.1|628831_630790_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_035683362.1|631051_631420_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_035683360.1|631668_632301_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_035683358.1|632568_633531_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104675504.1|633632_634829_+	MFS transporter	NA	NA	NA	NA	NA
WP_143265649.1|635130_635460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165175.1|635499_635778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035683354.1|635962_636451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165176.1|636447_638553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165177.1|638549_640790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165178.1|640794_641940_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_156355532.1|642150_642312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059399031.1|642441_643782_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
648931:648950	attR	AGGCCGCCGAGGCGCTGATC	NA	NA	NA	NA
>prophage 2
NZ_CP012914	Azospirillum brasilense strain Sp 7 chromosome, complete genome	3005726	2888082	2907872	3005726	integrase,transposase	Stx2-converting_phage(50.0%)	19	2888525:2888544	2899306:2899325
WP_035670709.1|2888082_2888481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035670722.1|2888477_2888636_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
2888525:2888544	attL	CACCGACATGCGCAAGGGCT	NA	NA	NA	NA
WP_137165139.1|2891409_2891859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059398986.1|2892408_2893512_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_137165140.1|2894002_2895538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035683817.1|2895548_2897108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059398987.1|2897293_2898940_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	51.5	3.5e-125
WP_059398988.1|2899024_2899372_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.9	9.5e-33
2899306:2899325	attR	AGCCCTTGCGCATGTCGGTG	NA	NA	NA	NA
WP_059398593.1|2899612_2900833_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	5.5e-43
WP_167555881.1|2900872_2901052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107685996.1|2901184_2901337_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035683386.1|2901393_2901780_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_137165141.1|2902198_2903467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137165142.1|2903469_2904576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079285690.1|2904589_2905195_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_079285689.1|2905290_2905590_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059398990.1|2905768_2906203_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_051141077.1|2906162_2906396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059398991.1|2906588_2907872_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.1	7.3e-46
>prophage 1
NZ_CP012915	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence	1754523	342447	383769	1754523	transposase,integrase	Enterobacteria_phage(14.29%)	42	374905:374925	393848:393868
WP_035683708.1|342447_343560_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059399153.1|343989_344619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035683705.1|346139_346487_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_107685989.1|346649_347204_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_035683703.1|347375_347669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165208.1|348100_348349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155903790.1|348464_348611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059399156.1|348618_349326_+	YmfQ family protein	NA	Q8W614	Enterobacteria_phage	33.7	7.7e-21
WP_051141053.1|349352_351464_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_051141052.1|351492_352038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035683699.1|352142_352616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167555916.1|352603_352780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158283150.1|352813_353326_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_137165207.1|353495_354089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079285348.1|354134_355250_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	26.2	3.1e-16
WP_035683696.1|355678_356377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051141051.1|356541_357075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051141050.1|357083_357353_+	YgjV family protein	NA	NA	NA	NA	NA
WP_059399157.1|357401_358472_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_035675751.1|359040_359859_+	hypothetical protein	NA	A0A0P1KLE3	Acinetobacter_phage	38.0	3.2e-10
WP_059399413.1|360075_361416_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	26.3	3.0e-26
WP_035675754.1|363007_364750_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	27.5	1.4e-36
WP_035675755.1|364746_365682_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_035675757.1|365678_367064_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	22.1	4.0e-05
WP_035675758.1|367060_370192_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_137165206.1|370522_371137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165205.1|371162_371537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035675761.1|371585_372281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145611146.1|372392_372908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137165204.1|373168_373402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035675766.1|373414_373771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059399159.1|373767_374487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059399160.1|374581_375514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
374905:374925	attL	CCTTCCCATCGCCGGGCGCGA	NA	NA	NA	NA
WP_155903515.1|375971_376139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035675771.1|376201_376885_-	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	35.3	2.4e-27
WP_137165203.1|377111_377873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079285352.1|377910_378456_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079285353.1|378799_379336_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_137165202.1|379366_380167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079285354.1|380160_380553_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_137165201.1|380521_381343_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_059399161.1|382020_383769_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
393848:393868	attR	CCTTCCCATCGCCGGGCGCGA	NA	NA	NA	NA
>prophage 2
NZ_CP012915	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence	1754523	1238503	1247274	1754523		Emiliania_huxleyi_virus(33.33%)	8	NA	NA
WP_035678629.1|1238503_1239952_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.6	5.2e-24
WP_059399307.1|1240143_1240722_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	49.2	7.7e-11
WP_059399308.1|1240966_1241464_-	YchJ family protein	NA	G9E3U3	Emiliania_huxleyi_virus	62.2	5.4e-05
WP_079285416.1|1241621_1242410_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035678617.1|1242406_1243081_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	35.6	1.1e-19
WP_035678616.1|1243171_1244257_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	34.6	1.5e-31
WP_035678614.1|1244348_1244774_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_079285417.1|1244778_1247274_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	36.2	7.2e-05
>prophage 1
NZ_CP012918	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence	206714	24238	66440	206714	integrase,transposase	Burkholderia_virus(28.57%)	36	45154:45172	69411:69429
WP_059399752.1|24238_25639_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_059399753.1|25973_26669_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.7	4.1e-19
WP_051140123.1|27217_27649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109111641.1|27789_28928_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	33.8	1.2e-26
WP_035671909.1|28991_29387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158283101.1|29618_30917_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_146206565.1|30913_31798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146206564.1|31892_32399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082413765.1|32843_33224_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158283147.1|34220_36308_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_059399811.1|36499_38167_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_035684106.1|38157_39090_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_035684109.1|39093_40542_+	TniQ family protein	NA	NA	NA	NA	NA
WP_156355545.1|40634_41243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035684117.1|41444_42248_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_035684120.1|42262_43015_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	7.1e-09
WP_035684123.1|43018_44170_-	thiolase family protein	NA	NA	NA	NA	NA
WP_035684127.1|44166_44571_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_059399760.1|44804_45641_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	40.0	4.8e-06
45154:45172	attL	TCGGCGGCGAGCGCCTCGG	NA	NA	NA	NA
WP_035684131.1|45902_46787_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.4	8.7e-22
WP_081650398.1|46856_48215_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	2.1e-51
WP_059399761.1|48507_49398_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035684134.1|49444_50659_+	CoA transferase	NA	NA	NA	NA	NA
WP_059399762.1|50688_52125_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_035684137.1|52147_52567_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_035684140.1|52642_53527_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146206586.1|53750_54170_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081650399.1|54299_54833_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_081650400.1|54869_55808_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035684149.1|55924_56530_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_105217750.1|56677_57316_-	Isoquinoline 1-oxidoreductase subunit	NA	NA	NA	NA	NA
WP_059399764.1|57318_59523_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_059399765.1|59524_60001_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	31.5	1.4e-05
WP_035684158.1|60368_63311_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059399766.1|63399_64203_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081650200.1|64640_66440_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
69411:69429	attR	TCGGCGGCGAGCGCCTCGG	NA	NA	NA	NA
>prophage 2
NZ_CP012918	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence	206714	115292	137321	206714	integrase,transposase	Microcystis_phage(14.29%)	21	112402:112418	121949:121965
112402:112418	attL	AGACGCGGGCGTAGGCG	NA	NA	NA	NA
WP_059399779.1|115292_116975_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_059399780.1|117153_118023_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_035683687.1|118074_118965_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	38.2	2.4e-27
WP_081650378.1|119071_119926_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	42.3	1.3e-43
WP_059399782.1|121931_122231_+	hypothetical protein	NA	NA	NA	NA	NA
121949:121965	attR	CGCCTACGCCCGCGTCT	NA	NA	NA	NA
WP_059399783.1|122227_123061_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.4	2.0e-28
WP_081650376.1|123290_123875_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_051141049.1|123842_124361_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.4	1.2e-15
WP_059399784.1|124546_125830_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.4	2.8e-45
WP_059399785.1|125826_126699_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.2	3.9e-51
WP_146206581.1|126619_127027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035683484.1|129723_129990_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_051141032.1|129982_130360_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_035683464.1|130479_130728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158283143.1|130788_130893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059399787.1|132150_133170_+	replication initiation protein	NA	NA	NA	NA	NA
WP_051141031.1|133213_133861_+	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	30.8	3.4e-15
WP_059399788.1|133847_134609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155903770.1|134658_135537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081650364.1|135822_136227_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_167555950.1|136889_137321_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP012919	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence	156480	112524	120179	156480		Bacillus_phage(33.33%)	7	NA	NA
WP_051141003.1|112524_113517_+	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	31.2	3.0e-15
WP_051141002.1|113506_114376_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	33.3	2.8e-09
WP_035683236.1|114528_115932_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.2	2.8e-51
WP_035683234.1|115964_117290_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.0	1.3e-82
WP_035683232.1|117557_117854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035683231.1|117939_119187_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.7	1.7e-15
WP_035683243.1|119186_120179_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	33.8	8.7e-39
