The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	156280	216817	5174928	tail,capsid,tRNA,head,protease,portal,transposase	Caulobacter_phage(15.79%)	62	NA	NA
WP_145923316.1|156280_157180_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054724054.1|157213_160804_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	24.0	3.2e-22
WP_054724055.1|161141_162965_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	4.7e-22
WP_054724058.1|163210_163492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590010.1|163685_163985_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_054724060.1|163977_164370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082395361.1|164503_165649_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054724069.1|165700_166138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167346261.1|166230_166368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724071.1|166407_167097_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_082396171.1|167187_167499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082395362.1|167624_168188_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_054724076.1|168205_168907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054586486.1|169045_169303_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_145923317.1|169472_171053_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_054724080.1|171049_171508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167346262.1|171629_171779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724082.1|172163_172640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724084.1|172753_173068_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_145923318.1|173549_174720_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.1e-45
WP_145923319.1|174750_175461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724102.1|175505_175736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724104.1|175871_176933_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	59.1	4.0e-114
WP_054724106.1|176999_177437_-	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_054724108.1|177499_179458_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	69.0	8.9e-237
WP_054732798.1|180194_182465_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_054724110.1|182858_183236_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054724112.1|183235_184975_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_054724114.1|185102_185843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054732801.1|185842_187942_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_082395363.1|187959_188337_+	reverse transcriptase-like protein	NA	A0A2L0V0T1	Agrobacterium_phage	37.4	1.6e-09
WP_054724116.1|188411_188873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054586500.1|189063_190104_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_054724119.1|190113_191778_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_054732806.1|191854_192733_-	subclass B3 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_054724121.1|192828_193713_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.6	3.3e-13
WP_054724123.1|193699_194545_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.2e-15
WP_054724125.1|194776_195868_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_054724127.1|195902_197051_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_054724129.1|197064_197724_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054724130.1|197851_199855_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_158514378.1|200064_200226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724132.1|200353_200878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082396174.1|200928_202233_+	DNA-packaging protein	NA	A0A0K0N6T3	Gordonia_phage	38.3	1.2e-56
WP_054724135.1|202713_203820_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	34.7	2.7e-44
WP_054724137.1|203835_204144_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	48.7	1.5e-10
WP_054724139.1|204140_204569_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	37.0	3.3e-11
WP_082395364.1|204574_205714_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	47.3	3.0e-83
WP_054724141.1|205960_207319_+	hypothetical protein	NA	A0A2L0HPI4	Escherichia_phage	44.8	1.7e-16
WP_156343989.1|207315_207480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724143.1|207496_207778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724146.1|207777_208323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724148.1|208319_208712_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_054724150.1|208715_209051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724152.1|209098_209506_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_054724154.1|209502_209814_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_082396180.1|209863_210019_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_054724158.1|210011_210584_+	hypothetical protein	NA	D6PGG3	uncultured_phage	32.0	1.5e-06
WP_054724160.1|210583_212917_+	DUF2460 domain-containing protein	NA	A0A0P1KKK5	Acinetobacter_phage	27.1	5.0e-53
WP_054724162.1|212910_213735_+	DUF2163 domain-containing protein	NA	K4JUH7	Caulobacter_phage	38.3	2.4e-05
WP_054724164.1|214186_216361_+	hypothetical protein	NA	K4JQL7	Caulobacter_virus	42.1	6.6e-31
WP_054724166.1|216373_216817_+	DUF2793 domain-containing protein	NA	F4YXU6	Roseobacter_phage	38.1	1.8e-12
>prophage 3
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	810955	856217	5174928	transposase,integrase	Stenotrophomonas_phage(12.5%)	36	852930:852989	857253:857345
WP_039575425.1|810955_811963_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145923348.1|812293_813471_-|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_081997338.1|814389_815238_+	universal stress protein	NA	NA	NA	NA	NA
WP_081997337.1|815316_816366_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_156343998.1|817877_818048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|818275_819490_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054732956.1|819695_820913_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.2	6.4e-92
WP_054725015.1|820985_821360_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054732959.1|821331_822072_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054725017.1|822124_822859_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_145923349.1|822903_823614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725021.1|823693_823966_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_054725023.1|824006_824267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725025.1|824315_827651_-	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_054732962.1|827713_828706_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_054732965.1|828802_829072_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_158514394.1|829068_829401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923343.1|829548_830305_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082395406.1|830236_830965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|830967_832182_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_167346296.1|832671_834840_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	44.1	1.5e-35
WP_054725030.1|836025_838536_-	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	30.7	3.4e-31
WP_145923351.1|838519_838909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725034.1|838874_840962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725036.1|841489_843457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725037.1|846407_846731_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_082395407.1|846788_847028_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_054725040.1|848248_849241_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054725041.1|849237_850176_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054732971.1|850172_851390_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_158514485.1|851375_851804_+	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	56.3	8.2e-18
WP_145923610.1|851872_852055_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_054725044.1|852114_853014_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
852930:852989	attL	CGATTATGCCGAGCGCCACACTATGCCGAGCGGGCGCGGTAGGTCCCGGCTTTCCAGCAA	NA	NA	NA	NA
WP_158514395.1|853303_854296_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054724981.1|854292_855219_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	28.6	6.7e-09
WP_054724983.1|855215_856217_+|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
857253:857345	attR	TTGCTGGAAAGCCGGGACCTACCGCGCCCGCTCGGCATAGTGTGGCGCTCGGCATAATCGCCGCATTACAAGATTAGCGCGGAGGAATTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	1000515	1050958	5174928	tRNA,integrase	Mycobacterium_phage(25.0%)	49	1018288:1018304	1056126:1056142
WP_054725297.1|1000515_1001259_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_054725299.1|1001255_1002176_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.2	7.7e-05
WP_054725301.1|1002211_1002808_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_062912869.1|1002821_1003211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725307.1|1003242_1003776_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	8.9e-22
WP_054725310.1|1003925_1004489_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_054725312.1|1004493_1005537_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_054725315.1|1005638_1006355_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_054725318.1|1006356_1006980_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C7C699	Ugandan_cassava_brown_streak_virus	32.3	3.0e-13
WP_054725322.1|1007041_1007560_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_054725325.1|1007591_1008737_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_054725328.1|1008846_1009737_+	tyrosine recombinase XerC	NA	A0A1I9SC88	Mycobacterium_phage	32.8	6.3e-12
WP_054725331.1|1009739_1010348_-	DedA family protein	NA	NA	NA	NA	NA
WP_054725334.1|1010372_1011323_-	glutathione synthase	NA	NA	NA	NA	NA
WP_054588574.1|1011333_1011684_-	YraN family protein	NA	NA	NA	NA	NA
WP_054725337.1|1011680_1012541_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_054733026.1|1012551_1013739_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_054588572.1|1013918_1014455_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	7.6e-13
WP_054725339.1|1014466_1015165_-	NRDE family protein	NA	NA	NA	NA	NA
WP_054733028.1|1015261_1015816_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_054725342.1|1015827_1016436_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054733030.1|1016459_1016897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725344.1|1017055_1018564_-	peptidase S10	NA	NA	NA	NA	NA
1018288:1018304	attL	GGCGGCTCGGGTCGCGC	NA	NA	NA	NA
WP_054725347.1|1018667_1019360_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_054725351.1|1019463_1021650_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_062912870.1|1021736_1022255_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_054725357.1|1022383_1022926_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_054725360.1|1023585_1025343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003039428.1|1025470_1025707_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_054725364.1|1025890_1027153_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_082396229.1|1027453_1028371_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_082395424.1|1028336_1029167_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054733033.1|1029333_1029819_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_054733036.1|1030135_1031389_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.6	2.4e-73
WP_082395425.1|1031615_1032275_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	1.5e-23
WP_054725373.1|1032402_1033311_+	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	40.8	1.4e-06
WP_054725375.1|1033414_1035883_+	methylase	NA	NA	NA	NA	NA
WP_030540398.1|1036020_1037025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_030540399.1|1037021_1037936_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725389.1|1037929_1039477_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725391.1|1039533_1041372_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.2	1.3e-14
WP_054733039.1|1041431_1041845_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054725394.1|1041841_1042558_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054725397.1|1042571_1043735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725399.1|1043741_1044524_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	42.9	1.7e-58
WP_054725401.1|1044526_1045642_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_054725404.1|1045918_1047907_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_054732971.1|1048805_1050023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054725041.1|1050019_1050958_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1056126:1056142	attR	GGCGGCTCGGGTCGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	1187830	1196225	5174928		uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_054725735.1|1187830_1189903_+	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	26.4	3.3e-32
WP_054725738.1|1190043_1190370_-	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	58.0	1.2e-26
WP_054725741.1|1190835_1191135_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_054725745.1|1191207_1191966_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.8	5.2e-76
WP_054733071.1|1191965_1193036_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_145923636.1|1193032_1193455_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	5.2e-49
WP_054725751.1|1193472_1193805_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054725755.1|1193864_1194713_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.1	4.4e-47
WP_054733073.1|1194725_1196225_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	64.6	2.9e-171
>prophage 6
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	1384808	1397165	5174928	terminase	Sinorhizobium_phage(63.64%)	17	NA	NA
WP_054726283.1|1384808_1385438_+	hypothetical protein	NA	I6S676	Salmonella_phage	48.6	2.5e-47
WP_054726286.1|1385440_1385938_+	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	49.6	2.4e-29
WP_054733143.1|1386059_1387415_+|terminase	phage terminase large subunit	terminase	W8VT11	Pseudomonas_phage	52.6	2.3e-122
WP_167346268.1|1387506_1388850_+	DUF1073 domain-containing protein	NA	A0A076G6H8	Sinorhizobium_phage	46.2	2.4e-108
WP_054726292.1|1388846_1389998_+	hypothetical protein	NA	A0A076G8G2	Sinorhizobium_phage	48.1	7.7e-87
WP_054726295.1|1390001_1390490_+	hypothetical protein	NA	A0A2I7RPR6	Vibrio_phage	39.0	5.6e-15
WP_054726298.1|1390502_1391585_+	hypothetical protein	NA	A0A076GD16	Sinorhizobium_phage	62.5	4.3e-124
WP_054726302.1|1391599_1392184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726304.1|1392257_1392755_+	hypothetical protein	NA	A0A076G6I4	Sinorhizobium_phage	44.2	1.2e-23
WP_054726306.1|1392754_1393147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726308.1|1393143_1394319_+	hypothetical protein	NA	A0A076G6I6	Sinorhizobium_phage	34.1	5.3e-43
WP_145923429.1|1394330_1394549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726310.1|1394548_1394971_+	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	30.7	1.2e-10
WP_054726312.1|1394970_1395399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923428.1|1395395_1395869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054726319.1|1395872_1396241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923427.1|1396487_1397165_+	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	41.4	7.8e-31
>prophage 7
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	2323570	2387553	5174928	tail,transposase,integrase,plate	uncultured_Caudovirales_phage(33.33%)	54	2320361:2320376	2328912:2328927
2320361:2320376	attL	GGCATCCCCTTCCTCG	NA	NA	NA	NA
WP_054728081.1|2323570_2324200_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WE94	Clostridium_phage	27.5	1.1e-07
WP_054728083.1|2324501_2324771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728085.1|2324803_2325037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923389.1|2325026_2325353_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_062912888.1|2325318_2325927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728090.1|2326325_2326532_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	41.2	2.4e-07
WP_054728094.1|2326540_2326795_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054728096.1|2326975_2327188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728098.1|2327547_2327877_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054728100.1|2327890_2328319_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	4.0e-49
WP_054728102.1|2328329_2329394_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
2328912:2328927	attR	GGCATCCCCTTCCTCG	NA	NA	NA	NA
WP_054728104.1|2329399_2330158_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	64.9	1.4e-76
WP_054728106.1|2330268_2331066_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_054728108.1|2331062_2331842_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	24.2	4.5e-06
WP_145923348.1|2332250_2333428_-|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_006954973.1|2333911_2335126_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_145923387.1|2335453_2336092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923348.1|2336355_2337533_-|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_082395608.1|2337593_2339363_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_054728114.1|2339519_2340926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728116.1|2340938_2343236_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728117.1|2343312_2343900_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054728119.1|2344022_2345324_+	MFS transporter	NA	NA	NA	NA	NA
WP_054728121.1|2345264_2346194_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_054728123.1|2346220_2348671_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728126.1|2348811_2349561_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054728128.1|2349609_2350740_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_082396314.1|2350736_2351756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728131.1|2351990_2352707_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054728134.1|2352794_2353724_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_054728136.1|2353713_2354952_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054728139.1|2354956_2355913_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054728141.1|2356430_2358302_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728143.1|2358459_2359929_+	serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	23.9	1.9e-05
WP_054728145.1|2359912_2361010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728147.1|2361013_2362309_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.5	4.3e-54
WP_054728149.1|2363231_2364647_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_054728151.1|2364874_2368417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728153.1|2368413_2370819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728155.1|2370815_2373410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728157.1|2373406_2375887_-	hypothetical protein	NA	A0A1J0GW37	Streptomyces_phage	25.4	3.0e-11
WP_054728159.1|2375883_2376258_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_054728161.1|2376254_2376590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728163.1|2376604_2377120_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_054728164.1|2377116_2378235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728166.1|2378221_2378542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728168.1|2378538_2379195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923384.1|2379205_2382604_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_054728173.1|2382600_2382837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728174.1|2382833_2384732_-	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	35.4	1.4e-24
WP_054728176.1|2384728_2385481_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_054728178.1|2385477_2386284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728180.1|2386280_2387024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728182.1|2387031_2387553_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 8
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	2818476	2886369	5174928	transposase,integrase	Aureococcus_anophage(18.75%)	56	2870177:2870192	2888182:2888197
WP_006954973.1|2818476_2819691_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_158514399.1|2819808_2821479_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	1.1e-22
WP_082395699.1|2821781_2822900_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_120218809.1|2823094_2824265_+|transposase	IS3-like element ISSpma3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.5e-45
WP_054588524.1|2825312_2826956_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054588525.1|2826975_2827671_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_054588526.1|2827839_2828031_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_054729007.1|2828397_2828592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013832744.1|2828694_2828931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054733571.1|2829257_2829488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038575578.1|2829605_2829995_-	single-stranded DNA-binding protein	NA	A0A2I6PDH4	Staphylococcus_phage	35.5	1.7e-14
WP_082395701.1|2830292_2830721_-	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	59.8	3.0e-36
WP_054729011.1|2830731_2831169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729014.1|2831286_2832240_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_015459196.1|2832540_2832963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054732971.1|2833439_2834657_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054725041.1|2834653_2835592_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725040.1|2835588_2836581_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054729017.1|2837445_2839434_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_082395703.1|2839601_2840087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729020.1|2840126_2840846_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054733577.1|2840842_2841256_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054729023.1|2841311_2843156_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.2	1.3e-14
WP_054725389.1|2843212_2844760_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540399.1|2844753_2845668_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540398.1|2845664_2846669_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_054729026.1|2846806_2849275_-	methylase	NA	NA	NA	NA	NA
WP_054729029.1|2849378_2850287_-	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	40.8	1.4e-06
WP_062902859.1|2850414_2851074_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	2.0e-23
WP_167346279.1|2851142_2851298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|2852404_2853619_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054729035.1|2857317_2857632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729038.1|2858028_2858607_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054729042.1|2858603_2859512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514428.1|2859594_2862528_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.0	2.8e-24
WP_054729048.1|2862521_2864495_+	Atxe2 family lasso peptide isopeptidase	NA	NA	NA	NA	NA
WP_167346280.1|2864401_2865994_-	asparagine synthase	NA	NA	NA	NA	NA
WP_054729052.1|2866095_2866740_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_145923460.1|2866805_2866934_-	benenodin family lasso peptide	NA	NA	NA	NA	NA
WP_158514429.1|2867226_2867847_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054729058.1|2867843_2868731_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_054729061.1|2868742_2869351_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_054729064.1|2869531_2870272_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
2870177:2870192	attL	CGCGGCGGCAGCACCC	NA	NA	NA	NA
WP_158514430.1|2870280_2870418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729067.1|2870509_2871442_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_054729070.1|2871751_2872783_-	DNA primase	NA	A0A2I7R874	Vibrio_phage	36.8	5.7e-09
WP_082395715.1|2872794_2874657_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.8	3.7e-14
WP_030540398.1|2874705_2875710_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_030540399.1|2875706_2876621_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725389.1|2876614_2878162_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082395717.1|2878307_2880872_-	helicase	NA	A0A076FMQ0	Aureococcus_anophage	23.1	3.2e-16
WP_054729073.1|2880964_2881609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729076.1|2881673_2882183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729079.1|2882175_2882667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729082.1|2882817_2884944_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_054729085.1|2885142_2886369_-|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	28.9	9.2e-30
2888182:2888197	attR	GGGTGCTGCCGCCGCG	NA	NA	NA	NA
>prophage 9
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	2893507	2925938	5174928	tail,capsid,integrase,terminase,head,protease,portal	Pseudomonas_phage(22.22%)	46	2889367:2889382	2930432:2930447
2889367:2889382	attL	GCAGGCGCGCGCGGTC	NA	NA	NA	NA
WP_054729130.1|2893507_2894638_-	ParB N-terminal domain-containing protein	NA	H9A0Q8	Staphylococcus_phage	29.9	4.8e-09
WP_145923461.1|2894634_2894985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082395719.1|2895175_2895982_-	helix-turn-helix domain-containing protein	NA	A0A0S2SYF7	Pseudomonas_phage	31.4	9.3e-15
WP_054729138.1|2895975_2896188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054733581.1|2896187_2897171_+	hypothetical protein	NA	S5M810	Pseudoalteromonas_phage	41.8	8.2e-13
WP_054729143.1|2897167_2898601_+	AAA family ATPase	NA	A0A1P8VVQ6	Streptococcus_phage	30.7	3.8e-43
WP_054729146.1|2898593_2899364_+	DUF1376 domain-containing protein	NA	B0VK15	Azospirillum_phage	44.7	3.7e-21
WP_054729150.1|2899360_2899543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923462.1|2899535_2900189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156344042.1|2900344_2900515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729156.1|2900507_2900810_+	HNH endonuclease	NA	A8B112	Xanthomonas_virus	56.1	1.1e-13
WP_054729159.1|2900794_2901031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156344043.1|2901197_2901356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729162.1|2901641_2902124_+	hypothetical protein	NA	B4UTN9	Rhizobium_phage	51.2	2.5e-31
WP_054729164.1|2902206_2903706_+|terminase	terminase large subunit	terminase	K7P7T5	Enterobacteria_phage	53.2	1.7e-134
WP_145923640.1|2903708_2904944_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	52.8	2.7e-106
WP_054729167.1|2904940_2905798_+|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	45.5	6.2e-57
WP_054733589.1|2905926_2907135_+|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	67.2	7.7e-146
WP_145923463.1|2907177_2907456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729172.1|2907458_2907821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729175.1|2907823_2908324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729178.1|2908323_2908668_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_167346281.1|2908726_2909122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729182.1|2909121_2909505_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_054729185.1|2909521_2909953_+	hypothetical protein	NA	A0A142K640	Streptomyces_phage	31.7	8.8e-12
WP_054729188.1|2909949_2910330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729191.1|2910419_2910644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923464.1|2910644_2911064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923466.1|2911366_2911603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923467.1|2911662_2912193_+	hypothetical protein	NA	A0A142KCV1	Gordonia_phage	46.0	2.2e-36
WP_145923468.1|2912189_2912657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729204.1|2912852_2915231_+	hypothetical protein	NA	A0A0K1Y6G1	Rhodobacter_phage	34.0	1.8e-21
WP_054729207.1|2915227_2915821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729210.1|2915820_2916423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923469.1|2916422_2916836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923470.1|2916828_2918445_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_054729222.1|2918444_2918936_+	hypothetical protein	NA	D6PGT3	uncultured_phage	43.2	1.2e-12
WP_054729224.1|2918946_2919327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729228.1|2919329_2921498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726344.1|2921537_2921894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726352.1|2921890_2922679_+	hypothetical protein	NA	A0A1P8VVH0	Erythrobacter_phage	58.0	1.3e-69
WP_054726353.1|2922675_2923035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729231.1|2923031_2923394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729234.1|2924000_2924228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729237.1|2924217_2924658_-	hypothetical protein	NA	A0A125SA69	Pseudomonas_phage	47.9	4.8e-05
WP_054729240.1|2924666_2925938_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	50.0	3.1e-113
2930432:2930447	attR	GACCGCGCGCGCCTGC	NA	NA	NA	NA
>prophage 10
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	3014081	3021765	5174928	transposase,integrase	Ochrobactrum_phage(33.33%)	12	3011735:3011752	3025907:3025924
3011735:3011752	attL	GCGACCTGATGGACGCGT	NA	NA	NA	NA
WP_054729468.1|3014081_3016049_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0T6H2	Thiobacimonas_phage	42.5	1.1e-130
WP_054729471.1|3016062_3017058_+	hypothetical protein	NA	A0A0N7ACA6	Bacillus_phage	23.9	1.3e-10
WP_054729475.1|3017081_3017735_+	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	60.7	5.0e-67
WP_054729477.1|3017734_3017995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729480.1|3017991_3018393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729482.1|3018389_3018656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729485.1|3018652_3019228_+	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	39.4	5.6e-22
WP_054729488.1|3019227_3019680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729491.1|3019676_3019931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912969.1|3019930_3020170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729499.1|3020438_3020825_+	hypothetical protein	NA	A0A219VHE2	Ochrobactrum_phage	40.6	1.9e-13
WP_054733615.1|3021216_3021765_+	hypothetical protein	NA	A0A0D4DCJ5	Acinetobacter_phage	56.1	2.5e-51
3025907:3025924	attR	GCGACCTGATGGACGCGT	NA	NA	NA	NA
>prophage 11
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	4164730	4199297	5174928	transposase,integrase	Mycobacterium_phage(25.0%)	28	4157119:4157133	4199712:4199726
4157119:4157133	attL	AAACGCAGAGGCGGC	NA	NA	NA	NA
WP_006954973.1|4164730_4165945_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054731577.1|4166491_4167406_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054731578.1|4167548_4168442_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731579.1|4168540_4169290_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	5.4e-17
WP_054731580.1|4169319_4169742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731581.1|4169814_4170426_+	porin family protein	NA	O11861	Bartonella_henselae_phage	26.0	2.3e-05
WP_054731582.1|4170530_4171070_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731583.1|4171066_4171717_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054731584.1|4171811_4172192_+	response regulator	NA	NA	NA	NA	NA
WP_054731585.1|4172188_4174222_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_054731586.1|4174218_4176072_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_054734004.1|4176355_4177186_+	alpha/beta hydrolase	NA	A0A1D8ET90	Mycobacterium_phage	28.9	5.3e-13
WP_054731587.1|4177273_4177882_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_054731588.1|4177881_4178865_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054731589.1|4178976_4180191_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006954973.1|4180436_4181651_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082395953.1|4182528_4184787_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_054731590.1|4185062_4187612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156344053.1|4188018_4188180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923348.1|4188358_4189536_-|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_054725041.1|4189793_4190732_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054732971.1|4190728_4191946_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054731592.1|4192005_4192692_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.2	1.7e-25
WP_054734008.1|4193243_4193477_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	42.0	5.1e-06
WP_054731593.1|4193529_4193853_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_054731594.1|4194575_4196351_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	35.3	1.9e-07
WP_054731595.1|4196844_4197012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082395954.1|4197980_4199297_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.6	1.1e-97
4199712:4199726	attR	GCCGCCTCTGCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	4208043	4219811	5174928	terminase	Bordetella_phage(25.0%)	14	NA	NA
WP_054729130.1|4208043_4209174_-	ParB N-terminal domain-containing protein	NA	H9A0Q8	Staphylococcus_phage	29.9	4.8e-09
WP_145923538.1|4209170_4209692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731608.1|4209733_4210375_-	helix-turn-helix transcriptional regulator	NA	A0A291AUK0	Sinorhizobium_phage	31.9	1.7e-06
WP_054731609.1|4210459_4210741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731610.1|4210793_4212227_+	AAA family ATPase	NA	W8EEZ1	Geobacillus_phage	33.5	2.9e-43
WP_054731611.1|4212223_4213042_+	YdaU family protein	NA	A0A223W0C2	Agrobacterium_phage	51.5	8.0e-22
WP_145923539.1|4213076_4213580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731613.1|4213628_4214105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731614.1|4214268_4214646_+	hypothetical protein	NA	Q775B8	Bordetella_phage	35.0	1.5e-07
WP_054734010.1|4214629_4216255_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	50.5	1.1e-136
WP_054731615.1|4216424_4216700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731616.1|4217060_4218749_+	hypothetical protein	NA	A0A193GYI4	Enterobacter_phage	28.0	7.4e-54
WP_054731617.1|4218748_4219036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923540.1|4219010_4219811_+	hypothetical protein	NA	A0A193GYS7	Enterobacter_phage	29.8	3.8e-08
>prophage 13
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	4361172	4389937	5174928	integrase	Escherichia_phage(28.57%)	25	4386353:4386412	4389998:4390086
WP_054724983.1|4361172_4362174_-|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
WP_054724981.1|4362170_4363097_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	28.6	6.7e-09
WP_158514395.1|4363093_4364086_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082395986.1|4364375_4365284_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_054731729.1|4365367_4365691_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_054734077.1|4365997_4366399_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082395989.1|4366473_4367313_+	cation transporter	NA	NA	NA	NA	NA
WP_054731730.1|4367494_4368421_+	lipid kinase	NA	NA	NA	NA	NA
WP_054731731.1|4368635_4369448_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	34.6	1.7e-32
WP_145923554.1|4369682_4370327_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054731733.1|4370323_4371244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731734.1|4371331_4374259_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.6e-19
WP_054731735.1|4374270_4376277_+	Atxe2 family lasso peptide isopeptidase	NA	NA	NA	NA	NA
WP_054731736.1|4376368_4378081_-	asparagine synthase	NA	NA	NA	NA	NA
WP_158514467.1|4378077_4378728_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_054731738.1|4379022_4379661_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145923659.1|4379657_4380518_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_054731740.1|4380582_4381200_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_054731741.1|4381291_4382035_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731742.1|4382279_4383212_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_054731743.1|4383518_4384550_-	DNA primase	NA	A0A2R4ALE6	Vibrio_phage	32.2	2.9e-08
WP_082395991.1|4384561_4386424_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	30.0	4.8e-14
4386353:4386412	attL	GACATATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCGGTAGGCGCAGGTTTCCT	NA	NA	NA	NA
WP_054725389.1|4386480_4388028_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540399.1|4388021_4388936_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540398.1|4388932_4389937_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
4389998:4390086	attR	AGGAAACCTGCGCCTACCGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATATGTCTAATGTTGAGCTCAACATTACACGTATTC	NA	NA	NA	NA
>prophage 14
NZ_CP009429	Sphingopyxis macrogoltabida strain 203 chromosome, complete genome	5174928	4464494	4520091	5174928	tRNA,transposase,integrase,protease	Streptococcus_phage(16.67%)	46	4458992:4459009	4497438:4497455
4458992:4459009	attL	TCGGCGACGATCTCGATC	NA	NA	NA	NA
WP_054731801.1|4464494_4465811_+|integrase	site-specific integrase	integrase	Q7Y4M3	Streptococcus_phage	24.5	3.1e-07
WP_054734108.1|4465884_4466211_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_145923557.1|4466390_4466741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731803.1|4467092_4467551_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	54.6	1.2e-27
WP_054731804.1|4468048_4468441_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_054589308.1|4468445_4468676_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145923346.1|4469007_4469779_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
WP_145923558.1|4470892_4471297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145923559.1|4472303_4472963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731807.1|4473209_4473872_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054731808.1|4473864_4475400_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145923560.1|4475472_4481697_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_145923561.1|4482061_4482484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731811.1|4483005_4483572_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_167346302.1|4483517_4484684_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054731812.1|4484758_4486060_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.5	1.9e-33
WP_054734115.1|4486215_4487067_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054731813.1|4487185_4488142_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082396008.1|4488095_4489121_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_054731814.1|4489182_4489914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|4489916_4491131_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082396023.1|4491147_4492293_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	25.6	1.9e-13
WP_145923562.1|4492584_4492833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731816.1|4493078_4493618_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145923563.1|4493682_4494021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167346292.1|4494068_4494557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731819.1|4494496_4495081_+	hypothetical protein	NA	A0A1B2LRS6	Wolbachia_phage	29.1	1.4e-12
WP_054731820.1|4495080_4495467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731821.1|4495498_4496383_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_054731822.1|4496754_4499292_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	37.6	2.1e-20
4497438:4497455	attR	GATCGAGATCGTCGCCGA	NA	NA	NA	NA
WP_054731823.1|4499294_4501475_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_054731824.1|4501402_4503193_-	asparagine synthase	NA	NA	NA	NA	NA
WP_158514470.1|4503189_4503822_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_054731826.1|4504498_4504747_+	helix-turn-helix domain-containing protein	NA	A0A2I6UI15	Bacillus_phage	39.4	7.8e-05
WP_054731827.1|4504748_4506086_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_054731828.1|4506202_4506712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731829.1|4506696_4507218_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
WP_054589336.1|4507723_4507999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082396362.1|4509453_4511145_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.9	9.4e-09
WP_054731832.1|4511682_4512015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731833.1|4512531_4514484_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054731834.1|4514507_4515302_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054731835.1|4515301_4516285_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	22.2	3.9e-07
WP_054731836.1|4516277_4517042_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	5.4e-12
WP_082396031.1|4517402_4519256_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_145923346.1|4519319_4520091_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
>prophage 1
NZ_CP009430	Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence	422455	64729	127384	422455	holin,transposase	Klosneuvirus(30.0%)	49	NA	NA
WP_054735404.1|64729_66322_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.6	4.3e-64
WP_082396386.1|66329_67178_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_054734514.1|67208_68018_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.0	7.2e-15
WP_054734517.1|68017_68545_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_054734520.1|68773_69649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054734524.1|69676_70507_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_054734529.1|70543_70921_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_054734532.1|70966_72631_-	hypothetical protein	NA	A0A1V0SI18	Klosneuvirus	29.7	4.0e-52
WP_054734535.1|72755_73571_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_054734539.1|73563_75204_-	MFS transporter	NA	NA	NA	NA	NA
WP_158514493.1|75341_77711_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054734545.1|77768_78005_+	ferredoxin	NA	NA	NA	NA	NA
WP_082396389.1|78020_79196_+	cytochrome P450	NA	NA	NA	NA	NA
WP_054734551.1|79285_80761_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_145923673.1|80775_81747_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054734555.1|81751_82588_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	2.5e-10
WP_054734561.1|82607_83813_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054734565.1|83846_84884_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_062913032.1|84892_85237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054734571.1|85303_86461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054734574.1|86478_87306_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054734577.1|87662_88400_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054734580.1|88545_90732_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082396439.1|90792_92142_+	MFS transporter	NA	NA	NA	NA	NA
WP_145923348.1|92938_94116_-|transposase	IS3-like element ISSpma1 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.8e-35
WP_054734590.1|96059_97007_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054734594.1|97122_98298_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_054734598.1|98297_99428_+	CoA transferase	NA	NA	NA	NA	NA
WP_054734600.1|99460_100504_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_054734603.1|100815_101262_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_054734605.1|101309_102467_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_158514496.1|102459_103833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054734611.1|103883_104951_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_145923676.1|104995_105790_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_054734618.1|105786_106599_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054734621.1|106602_108648_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_054734624.1|110221_111169_-	gluconolaconase	NA	NA	NA	NA	NA
WP_082396396.1|111295_112144_-	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_158514497.1|112148_114023_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	30.9	5.7e-47
WP_054734634.1|114146_114956_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054734637.1|115078_116047_-	cytochrome P450	NA	NA	NA	NA	NA
WP_006954973.1|116232_117447_+|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054734639.1|117776_119411_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	29.2	3.1e-49
WP_006954973.1|119672_120887_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_145923677.1|121230_122133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158514498.1|122391_124647_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_167346308.1|124687_125431_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_082396400.1|125467_126196_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_006954973.1|126169_127384_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
>prophage 2
NZ_CP009430	Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence	422455	388978	403746	422455	transposase,integrase	Corynebacterium_phage(16.67%)	14	395060:395080	403835:403855
WP_006954973.1|388978_390193_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054735343.1|391080_392454_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_158514395.1|393051_394044_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.2	3.7e-13
WP_054724983.1|394964_395966_+|integrase	site-specific integrase	integrase	A0A2K9VH72	Gordonia_phage	28.0	1.1e-12
395060:395080	attL	CTACCGCGACACGTTCCGGCT	NA	NA	NA	NA
WP_054724984.1|395984_396890_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_054735346.1|396976_397489_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_145923318.1|397498_398670_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.1e-45
WP_054735349.1|398732_399164_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158514510.1|399193_399703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923693.1|400054_400492_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_054735357.1|400488_401100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158514511.1|401140_401608_-	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	48.5	3.6e-19
WP_054732971.1|401593_402811_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	3.6e-10
WP_054725041.1|402807_403746_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
403835:403855	attR	CTACCGCGACACGTTCCGGCT	NA	NA	NA	NA
>prophage 1
NZ_CP009431	Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence	151240	6145	69233	151240	transposase,protease,integrase	Corynebacterium_phage(18.18%)	50	9941:9955	72182:72196
WP_054735466.1|6145_7171_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_054735469.1|7526_8426_+	3'-5' exonuclease	NA	A0A223VZT3	Agrobacterium_phage	29.0	3.2e-16
WP_054735473.1|8457_10593_+	AAA family ATPase	NA	NA	NA	NA	NA
9941:9955	attL	CGATCATCACCGATC	NA	NA	NA	NA
WP_054735476.1|10594_12394_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	22.3	1.0e-21
WP_054735480.1|12618_15012_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_145923696.1|14981_15248_-	DUF1203 domain-containing protein	NA	NA	NA	NA	NA
WP_006954973.1|15334_16549_+|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054735482.1|16786_18352_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	32.1	6.3e-07
WP_054735485.1|18352_19180_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_054735488.1|19479_20850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006473457.1|21071_22427_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_145923697.1|22514_23849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735494.1|24180_25029_-	virulence-associated protein E	NA	NA	NA	NA	NA
WP_145923717.1|25486_26098_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.2	1.5e-28
WP_054735501.1|26077_26353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082396447.1|26362_27838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923698.1|28208_28424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054735507.1|28514_28925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590549.1|29046_29520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590550.1|29792_30110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054136666.1|30199_30484_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_054136667.1|30485_31052_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_054735510.1|31048_31849_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_054735512.1|31854_33144_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_145923699.1|33152_33998_+	DsbC family protein	NA	NA	NA	NA	NA
WP_054735515.1|33994_34705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735517.1|34711_37285_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_145923700.1|37281_37659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735524.1|37655_38207_+	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_082396448.1|38316_38793_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_082396457.1|38891_39452_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_145923718.1|39758_40751_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_054735533.1|40761_41499_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_082396449.1|41495_43232_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_066110861.1|43235_43613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735788.1|43609_44413_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054735543.1|44412_45855_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_054735546.1|45867_48654_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_145923701.1|48683_48908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054735551.1|49084_49870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735554.1|49880_50540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|50826_52041_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054735560.1|52732_54493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735563.1|54495_56037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167346310.1|56207_61508_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	32.0	9.8e-36
WP_082396450.1|61550_62585_+	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	25.4	7.5e-09
WP_006473457.1|62653_64009_+|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_054735488.1|64230_65601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007686150.1|66684_67215_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054735573.1|67565_69233_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.9	7.1e-09
72182:72196	attR	CGATCATCACCGATC	NA	NA	NA	NA
