The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012937	Bacteroides thetaiotaomicron strain 7330 chromosome, complete genome	6487685	2822553	2836586	6487685	portal,terminase,integrase,head,capsid,protease	Cellulophaga_phage(16.67%)	15	2817197:2817210	2824605:2824618
2817197:2817210	attL	AAAAAGAAAGATTA	NA	NA	NA	NA
WP_062694985.1|2822553_2824188_+|integrase	phage integrase SAM-like domain-containing protein	integrase	R9ZYY8	Cellulophaga_phage	26.5	3.1e-17
WP_167541986.1|2824454_2824622_-	hypothetical protein	NA	NA	NA	NA	NA
2824605:2824618	attR	TAATCTTTCTTTTT	NA	NA	NA	NA
WP_062694988.1|2824640_2825132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062694990.1|2825388_2827203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062694992.1|2827681_2828176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118023947.1|2828242_2828899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081013450.1|2828876_2829188_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	41.2	3.3e-08
WP_062694995.1|2829153_2829699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062694997.1|2829655_2829952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062694999.1|2830106_2830496_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_062695933.1|2830495_2832118_+|terminase	terminase large subunit	terminase	A0A0A8WI49	Clostridium_phage	31.8	8.1e-58
WP_062695001.1|2832117_2833350_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	33.0	4.3e-43
WP_062695003.1|2833324_2834800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055269423.1|2834817_2835369_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J792	uncultured_Caudovirales_phage	41.8	2.6e-24
WP_062695005.1|2835365_2836586_+|capsid	phage major capsid protein	capsid	A0A088FRT0	Escherichia_phage	30.5	1.9e-27
>prophage 2
NZ_CP012937	Bacteroides thetaiotaomicron strain 7330 chromosome, complete genome	6487685	4391021	4400293	6487685	integrase	Cafeteria_roenbergensis_virus(16.67%)	7	4391006:4391032	4394778:4394804
4391006:4391032	attL	GCCACATTATGAGAACGTGCCGTTTGA	NA	NA	NA	NA
WP_081013553.1|4391021_4392185_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	31.9	3.9e-14
WP_081013476.1|4392179_4392647_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_008764673.1|4392710_4393514_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	31.8	2.5e-20
WP_062695969.1|4393543_4394842_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.2	2.8e-21
4394778:4394804	attR	TCAAACGGCACGTTCTCATAATGTGGC	NA	NA	NA	NA
WP_008764671.1|4395031_4396162_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	27.3	1.9e-26
WP_008764670.1|4396165_4397584_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	27.0	4.5e-28
WP_062695497.1|4397587_4400293_-	DEAD/DEAH box helicase family protein	NA	A0A2I7SC38	Paenibacillus_phage	23.6	1.6e-13
>prophage 3
NZ_CP012937	Bacteroides thetaiotaomicron strain 7330 chromosome, complete genome	6487685	5204316	5257110	6487685	integrase,transposase	unidentified_phage(42.86%)	44	5234960:5234977	5257801:5257818
WP_081013489.1|5204316_5204706_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	51.8	9.1e-08
WP_004311259.1|5204822_5206052_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.4	4.9e-23
WP_062695710.1|5206071_5207283_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.4	6.7e-17
WP_005821412.1|5207556_5209371_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	24.5	6.8e-13
WP_062695984.1|5209428_5210274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007484602.1|5210535_5211444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007484600.1|5212141_5212957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007484599.1|5213314_5214334_+	DUF3871 family protein	NA	NA	NA	NA	NA
WP_062695712.1|5214421_5214868_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_062695713.1|5215018_5215606_+|integrase	tyrosine-type recombinase/integrase	integrase	R9ZX86	Cellulophaga_phage	37.3	2.7e-19
WP_081013490.1|5215541_5215751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007484595.1|5216367_5217123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007484594.1|5217129_5218368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005821429.1|5218432_5218804_-	DMT family protein	NA	NA	NA	NA	NA
WP_062695715.1|5218829_5219042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849094.1|5219054_5219258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005651718.1|5219391_5219583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004311262.1|5219556_5219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004311263.1|5219919_5223468_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.3	2.5e-11
WP_005651724.1|5223394_5224126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004311265.1|5224535_5226728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004311266.1|5226730_5228932_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005651733.1|5228938_5231113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062695717.1|5231143_5232706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004312956.1|5232729_5234001_-	DUF4876 domain-containing protein	NA	NA	NA	NA	NA
WP_005829323.1|5234014_5236999_-	TonB-dependent receptor	NA	NA	NA	NA	NA
5234960:5234977	attL	AATATTTTCATTGGTAAG	NA	NA	NA	NA
WP_004327093.1|5237795_5239676_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_153862836.1|5240663_5240825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004311277.1|5240933_5241722_-	ParA family protein	NA	NA	NA	NA	NA
WP_004315818.1|5241797_5242202_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004327094.1|5242231_5242648_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_062695985.1|5242769_5242979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004327095.1|5243361_5243634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289236.1|5243562_5244129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004289235.1|5244125_5244884_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.1	4.5e-11
WP_004311292.1|5244880_5245861_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004289233.1|5245861_5247001_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004311295.1|5247012_5249091_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_004289231.1|5249109_5250114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004311297.1|5250238_5252329_-	lipoprotein	NA	NA	NA	NA	NA
WP_004289229.1|5252343_5254089_-	cell surface protein	NA	NA	NA	NA	NA
WP_004289228.1|5254189_5255107_-	DUF4465 domain-containing protein	NA	NA	NA	NA	NA
WP_004289226.1|5255840_5256170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004289225.1|5256216_5257110_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
5257801:5257818	attR	AATATTTTCATTGGTAAG	NA	NA	NA	NA
