The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	8393	96652	2317164	tRNA,transposase	Streptococcus_phage(13.64%)	54	NA	NA
WP_082990784.1|8393_9698_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.1	8.2e-45
WP_190299890.1|9759_10101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060470998.1|10180_10999_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_060470999.1|11009_11807_-	alpha/beta hydrolase	NA	A0A0Y0ADV3	Mycobacterium_phage	34.4	1.5e-12
WP_060472572.1|12654_12846_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060471001.1|13076_14354_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060472573.1|14364_14646_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060471002.1|14922_15762_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	38.0	2.5e-50
WP_060471003.1|15905_16391_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_082990669.1|17301_18093_-	recombinase family protein	NA	Q2A092	Sodalis_phage	32.5	1.0e-10
WP_060471006.1|18404_19985_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.4	1.3e-20
WP_060471007.1|19971_20520_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	34.9	1.8e-14
WP_060471008.1|20669_21254_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060471009.1|21378_22428_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	7.8e-46
WP_060471011.1|22763_23441_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	32.9	2.0e-18
WP_060471012.1|23456_24506_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.0	9.9e-49
WP_060471013.1|24588_25506_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	31.7	2.0e-13
WP_060471014.1|25693_27100_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471015.1|32142_33321_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060471016.1|34226_34565_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013851202.1|34558_34810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471017.1|37948_40054_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_060471018.1|40278_41730_+	APC family permease	NA	NA	NA	NA	NA
WP_060471019.1|41984_42539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471020.1|42708_43224_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012212177.1|43297_44209_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_012212178.1|44319_46005_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	6.0e-72
WP_060472574.1|47411_47999_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_060471021.1|48591_49269_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_060471022.1|49394_50243_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_060471023.1|50244_51540_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.5	8.0e-16
WP_060471024.1|51961_53011_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
WP_060471025.1|53031_53346_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_060471027.1|56116_56932_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_060471028.1|57105_57444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150121869.1|58128_59076_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.6	6.3e-79
WP_060471030.1|59166_59817_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_060471031.1|59806_60139_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014918364.1|60125_60278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471032.1|61973_62804_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_060471034.1|66058_67705_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_190299903.1|67798_70216_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
WP_060471036.1|70501_71164_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_060471001.1|71592_72870_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060471037.1|73784_75245_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.4	8.7e-27
WP_060471038.1|75262_76462_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.3	1.1e-141
WP_060471039.1|83766_84225_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	1.0e-42
WP_060471040.1|84237_86577_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	2.1e-83
WP_060471041.1|86651_86885_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_060471042.1|86951_89012_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	8.8e-142
WP_060471043.1|89083_90109_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_060471044.1|90108_91152_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_060471045.1|91165_92329_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_082990672.1|95404_96652_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	119710	174736	2317164	tRNA,integrase,transposase	Streptococcus_phage(19.05%)	44	116353:116412	166068:166469
116353:116412	attL	AGACCTCTGCCAGCGTCATGCAGGCTTTTCAAATGCTTCAAAAACAGTACAGCGAGCATT	NA	NA	NA	NA
WP_060471062.1|119710_121117_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471063.1|121256_123614_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_003627751.1|123677_123989_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_060471064.1|123991_124420_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003627753.1|124419_124677_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_060471065.1|124737_127377_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.3	2.7e-63
WP_060471066.1|127646_128132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471067.1|128700_130062_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	7.5e-49
WP_060471068.1|130054_131011_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_060471069.1|131070_132192_-	DNA polymerase IV	NA	O64031	Bacillus_phage	24.3	2.8e-17
WP_060471070.1|132184_133636_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.0	4.5e-60
WP_060471071.1|133743_134169_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_060471072.1|134227_135244_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	4.3e-09
WP_060471073.1|135292_135883_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_060471074.1|135907_137818_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.0e-56
WP_060471075.1|137817_140415_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	24.8	1.3e-38
WP_060471076.1|140577_142212_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.7	1.0e-156
WP_060471077.1|142264_142549_-	co-chaperone GroES	NA	A0A221S465	uncultured_virus	37.6	9.9e-12
WP_060471078.1|142781_143933_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.2	2.4e-56
WP_065214082.1|144259_145279_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	60.7	3.1e-23
WP_060471079.1|145399_145618_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060471080.1|145618_146041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471081.1|146043_146346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082990674.1|146366_146942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471082.1|146957_147278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190299891.1|147396_148782_+	conserved phage C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060471084.1|150241_150772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471085.1|151038_151224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471086.1|151304_151598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471087.1|152704_153982_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.6	2.2e-10
WP_082990676.1|154892_156122_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	1.5e-64
WP_080741353.1|156695_156983_-	GH32 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060471090.1|157949_159179_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	5.6e-11
WP_060471091.1|159386_160793_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471092.1|160913_161660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471093.1|161659_162115_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471094.1|162254_162902_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_060471095.1|163075_164989_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.8	3.5e-60
WP_082990677.1|166413_167679_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	3.1e-12
166068:166469	attR	AGACCTCTGCCAGCGTCATGCAGGCTTTTCAAATGCTTCAAAAACAGTACAGCGAGCATTGGAACGATATCTTTAAGACAATTGCTACTGATAATGGTTCAGAGTTTGCGGATCTAGCTAATCTGGAACAAGTCTCTAAAACGCTTATTTATTATGCTCATCCTTATACTTCTTGTGATAAAGGAACTGTTGAAAGACATAATGGCCTGATCCGCAGATTCTTTCCTAAAGGAGACTGCATCAATAGCTATTCTCTCCAACAAATCATTGATATTGAAACCTGGTGCAACTCTTTGCCCAGAAAGATCCTGGCATATCACACGCCAGATGAAATCTTTGAGAGAGAATTAGATCAAATCTATCAAGCAGCTTAAGCGTTCAATTTATTATTGCAATTTACGA	NA	NA	NA	NA
WP_060471097.1|167919_169068_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.6	1.3e-54
WP_060471098.1|169496_170699_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	29.8	4.3e-40
WP_060471099.1|170976_172026_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	2.8e-51
WP_082990678.1|172215_173475_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	3.5e-125
WP_060471101.1|173998_174736_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	407197	452368	2317164	transposase	Planktothrix_phage(28.57%)	41	NA	NA
WP_060471197.1|407197_408376_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060471282.1|408806_410213_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471283.1|410467_413485_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_060471284.1|414748_415534_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_060471285.1|415530_416664_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_060471286.1|416768_417509_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471287.1|417536_418619_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060471288.1|418773_420015_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_190299907.1|420046_420778_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	4.5e-32
WP_060471290.1|420779_422264_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_060471291.1|422391_423216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471292.1|423228_423912_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471293.1|424061_425048_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	30.3	4.2e-33
WP_060471294.1|425254_425674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471295.1|425676_426315_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_060471296.1|426332_426989_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471297.1|427000_427816_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060471298.1|427977_428922_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_082990788.1|429076_430381_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.7	2.2e-45
WP_060471299.1|430451_431210_-	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	32.7	2.0e-27
WP_060471300.1|431298_432225_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471301.1|432244_433702_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_060471302.1|433696_434176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471303.1|434228_434936_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_060471304.1|435497_436286_+	DUF475 domain-containing protein	NA	A0A068EP98	Bacillus_phage	40.4	5.0e-37
WP_060471305.1|436322_436685_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_060471306.1|436754_437387_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_060471307.1|437714_439328_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_060471308.1|439327_440083_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	1.5e-27
WP_060471309.1|440135_441053_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_014918082.1|441053_441701_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_190299893.1|441863_442025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025283179.1|442071_442398_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_060471310.1|442449_443559_-	beta-glucanase	NA	NA	NA	NA	NA
WP_082990689.1|443473_444880_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_150121880.1|445976_446117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471313.1|447633_448485_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060472587.1|448704_449415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472588.1|449419_449986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471001.1|450163_451441_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_150121881.1|451567_452368_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	468441	540998	2317164	protease,transposase	Streptococcus_phage(20.0%)	43	NA	NA
WP_060471326.1|468441_469299_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471327.1|469627_470032_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_060471328.1|470212_471319_+	cation transporter	NA	NA	NA	NA	NA
WP_060471329.1|471386_471947_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
WP_060471330.1|471961_472858_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_060471331.1|472975_474253_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	5.8e-11
WP_150121883.1|474490_475138_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.0	6.5e-27
WP_060471332.1|476216_477158_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060472589.1|477928_478408_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_060471333.1|478877_480119_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	6.2e-18
WP_060471334.1|480205_481003_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	2.7e-30
WP_060471335.1|481018_481843_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_060471336.1|481845_483195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471337.1|483184_485041_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.6	2.3e-32
WP_060471338.1|485107_485824_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.0e-41
WP_060471339.1|486145_486367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471340.1|486551_487958_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471197.1|488471_489650_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060471341.1|489827_491105_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.4	1.7e-10
WP_060471098.1|491244_492447_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	29.8	4.3e-40
WP_190299896.1|492817_492961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471342.1|492968_493388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471343.1|493604_494882_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.5	2.4e-12
WP_060471344.1|510414_510828_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.4	2.3e-09
WP_082990691.1|511114_512125_+	serine hydrolase	NA	NA	NA	NA	NA
WP_060472590.1|512164_514996_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	25.1	8.1e-29
WP_060471346.1|516485_517313_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.1	1.0e-96
WP_060471347.1|517785_518628_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_060471348.1|518754_519768_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.3	5.0e-50
WP_060471349.1|520069_520927_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.0	7.3e-58
WP_060472591.1|521800_522508_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_060471350.1|522847_523840_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060471351.1|523836_524733_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060471352.1|524729_525491_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.4	5.5e-17
WP_060471354.1|528791_529958_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	47.2	1.8e-99
WP_060471355.1|529970_531047_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	1.1e-92
WP_060471356.1|531447_532077_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_060471357.1|533342_533915_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_060471358.1|533911_534946_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060471359.1|535200_537435_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.4	6.5e-90
WP_060471360.1|538372_538933_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_060471361.1|538971_539745_-	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_060471024.1|539948_540998_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
>prophage 6
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	562471	702153	2317164	protease,transposase,holin,integrase,tRNA	Streptococcus_phage(15.62%)	105	561334:561360	640424:640450
561334:561360	attL	ATCAACAGGATTTGACAAAGAGCCGTA	NA	NA	NA	NA
WP_023191461.1|562471_563710_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003624850.1|563753_563933_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004561176.1|563934_564318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471377.1|565226_566021_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	28.5	2.7e-14
WP_060471378.1|566010_566562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471379.1|566578_567016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471380.1|567196_567913_+	helix-turn-helix transcriptional regulator	NA	Q9AZN3	Lactococcus_phage	47.1	3.7e-07
WP_082990787.1|568236_569502_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471381.1|569821_570526_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.9	2.1e-18
WP_060471382.1|570609_571839_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_060471383.1|571900_572161_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_065214089.1|572211_572382_-	CsbD family protein	NA	NA	NA	NA	NA
WP_060471282.1|572532_573939_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471385.1|574695_575943_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.2	7.4e-11
WP_082990676.1|576180_577410_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	1.5e-64
WP_060471386.1|577505_578363_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471387.1|578659_579589_-	DegV family protein	NA	NA	NA	NA	NA
WP_060471388.1|579679_580609_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060471389.1|580845_582240_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	3.7e-120
WP_060471390.1|582270_582726_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060471391.1|582737_584759_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_060471392.1|584966_585824_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_172644354.1|586044_587646_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	32.2	4.9e-15
WP_060471393.1|589271_589508_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_060471394.1|589536_590055_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	51.2	9.2e-40
WP_060471395.1|590100_590397_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_060471396.1|590616_593100_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.1	1.4e-109
WP_060471397.1|593110_595075_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.2	2.9e-142
WP_060471398.1|595075_596203_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_060471399.1|596202_596427_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	47.2	3.2e-05
WP_060471400.1|596652_597783_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	26.5	3.1e-24
WP_060471401.1|597947_599315_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003549412.1|599790_599931_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003624919.1|599983_600352_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_060471402.1|600332_601229_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_060471403.1|601338_602724_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_060471404.1|602732_604631_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_060471405.1|606880_608284_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.9	4.1e-34
WP_060471406.1|608384_609944_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_060471407.1|610037_611147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624933.1|611211_611364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471408.1|614332_616255_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.3	1.4e-93
WP_060471409.1|616254_616542_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_060471410.1|616545_616851_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_060471409.1|616850_617138_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_060471411.1|617137_617515_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_060471412.1|617527_617968_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_060471413.1|618099_618957_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150121940.1|623505_623592_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_060471414.1|626203_627553_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.6	7.0e-124
WP_060471415.1|627692_628970_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	4.5e-11
WP_060471001.1|629197_630475_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_150121888.1|630940_631042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060471416.1|631096_631543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082990787.1|631879_633145_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471392.1|633216_634074_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150121941.1|634736_634823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471417.1|637908_638796_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_060471419.1|640565_641879_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.0	1.3e-34
640424:640450	attR	ATCAACAGGATTTGACAAAGAGCCGTA	NA	NA	NA	NA
WP_060471420.1|643428_644268_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_060471421.1|644264_645452_-	MFS transporter	NA	NA	NA	NA	NA
WP_060471422.1|645636_647043_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471423.1|647283_648594_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.9	3.5e-43
WP_060471424.1|648773_649508_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471425.1|649646_650846_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_082990791.1|650901_652167_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471426.1|653793_654594_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_060471427.1|654641_655328_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.2	1.2e-55
WP_060471428.1|655352_656000_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	48.4	2.3e-48
WP_060471429.1|656512_657232_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_060471430.1|657349_658177_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.1	3.3e-23
WP_060471431.1|659128_659734_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_060471432.1|662132_663236_-	YdcF family protein	NA	NA	NA	NA	NA
WP_060471433.1|663324_663981_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_150121889.1|664179_664278_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_150121890.1|665015_665111_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_060471434.1|665264_665546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471435.1|665542_666400_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060471436.1|666491_667121_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_060471437.1|667125_668694_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.6e-10
WP_004561119.1|668731_669001_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_060471438.1|668987_669296_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_060471439.1|669424_670594_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_060471440.1|670747_672604_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.5	8.9e-69
WP_060471441.1|672736_673207_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_060471442.1|673782_674919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630630.1|675388_675541_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_060471443.1|675556_677074_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.6	1.5e-34
WP_060471444.1|677070_678309_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.2	5.8e-24
WP_060471445.1|678367_678607_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_060471446.1|678599_679886_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_060471447.1|679885_680830_+	serine hydrolase	NA	NA	NA	NA	NA
WP_082990699.1|681041_681593_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060471448.1|681940_682330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471449.1|683426_684704_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	9.9e-11
WP_060471450.1|684928_685585_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_060471451.1|685650_686613_-	SLAP domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	53.8	1.0e-63
WP_082990700.1|686887_688504_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014919612.1|688542_688779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471453.1|691840_693166_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_060471454.1|693134_694004_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471455.1|694347_696471_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	4.2e-115
WP_060471456.1|696578_697220_+	signal peptidase I	NA	NA	NA	NA	NA
WP_060471457.1|697313_698051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079227714.1|702000_702153_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	708678	735749	2317164	transposase	Lysinibacillus_phage(14.29%)	22	NA	NA
WP_060471459.1|708678_709956_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.8	1.3e-10
WP_060471460.1|710263_711313_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
WP_060471461.1|711346_712360_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.8	1.2e-62
WP_060471462.1|712793_713849_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_060471463.1|714285_715278_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.0	3.7e-130
WP_060471464.1|715475_716765_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.8	8.1e-69
WP_060471465.1|716768_718067_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	5.0e-18
WP_060471466.1|718135_718498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471467.1|718533_719574_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	6.6e-37
WP_060471468.1|720488_721133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471469.1|722329_722812_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	44.1	8.3e-19
WP_082990791.1|722879_724145_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471470.1|724352_725039_-	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
WP_060471471.1|725321_726134_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_082990703.1|726536_727796_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.9	1.0e-116
WP_060471473.1|729147_729921_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_150121942.1|729951_730095_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082990704.1|730095_730449_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_150121943.1|730717_731725_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	1.0e-95
WP_003648207.1|731705_732131_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_060471475.1|732123_734292_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	4.2e-171
WP_060471476.1|734471_735749_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.8	5.8e-11
>prophage 8
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	802362	933287	2317164	protease,transposase	Lactobacillus_phage(12.9%)	106	NA	NA
WP_190299899.1|802362_803592_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.6	6.4e-116
WP_060471524.1|803767_804304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471525.1|805286_805901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471526.1|805955_807461_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_060471527.1|807553_807853_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_060471528.1|807947_808493_+	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	28.9	3.6e-10
WP_060471529.1|808682_809234_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	33.9	3.2e-14
WP_060471530.1|809798_810512_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	2.1e-18
WP_060471531.1|810649_811534_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	37.8	8.7e-14
WP_060471532.1|813223_814237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471533.1|814258_815524_-	GTPase HflX	NA	NA	NA	NA	NA
WP_060471534.1|815999_817061_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	4.2e-15
WP_060471535.1|817072_817954_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_060471536.1|817964_818765_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_060471537.1|818764_819535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471538.1|819654_820305_+	sugar transferase	NA	NA	NA	NA	NA
WP_060471539.1|820319_820769_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_060471540.1|820781_821282_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_060471541.1|821290_823255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190299900.1|823260_824364_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_060471543.1|824350_825376_+	glycosyltransferase family 2 protein	NA	A0A1V0S9B9	Catovirus	23.4	9.1e-07
WP_060471544.1|825376_826111_+	hypothetical protein	NA	A0A2K9L4Z6	Tupanvirus	28.7	1.3e-07
WP_060471545.1|826107_826818_+	acyltransferase	NA	NA	NA	NA	NA
WP_060471546.1|826835_827966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471547.1|827962_829414_+	flippase	NA	NA	NA	NA	NA
WP_082990707.1|829620_829857_+	transferase	NA	A0A191KBJ5	Streptococcus_virus	59.7	4.5e-18
WP_082990708.1|831615_832875_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	1.3e-10
WP_060471549.1|833655_834579_+	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	67.0	4.8e-108
WP_060471550.1|834597_835017_+	hypothetical protein	NA	E9LUK8	Lactobacillus_phage	52.9	5.2e-33
WP_060471551.1|835009_835702_+	hypothetical protein	NA	E9LUK7	Lactobacillus_phage	48.3	8.8e-54
WP_023192708.1|837406_838015_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	2.5e-44
WP_060471553.1|838031_839018_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	37.3	3.7e-29
WP_060471554.1|839418_840294_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	2.5e-77
WP_060471556.1|840941_841448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471557.1|843862_845188_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	4.7e-56
WP_060471558.1|845217_845826_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	2.6e-33
WP_060471560.1|847415_848420_+	asparaginase	NA	NA	NA	NA	NA
WP_003627805.1|848510_848648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190299910.1|848727_848925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471562.1|848982_849654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471563.1|849742_851014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471564.1|851160_851910_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	9.9e-35
WP_060471565.1|851922_853719_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_060471567.1|854744_855395_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_060471568.1|855455_856142_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_060471569.1|856291_858598_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060471570.1|860139_860700_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_060471571.1|860758_861673_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	3.6e-31
WP_060471572.1|861707_862271_+	elongation factor P	NA	NA	NA	NA	NA
WP_060471574.1|863538_864057_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082990710.1|864095_864740_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_060471576.1|864872_865376_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_060471577.1|865423_866425_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_060471578.1|866514_867429_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_060471579.1|867578_868985_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471001.1|869128_870406_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060471580.1|870627_872232_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	2.9e-15
WP_003629963.1|872627_873368_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	84.5	1.8e-121
WP_082990711.1|874972_875152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471583.1|876039_876219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150121894.1|876435_877222_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082990713.1|877838_881039_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_060471587.1|881228_883013_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.7	8.8e-90
WP_060471588.1|882942_884115_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060471579.1|884260_885667_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471589.1|886797_887079_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_060471590.1|887068_887551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471591.1|887540_887810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471592.1|888120_889221_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_060472596.1|889236_890328_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_082990714.1|890345_891803_-	FAD-binding protein	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.0	1.9e-21
WP_060471593.1|892796_893354_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_060471594.1|893319_894504_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_060471595.1|894545_895457_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.2	9.1e-59
WP_060471598.1|896322_896550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471601.1|899958_900405_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_060471602.1|900434_900902_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625237.1|900898_901882_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_013855204.1|901940_902183_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_060471603.1|902192_903110_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_060471604.1|903109_903841_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.6e-13
WP_060471605.1|903862_905092_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_013855208.1|905095_905566_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_060471606.1|905570_905987_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_060471607.1|906000_907380_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_060471608.1|907360_908203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471609.1|908195_908966_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_054640358.1|909024_909783_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_060471610.1|909830_910820_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_060471611.1|910893_911436_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_060471612.1|911557_911899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082990716.1|912448_913678_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.0	3.3e-64
WP_014564291.1|915363_915921_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_060471614.1|915923_917000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471615.1|917215_918082_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.2e-31
WP_150121897.1|918479_919007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082990717.1|919073_920000_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_060471617.1|919977_922263_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_060471619.1|924234_925041_+	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	30.1	2.3e-21
WP_060463335.1|925054_925303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471620.1|927129_927420_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_060472599.1|927462_927894_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_060471621.1|928445_929684_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_082990718.1|929988_930294_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	51.1	1.4e-16
WP_060472601.1|930500_930755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_060471623.1|931880_933287_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	951792	1025388	2317164	tRNA,transposase	Streptococcus_phage(11.76%)	52	NA	NA
WP_060471641.1|951792_952983_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.1	2.0e-114
WP_060471642.1|953159_954542_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060472602.1|954625_955483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060471643.1|955482_956280_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471644.1|956409_957018_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	37.5	7.5e-33
WP_060471645.1|957017_957569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060471646.1|957793_959101_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.3	2.1e-93
WP_082990791.1|965172_966438_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_150121898.1|966822_966927_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_060471648.1|967020_967353_+	GH32 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060471650.1|971464_972475_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_060471651.1|972491_973310_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_060471652.1|973339_974260_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_060471653.1|974263_974632_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_082990719.1|974676_975558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471655.1|975715_976765_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	3.5e-46
WP_190299901.1|976868_977447_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_082990794.1|977435_978740_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.1	8.2e-45
WP_060471656.1|978905_980279_-	amino acid permease	NA	NA	NA	NA	NA
WP_060471657.1|980592_983217_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_060471658.1|983411_985223_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.4	5.6e-92
WP_060471659.1|985295_985589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082990720.1|985772_985859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471660.1|986126_987404_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	4.5e-11
WP_060471662.1|987865_989050_+	acetate kinase	NA	NA	NA	NA	NA
WP_003626977.1|989884_990298_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_060471392.1|990459_991317_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471663.1|991437_993276_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060471664.1|993280_994606_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_060471665.1|994617_996849_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	25.8	3.4e-06
WP_003626968.1|996881_997253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471666.1|997270_998020_-	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_150121899.1|999530_999716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471668.1|1000538_1001252_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003632960.1|1001268_1002423_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_060471669.1|1003649_1003844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013854640.1|1003919_1004318_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_060471670.1|1004422_1004623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471671.1|1004730_1005114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471672.1|1005152_1006028_+	serine/threonine protein phosphatase	NA	A8E2N0	Enterococcus_phage	27.6	1.1e-16
WP_060471673.1|1006153_1007551_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_060471676.1|1010410_1011106_+	SLAP domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	80.6	8.1e-07
WP_060471677.1|1011244_1012303_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_060471678.1|1012375_1012954_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	7.4e-22
WP_082990723.1|1012954_1013542_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.3	8.9e-15
WP_060471679.1|1013608_1014268_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060471680.1|1014319_1015015_+	glycerophosphodiester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.8e-14
WP_060471683.1|1018792_1019995_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	29.8	4.3e-40
WP_060471684.1|1020157_1021564_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_082990787.1|1021667_1022933_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471685.1|1023211_1024489_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	1.7e-10
WP_060471686.1|1024536_1025388_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1113537	1180007	2317164	protease,tRNA,bacteriocin,transposase	Streptococcus_phage(18.18%)	51	NA	NA
WP_060471749.1|1113537_1114395_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471750.1|1114391_1114718_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_060471751.1|1114723_1115488_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_060471752.1|1115783_1118183_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_060471753.1|1118249_1119098_+	patatin family protein	NA	NA	NA	NA	NA
WP_060471754.1|1122651_1123500_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060471197.1|1124561_1125740_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_190299902.1|1126414_1127644_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.4	2.1e-122
WP_060471756.1|1129371_1130139_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060471757.1|1130662_1131148_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003633284.1|1131272_1131530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471758.1|1132345_1133707_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014919185.1|1135547_1136252_+	lysozyme	NA	NA	NA	NA	NA
WP_060471759.1|1136251_1137499_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	2.8e-34
WP_060471760.1|1137482_1138811_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014919182.1|1138976_1139165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471761.1|1139272_1140415_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.6	4.2e-29
WP_060471762.1|1140438_1140978_-	GtrA family protein	NA	NA	NA	NA	NA
WP_060471763.1|1140970_1141417_-	flavodoxin	NA	NA	NA	NA	NA
WP_003633294.1|1141560_1142388_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_060471764.1|1142396_1143320_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_060471765.1|1143381_1144281_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.3e-73
WP_060471766.1|1144476_1145793_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	40.1	1.3e-58
WP_060471767.1|1146024_1147185_+	thiolase family protein	NA	NA	NA	NA	NA
WP_060471768.1|1147184_1148396_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_060471769.1|1148395_1149559_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003626759.1|1149597_1149882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471770.1|1151290_1152673_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.7	1.8e-66
WP_060471771.1|1152794_1153607_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_060471772.1|1153616_1154099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627789.1|1154100_1154562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471773.1|1154667_1155537_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_060471774.1|1155539_1157111_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	25.4	3.0e-33
WP_014563970.1|1157181_1157463_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_060471775.1|1158766_1160956_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.4	9.7e-123
WP_190299879.1|1161146_1161329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718606.1|1161442_1161709_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_060471777.1|1161708_1163442_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_060471778.1|1163675_1164074_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_060471779.1|1164165_1164906_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_060471780.1|1164983_1165832_+	competence protein	NA	NA	NA	NA	NA
WP_060471781.1|1165840_1166458_-	DsbA family protein	NA	NA	NA	NA	NA
WP_060471782.1|1166543_1167152_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_060471783.1|1167275_1167908_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_060471784.1|1167904_1168717_+	NAD kinase	NA	NA	NA	NA	NA
WP_060471785.1|1168700_1169597_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.5	1.8e-06
WP_060471001.1|1171061_1172339_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060471787.1|1173791_1174820_-	lactonase family protein	NA	NA	NA	NA	NA
WP_060471788.1|1174972_1177729_+	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.3	4.2e-75
WP_060471789.1|1178195_1179395_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060471790.1|1179446_1180007_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1203215	1261226	2317164	tRNA,transposase	Streptococcus_phage(26.67%)	42	NA	NA
WP_082990798.1|1203215_1204439_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.7e-121
WP_060471808.1|1205170_1206895_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.2	1.8e-148
WP_060471809.1|1206997_1209046_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_060471810.1|1209035_1211876_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	7.7e-306
WP_060471811.1|1211940_1212483_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_082990799.1|1212541_1213846_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.1	6.3e-45
WP_060471812.1|1214053_1214935_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	4.2e-08
WP_060471813.1|1214945_1215989_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.5	3.7e-88
WP_060471814.1|1215981_1216917_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	6.3e-47
WP_005718663.1|1216968_1217553_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.4	1.1e-52
WP_060471816.1|1219322_1220180_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471817.1|1220338_1221964_+	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_082990734.1|1224446_1225676_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	3.2e-123
WP_060471819.1|1229397_1230429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471820.1|1230484_1231501_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060471821.1|1231612_1232824_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_060471822.1|1232849_1233608_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_060471823.1|1233765_1235472_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.5	3.2e-89
WP_060471825.1|1236290_1237589_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	7.4e-38
WP_012211631.1|1237666_1238188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471826.1|1238194_1239076_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_060471827.1|1239144_1239843_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	42.6	3.5e-42
WP_060471828.1|1239854_1240844_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_060471829.1|1240843_1241323_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_060471830.1|1241361_1241895_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	36.6	1.5e-21
WP_060471831.1|1241992_1242889_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_082990735.1|1242954_1244052_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.1	2.2e-35
WP_060471833.1|1244041_1244854_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060471834.1|1244850_1245666_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060471835.1|1245662_1246736_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060471836.1|1246793_1247636_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_060471837.1|1247632_1248592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626072.1|1248622_1249975_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_060471838.1|1250882_1251698_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_060471839.1|1251714_1252428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633503.1|1252431_1252899_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_060471840.1|1252903_1254058_-	glycerate kinase	NA	NA	NA	NA	NA
WP_060471841.1|1255390_1256347_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471842.1|1258380_1258566_+	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_060471843.1|1258661_1259177_+	VanZ family protein	NA	NA	NA	NA	NA
WP_060471844.1|1259267_1259996_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060471024.1|1260176_1261226_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
>prophage 13
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1267359	1328313	2317164	tRNA,integrase,transposase	Bacillus_phage(18.75%)	54	1283257:1283282	1290222:1290247
WP_060471282.1|1267359_1268766_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471851.1|1269334_1270300_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_060471852.1|1270334_1270727_+	SdpI family protein	NA	NA	NA	NA	NA
WP_060471853.1|1270726_1271449_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	9.2e-38
WP_060471854.1|1271448_1272906_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.7	1.8e-32
WP_060471855.1|1272959_1275155_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.3	1.1e-150
WP_003626132.1|1275279_1275894_+	VanZ family protein	NA	NA	NA	NA	NA
WP_060471856.1|1275969_1277310_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_060471857.1|1277567_1278845_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	1.7e-10
WP_082990676.1|1280547_1281777_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	1.5e-64
WP_060471858.1|1282032_1283046_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.7	5.3e-07
1283257:1283282	attL	TTCGAGCCCCAATATCTCAATAGTAA	NA	NA	NA	NA
WP_065214119.1|1283609_1283990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082990800.1|1285367_1286507_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	45.5	2.2e-86
WP_060471860.1|1287010_1287286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471861.1|1287330_1287528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471862.1|1287530_1287755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471863.1|1287758_1287977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471864.1|1287969_1288185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060471865.1|1288318_1288855_+	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	37.9	1.6e-10
WP_060471866.1|1288993_1290151_+|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	38.4	5.8e-58
WP_060471867.1|1290328_1291681_-	Mur ligase family protein	NA	NA	NA	NA	NA
1290222:1290247	attR	TTCGAGCCCCAATATCTCAATAGTAA	NA	NA	NA	NA
WP_060471868.1|1291830_1292430_+	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	48.5	5.3e-47
WP_014563879.1|1292446_1293535_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
WP_060471869.1|1293527_1294370_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_060471870.1|1294375_1295377_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.9	1.5e-49
WP_060471871.1|1295460_1296090_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_060471872.1|1296214_1296928_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_005718768.1|1296947_1297172_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_060471873.1|1297223_1297733_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_060471874.1|1297732_1298281_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_012211671.1|1298295_1299807_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_060471875.1|1299817_1300780_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_060471876.1|1300801_1302241_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_012211673.1|1302252_1302693_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_060471877.1|1302756_1302987_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_060471878.1|1303070_1304060_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_082990736.1|1304073_1304367_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_060471879.1|1304375_1304603_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_060471880.1|1304624_1305818_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_060471881.1|1305882_1306347_-	universal stress protein	NA	NA	NA	NA	NA
WP_060471882.1|1307380_1307662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471883.1|1309555_1310869_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	1.3e-101
WP_060471884.1|1310868_1311336_-	YueI family protein	NA	NA	NA	NA	NA
WP_060471885.1|1311425_1312037_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_060471886.1|1312318_1314028_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_060471887.1|1314118_1315279_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.3	1.9e-37
WP_060471888.1|1315278_1316496_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_082990737.1|1319115_1319895_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060471889.1|1319900_1320680_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_190299881.1|1322465_1322642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471890.1|1322638_1322986_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060471891.1|1323042_1323258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060471892.1|1326358_1327675_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.0	1.4e-55
WP_060471558.1|1327704_1328313_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	2.6e-33
>prophage 14
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1374270	1442690	2317164	tRNA,transposase,protease	unidentified_phage(13.33%)	56	NA	NA
WP_060471922.1|1374270_1377054_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.5	5.8e-88
WP_003627651.1|1377053_1377257_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_060471923.1|1377276_1377846_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060471924.1|1377848_1378157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471925.1|1378174_1378870_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_060471926.1|1378871_1380029_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	34.8	5.8e-26
WP_060471927.1|1380076_1380418_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_060471928.1|1380425_1381553_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_060471929.1|1383104_1383764_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_060471930.1|1383763_1384408_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060471931.1|1384407_1386759_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.9	3.6e-59
WP_060471932.1|1387948_1389226_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	5.8e-11
WP_060471933.1|1389273_1390953_-	ribonuclease J	NA	NA	NA	NA	NA
WP_060471934.1|1390959_1391181_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_060471935.1|1391531_1392086_-	peptide deformylase	NA	K4JRM9	Caulobacter_phage	41.3	2.1e-10
WP_060471936.1|1392337_1394182_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.0	8.1e-22
WP_060471937.1|1394277_1395459_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_060471938.1|1395455_1395800_+	YlbG family protein	NA	NA	NA	NA	NA
WP_060471939.1|1395796_1396345_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003627939.1|1396347_1396842_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
WP_060471940.1|1396825_1397860_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_060471941.1|1397937_1398633_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060471942.1|1398601_1400890_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	37.7	2.9e-21
WP_060471943.1|1400886_1401873_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_014919008.1|1401933_1402191_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_060471944.1|1402389_1402659_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_060471945.1|1402814_1404587_+	ribonuclease J	NA	NA	NA	NA	NA
WP_060471946.1|1404589_1405423_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060471947.1|1405612_1406803_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	2.3e-30
WP_060471948.1|1406948_1408250_+	trigger factor	NA	NA	NA	NA	NA
WP_060471949.1|1408400_1409675_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.9	4.3e-131
WP_060471950.1|1409664_1410255_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_060471951.1|1411930_1412935_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_060471952.1|1412927_1414301_-	aspartate kinase	NA	NA	NA	NA	NA
WP_060471953.1|1414771_1416088_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_060471954.1|1416107_1416818_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_060471955.1|1416820_1417975_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_060471956.1|1417976_1418912_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_060472617.1|1418904_1419684_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_060471957.1|1419704_1420868_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_060471958.1|1420887_1421946_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_150121909.1|1422048_1423149_+	serine hydrolase	NA	NA	NA	NA	NA
WP_060471960.1|1423573_1425184_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_060471961.1|1425481_1426333_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471962.1|1426756_1427230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471963.1|1427332_1428262_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_060471964.1|1428400_1429321_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060471966.1|1431053_1432340_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_014563771.1|1433443_1434019_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_060471967.1|1434127_1434985_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060471969.1|1436205_1436505_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	35.4	9.4e-05
WP_082990802.1|1436526_1436646_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_060471970.1|1438593_1440000_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060471971.1|1440133_1441090_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.9	2.3e-113
WP_060472619.1|1441104_1441644_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	1.1e-24
WP_060471972.1|1441640_1442690_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.0	1.2e-49
>prophage 15
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1453842	1506401	2317164	tRNA,transposase	Lysinibacillus_phage(16.67%)	37	NA	NA
WP_082990745.1|1453842_1455072_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.6	4.8e-63
WP_060471982.1|1455309_1456569_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.3	4.9e-10
WP_060471985.1|1458210_1459137_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_190299882.1|1462347_1463529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471986.1|1463626_1464940_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.1	1.9e-57
WP_060471197.1|1465315_1466494_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060471987.1|1466642_1468109_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_060471988.1|1468187_1468979_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060471989.1|1469069_1470122_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_003628158.1|1470111_1470405_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_060471990.1|1470405_1471320_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_060471991.1|1471291_1472851_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_060471992.1|1474377_1475574_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_150121947.1|1475675_1476917_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	1.6e-10
WP_060471993.1|1477015_1478065_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	3.5e-46
WP_060471994.1|1478346_1478640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471995.1|1478787_1479243_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_003626603.1|1479273_1479432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060471996.1|1481984_1482542_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060471997.1|1482673_1483054_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_060471998.1|1483309_1483642_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	46.2	8.8e-20
WP_060471999.1|1484766_1486113_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_060472000.1|1486215_1486722_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_060472001.1|1488351_1488861_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_060472002.1|1488921_1489869_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_060472622.1|1489924_1490287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472003.1|1490301_1492542_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	35.7	1.7e-10
WP_060472004.1|1492541_1492979_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014918921.1|1493286_1494573_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	1.8e-20
WP_060472005.1|1494578_1496432_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	1.7e-11
WP_060472006.1|1496486_1497671_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_060471197.1|1497977_1499156_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472623.1|1499484_1500678_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.7	7.8e-42
WP_060472007.1|1500849_1501686_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.9	2.6e-36
WP_060472008.1|1501732_1502545_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_060472009.1|1503637_1505023_-	amino acid permease	NA	NA	NA	NA	NA
WP_082990803.1|1505135_1506401_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.6	3.3e-51
>prophage 16
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1536606	1596652	2317164	tRNA,integrase,transposase,protease	unidentified_phage(17.65%)	48	1550756:1550772	1593724:1593740
WP_060472034.1|1536606_1537806_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	1.1e-48
WP_060472035.1|1537843_1538536_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_060472626.1|1538652_1539483_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	2.4e-21
WP_060472036.1|1539485_1539716_+	YozE family protein	NA	NA	NA	NA	NA
WP_060472037.1|1539763_1541356_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_060472038.1|1541379_1542231_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012211825.1|1542220_1542973_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_060472039.1|1543033_1543882_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	6.3e-30
WP_060472040.1|1543952_1546067_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.5	5.5e-99
WP_060472041.1|1546088_1547405_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_060472042.1|1547404_1548313_+	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.4	1.8e-14
WP_060472043.1|1548321_1548846_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_060472044.1|1548856_1550260_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	24.7	1.7e-27
WP_060472045.1|1550412_1551312_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
1550756:1550772	attL	ATAATTTGATGAATAAT	NA	NA	NA	NA
WP_082990748.1|1551494_1552799_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.7	2.2e-45
WP_060472046.1|1553749_1554115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472047.1|1554274_1555363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472048.1|1555925_1556696_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_060472049.1|1557463_1558168_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_060472050.1|1558148_1558964_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_060472051.1|1559453_1559837_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	37.4	4.7e-09
WP_060472052.1|1559838_1560216_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_060471197.1|1560290_1561469_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_082990749.1|1562119_1563373_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.4	6.6e-116
WP_060472054.1|1565447_1566725_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	9.9e-11
WP_060472055.1|1567321_1568647_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	3.6e-56
WP_060472056.1|1568981_1571078_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_060472057.1|1571094_1572354_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_082990751.1|1572419_1573103_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_060472058.1|1573095_1574436_-	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_060472059.1|1574533_1576306_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	1.7e-77
WP_060472060.1|1576414_1576864_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_060472061.1|1577025_1578432_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_060472062.1|1578700_1579333_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_060472629.1|1579420_1580035_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_060472063.1|1580158_1581256_+	serine hydrolase	NA	NA	NA	NA	NA
WP_060472630.1|1581322_1582150_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_023191946.1|1582149_1582707_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_060472064.1|1582788_1583994_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_060472066.1|1584601_1585900_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_060472067.1|1587031_1588084_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.0	1.3e-48
WP_060472069.1|1588663_1589950_+	peptidase T	NA	NA	NA	NA	NA
WP_060472070.1|1590165_1590723_+	Fic family protein	NA	NA	NA	NA	NA
WP_060472071.1|1591249_1592854_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.4	9.2e-14
WP_057730255.1|1592843_1594427_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.5	1.5e-19
1593724:1593740	attR	ATAATTTGATGAATAAT	NA	NA	NA	NA
WP_060472072.1|1594433_1595174_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_012211854.1|1595186_1595564_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_060471024.1|1595602_1596652_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
>prophage 17
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1600797	1665238	2317164	transposase	Streptococcus_phage(28.57%)	45	NA	NA
WP_060471197.1|1600797_1601976_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014918851.1|1602152_1602863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472075.1|1604345_1604783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563659.1|1604870_1605347_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211860.1|1605611_1606031_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_060472077.1|1606322_1607180_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150121912.1|1607785_1608070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472079.1|1608307_1609357_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.0	7.6e-49
WP_060472080.1|1609453_1609813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472081.1|1610585_1610864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173001848.1|1612995_1613157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472083.1|1613211_1613871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150121914.1|1614061_1614730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472085.1|1614920_1615505_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.0	3.5e-19
WP_060472086.1|1615659_1615839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472087.1|1616156_1616705_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	3.5e-29
WP_060472088.1|1616706_1618161_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	7.2e-98
WP_060472089.1|1618276_1618981_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	31.8	3.1e-06
WP_060472090.1|1619734_1620268_+	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	29.2	2.6e-13
WP_082990753.1|1622825_1623083_+	DUF3923 family protein	NA	NA	NA	NA	NA
WP_060472092.1|1623373_1623991_+	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_060472093.1|1625217_1627077_+	DNA mismatch repair protein MutS	NA	F2Y1C6	Organic_Lake_phycodnavirus	32.1	1.5e-07
WP_060472094.1|1627123_1627354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472095.1|1627403_1627607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472096.1|1627924_1629430_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.5	6.0e-23
WP_060471098.1|1631035_1632238_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	29.8	4.3e-40
WP_060472097.1|1632566_1633472_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_060472098.1|1636697_1641980_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.7	1.1e-07
WP_060471015.1|1642270_1643449_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_082990676.1|1643626_1644856_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	1.5e-64
WP_060472099.1|1645093_1646353_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.6	9.8e-11
WP_060472100.1|1646539_1648474_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060472101.1|1648668_1649394_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_060472102.1|1649404_1651066_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_060472103.1|1651112_1652693_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_060472104.1|1652841_1653279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472105.1|1653449_1654004_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_190299908.1|1654061_1655312_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.3	1.7e-124
WP_012211876.1|1655430_1655802_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060472107.1|1655855_1656749_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_060472109.1|1658327_1659593_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_060472110.1|1659602_1660421_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_060472111.1|1660413_1660905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472112.1|1663257_1664178_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_060471009.1|1664188_1665238_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	7.8e-46
>prophage 18
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1744987	1791100	2317164	integrase,transposase	Bacillus_virus(18.18%)	29	1742482:1742497	1747025:1747040
1742482:1742497	attL	AAAATACTTAAGCAAA	NA	NA	NA	NA
WP_003626321.1|1744987_1745608_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	4.3e-20
WP_060472164.1|1745864_1746143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472165.1|1747673_1747871_+	hypothetical protein	NA	NA	NA	NA	NA
1747025:1747040	attR	AAAATACTTAAGCAAA	NA	NA	NA	NA
WP_060472166.1|1747913_1749254_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060472170.1|1752383_1753142_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057729960.1|1753297_1753564_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_060472171.1|1755101_1755371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472172.1|1756255_1756738_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060472173.1|1758139_1758658_+	hypothetical protein	NA	M1PSC3	Streptococcus_phage	37.2	1.9e-21
WP_060472174.1|1758746_1759214_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_060472181.1|1762762_1763389_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_060472182.1|1763485_1765432_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.4	4.1e-117
WP_060472183.1|1765448_1767905_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.6e-96
WP_060472184.1|1768050_1769025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060472185.1|1769045_1769981_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_060472186.1|1770681_1771035_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_060471015.1|1772450_1773629_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472188.1|1775278_1776130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060472189.1|1776177_1777443_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	7.5e-11
WP_023061618.1|1777565_1777820_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_082990763.1|1778471_1779242_+	DUF1906 domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	52.5	1.0e-58
WP_060472190.1|1780173_1780782_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	43.8	1.3e-37
WP_060472191.1|1780827_1781319_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	35.5	8.5e-19
WP_060472192.1|1781325_1781781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472195.1|1783492_1784575_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_060472196.1|1784818_1785868_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	1.6e-46
WP_060472197.1|1787446_1788328_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	5.8e-10
WP_060472198.1|1788401_1788818_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082990787.1|1789834_1791100_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 19
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1812090	1859544	2317164	tRNA,integrase,transposase	Streptococcus_phage(20.0%)	35	1845434:1845493	1853486:1853547
WP_060472211.1|1812090_1813389_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.3	3.3e-46
WP_060472634.1|1813442_1813940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472212.1|1813926_1816722_-	DEAD/DEAH box helicase	NA	A0A1X9I5C8	Streptococcus_phage	27.0	7.9e-69
WP_060472213.1|1816740_1820355_-	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	24.1	5.5e-22
WP_060472214.1|1820357_1823840_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_060472215.1|1823921_1824830_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_060472216.1|1824829_1825792_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_060472217.1|1825835_1826918_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_060472218.1|1826930_1827947_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_060472219.1|1827998_1829381_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060472220.1|1829355_1830339_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060472221.1|1830328_1831081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472222.1|1831166_1831736_+	signal peptidase I	NA	NA	NA	NA	NA
WP_060471024.1|1831786_1832836_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
WP_060472223.1|1832993_1833185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472224.1|1834619_1835408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472225.1|1835421_1836252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472226.1|1836262_1837108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472227.1|1837107_1837815_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	8.2e-15
WP_060472228.1|1837816_1838182_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060472229.1|1838443_1839685_-	peptidase T	NA	NA	NA	NA	NA
WP_060472230.1|1839704_1840502_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_060472231.1|1840494_1841181_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014563473.1|1841280_1841721_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_060472232.1|1841720_1842377_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_060472233.1|1842525_1843785_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	2.9e-10
WP_082990764.1|1844023_1845253_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	2.0e-64
1845434:1845493	attL	AGAAAAAGAACCAAACAGCCTTTTAATGACTGCCTGATTCTATTCATTTACTCTCTATCA	NA	NA	NA	NA
WP_060472235.1|1845631_1847038_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014563242.1|1847219_1847597_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.2	2.9e-11
WP_014563241.1|1847690_1849055_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060471015.1|1850166_1851345_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472237.1|1853579_1854692_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	1.1e-37
1853486:1853547	attR	AGAAAAAGAACCAAACAGCCTTTTAATGACTGCCTGATTCTATTCATTTACTCTCTATCAAC	NA	NA	NA	NA
WP_060472238.1|1854708_1856544_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.1	4.5e-57
WP_060472239.1|1856570_1858634_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_060472240.1|1858626_1859544_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1867192	1911159	2317164	terminase,plate,transposase,portal,capsid,integrase,tail	Lactobacillus_phage(82.05%)	58	1893551:1893584	1914307:1914340
WP_060472247.1|1867192_1868314_-	lysin	NA	Q71JA9	Lactobacillus_phage	82.8	6.4e-179
WP_060472248.1|1868376_1868793_-	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	37.2	5.0e-12
WP_060472249.1|1868794_1869034_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	72.2	1.6e-23
WP_060472250.1|1869017_1869239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472637.1|1869249_1869639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472251.1|1869607_1869793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472252.1|1869809_1870409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472253.1|1870509_1870851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150121925.1|1870900_1871284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472255.1|1871294_1873559_-	hypothetical protein	NA	L0P6E1	Lactobacillus_phage	40.4	2.3e-103
WP_060472256.1|1873562_1874144_-	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	83.6	9.8e-83
WP_060472257.1|1874136_1875282_-|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	90.0	9.0e-197
WP_060472638.1|1875271_1875685_-	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	97.8	8.3e-68
WP_060472258.1|1875710_1876055_-	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	93.9	6.1e-56
WP_060472259.1|1876027_1877095_-	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	90.7	3.2e-180
WP_060472260.1|1877091_1877790_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	94.4	1.3e-113
WP_150121949.1|1877796_1878270_-	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	88.5	1.4e-55
WP_060472261.1|1881075_1881492_-	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	97.8	1.2e-66
WP_060472262.1|1881504_1881981_-|tail	phage tail protein	tail	L0P6D4	Lactobacillus_phage	92.9	6.4e-80
WP_060472263.1|1881992_1883453_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	L0P8M7	Lactobacillus_phage	90.5	1.1e-252
WP_060472264.1|1883456_1883660_-	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	80.6	2.2e-21
WP_060472265.1|1883628_1884054_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	94.3	1.4e-73
WP_060472266.1|1884050_1884452_-	HK97 gp10 family phage protein	NA	A9D9U1	Lactobacillus_prophage	53.5	1.1e-37
WP_060472267.1|1884448_1884811_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	67.5	1.4e-39
WP_060472268.1|1884807_1885179_-	hypothetical protein	NA	L0P6D1	Lactobacillus_phage	91.9	1.1e-58
WP_060472269.1|1885194_1886274_-	hypothetical protein	NA	X2CY65	Lactobacillus_phage	79.2	1.2e-163
WP_060472270.1|1886277_1886820_-	phage scaffolding protein	NA	L0P7B0	Lactobacillus_phage	67.4	3.5e-58
WP_060472271.1|1886946_1888011_-|capsid	minor capsid protein	capsid	A9D9S7	Lactobacillus_prophage	64.7	5.0e-125
WP_060472272.1|1888022_1889492_-|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	66.7	1.1e-178
WP_060472273.1|1889482_1890712_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	69.1	9.4e-176
WP_060472274.1|1890698_1891193_-	helix-turn-helix domain-containing protein	NA	L0P6X1	Lactobacillus_phage	55.5	7.7e-36
WP_060472275.1|1891804_1892245_-	hypothetical protein	NA	L0P6G6	Lactobacillus_phage	92.5	1.3e-71
WP_190299884.1|1892362_1892908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472278.1|1893072_1893423_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	80.2	4.7e-48
WP_060472279.1|1893549_1893969_-	hypothetical protein	NA	A0A1W6JQL4	Staphylococcus_phage	36.4	1.3e-07
1893551:1893584	attL	TATTTGATAATTGTACTCGTGTGTACGTTTCCAA	NA	NA	NA	NA
WP_150121926.1|1894074_1894326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472281.1|1894334_1894610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082990804.1|1894599_1895013_-	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	42.4	8.4e-12
WP_060472282.1|1895147_1895348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472283.1|1895630_1897952_-	DNA primase	NA	Q9T1H6	Lactobacillus_phage	78.8	0.0e+00
WP_060472284.1|1898009_1898546_-	DUF669 domain-containing protein	NA	Q9T1H8	Lactobacillus_phage	75.8	4.8e-76
WP_060472285.1|1898563_1899925_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	52.1	7.3e-129
WP_060472286.1|1899933_1900596_-	AAA family ATPase	NA	Q9T1I1	Lactobacillus_phage	74.4	4.1e-101
WP_060472287.1|1900595_1900838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472288.1|1900830_1901112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472289.1|1901095_1901434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190299885.1|1901463_1901628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472290.1|1901617_1901917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472291.1|1901943_1902693_-	phage antirepressor KilAC domain-containing protein	NA	Q6SEF4	Lactobacillus_prophage	68.7	6.7e-92
WP_060472292.1|1902708_1902897_-	helix-turn-helix transcriptional regulator	NA	Q9T1I7	Lactobacillus_phage	53.2	1.3e-12
WP_060472293.1|1903162_1903504_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SA75	Streptococcus_phage	35.7	1.4e-12
WP_060472294.1|1903496_1903898_+	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	37.5	3.0e-22
WP_150121927.1|1903974_1904202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472296.1|1904436_1904634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472297.1|1904647_1904869_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	64.5	1.6e-17
WP_060472298.1|1905067_1906198_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	42.6	1.7e-70
WP_060472299.1|1906289_1907168_+	YitT family protein	NA	NA	NA	NA	NA
WP_060472300.1|1909752_1911159_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
1914307:1914340	attR	TTGGAAACGTACACACGAGTACAATTATCAAATA	NA	NA	NA	NA
>prophage 21
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	1920841	1999849	2317164	tRNA,transposase,protease	Streptococcus_phage(10.53%)	59	NA	NA
WP_060471024.1|1920841_1921891_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
WP_060472305.1|1926098_1926965_-	homoserine kinase	NA	NA	NA	NA	NA
WP_060472306.1|1926979_1928209_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_060472307.1|1928323_1929814_+	threonine synthase	NA	NA	NA	NA	NA
WP_060472308.1|1929828_1931190_+	aspartate kinase	NA	NA	NA	NA	NA
WP_060472311.1|1932383_1933709_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	1.6e-56
WP_060471558.1|1933738_1934347_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	2.6e-33
WP_060472312.1|1934707_1935235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472313.1|1935311_1935917_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_014918655.1|1935919_1936081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472314.1|1936096_1937263_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060472316.1|1939189_1939726_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_060472640.1|1941724_1942954_-	arginine deiminase	NA	NA	NA	NA	NA
WP_060472317.1|1943018_1943873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060472318.1|1944001_1946275_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.2	7.1e-44
WP_082990766.1|1946342_1946843_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_082990767.1|1947069_1947246_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_082990768.1|1948610_1949405_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_060472320.1|1949420_1950350_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.9	3.4e-101
WP_060472321.1|1950492_1951020_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_060472322.1|1951124_1953398_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.7	3.7e-77
WP_060472323.1|1953518_1954208_-	class A sortase	NA	NA	NA	NA	NA
WP_060472324.1|1954210_1956049_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
WP_003628994.1|1956217_1956433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472325.1|1957668_1958946_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.2	3.8e-10
WP_060472326.1|1960752_1961907_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	29.4	1.3e-20
WP_060472327.1|1961988_1963848_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.9	9.3e-143
WP_060472328.1|1963864_1964446_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_060472329.1|1964461_1965511_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_060472330.1|1965788_1967066_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	1.8e-12
WP_060472331.1|1967150_1968113_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_060472332.1|1968118_1969012_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_060472333.1|1969063_1969429_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_060472334.1|1969448_1972055_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.7	9.7e-21
WP_060472335.1|1972059_1972371_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_012212001.1|1972373_1972670_-	YlxR family protein	NA	NA	NA	NA	NA
WP_060472642.1|1972678_1973860_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_060472336.1|1973879_1974356_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_060472337.1|1974465_1978776_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	6.8e-19
WP_060472338.1|1978781_1980479_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060472339.1|1980522_1981779_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_060472340.1|1981789_1982605_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_060472341.1|1982606_1983341_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.7	8.5e-23
WP_060472342.1|1983343_1983901_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_060472343.1|1983900_1984626_-	UMP kinase	NA	NA	NA	NA	NA
WP_060472344.1|1984764_1985790_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_060472345.1|1985823_1986597_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_060472346.1|1986758_1987790_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_060472347.1|1987855_1988470_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_060472348.1|1988592_1989774_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	6.1e-47
WP_060472349.1|1989831_1991775_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.5	9.3e-61
WP_060472350.1|1991869_1993663_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.5	1.1e-18
WP_060472351.1|1993655_1995413_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.2	3.8e-45
WP_012212011.1|1995494_1995713_-	YneF family protein	NA	NA	NA	NA	NA
WP_082990769.1|1995775_1996039_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_060472352.1|1996188_1996815_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.2	1.5e-12
WP_060472353.1|1996843_1997629_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003629071.1|1998669_1999017_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_060472354.1|1999129_1999849_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	2004842	2062883	2317164	tRNA,transposase	Prochlorococcus_phage(13.33%)	48	NA	NA
WP_060471001.1|2004842_2006120_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060472358.1|2006208_2007630_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_060472359.1|2007672_2008965_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_060472360.1|2008965_2012535_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_060472361.1|2012550_2013237_-	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.1	6.9e-19
WP_060472362.1|2015307_2017059_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060472363.1|2017261_2018191_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060472364.1|2018205_2019165_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060472365.1|2019167_2020154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	4.8e-13
WP_060472366.1|2020157_2021192_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	7.0e-15
WP_060472367.1|2021312_2021555_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	55.4	2.4e-06
WP_060472368.1|2021585_2022587_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_060472644.1|2022607_2024638_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_060472369.1|2024639_2026301_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_060472370.1|2026322_2026685_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_014563392.1|2026841_2027027_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_060472371.1|2027342_2028029_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_060472372.1|2028028_2028679_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_060472373.1|2028691_2029582_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_060472374.1|2029582_2031598_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	27.1	7.5e-21
WP_060472645.1|2031587_2032343_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_082990770.1|2032347_2033712_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_060472376.1|2033662_2034607_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.7	2.8e-10
WP_060472377.1|2034620_2037020_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_003627587.1|2037069_2037294_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_060472378.1|2037296_2037911_-	guanylate kinase	NA	A0A1C9KBX3	Skunkpox_virus	29.8	2.4e-18
WP_060472379.1|2038044_2039451_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_082990787.1|2039554_2040820_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060471460.1|2041596_2042646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.3	2.6e-49
WP_060472380.1|2042755_2044438_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_060472381.1|2044448_2045261_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_060472382.1|2045261_2046131_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_060472383.1|2046133_2046376_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_060472384.1|2046378_2047722_-	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	32.1	7.7e-30
WP_060472385.1|2047711_2048560_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.7	6.5e-43
WP_060472385.1|2049590_2050439_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.7	6.5e-43
WP_060472386.1|2050497_2050890_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_060472387.1|2050897_2051323_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_060472388.1|2051340_2051910_-	elongation factor P	NA	NA	NA	NA	NA
WP_060472389.1|2051993_2053103_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_060472390.1|2053344_2054622_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	3.4e-11
WP_060472391.1|2054682_2054973_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003627604.1|2054991_2055303_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_060472392.1|2055469_2056837_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_060472393.1|2056975_2058001_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003547962.1|2059343_2059523_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_060472394.1|2059593_2061390_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_060472395.1|2061605_2062883_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	8.4e-10
>prophage 23
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	2079673	2140080	2317164	protease,transposase	Paramecium_bursaria_Chlorella_virus(22.22%)	53	NA	NA
WP_060471579.1|2079673_2081080_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_082990791.1|2081183_2082449_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_060472412.1|2082861_2086050_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_060472413.1|2086042_2087128_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.8	5.1e-56
WP_060472414.1|2087127_2088405_-	dihydroorotase	NA	NA	NA	NA	NA
WP_060472415.1|2088404_2089361_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.3	2.2e-26
WP_060472416.1|2089506_2090049_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_060472417.1|2090215_2091139_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_060472418.1|2091393_2092098_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003627631.1|2092099_2092723_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
WP_060472419.1|2092975_2093236_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_060472420.1|2093455_2094634_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472421.1|2097026_2098112_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	51.1	7.0e-82
WP_060472422.1|2098178_2099726_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	8.1e-15
WP_060472423.1|2099706_2100834_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060472424.1|2100830_2101787_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060472425.1|2102002_2104627_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.2	5.6e-85
WP_003630981.1|2106145_2106790_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_082990771.1|2106887_2107094_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_025283725.1|2107086_2107347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011678534.1|2107515_2108730_-	MFS transporter	NA	NA	NA	NA	NA
WP_060472427.1|2108878_2109178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472646.1|2109321_2109870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472428.1|2110044_2110359_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_007126420.1|2110405_2111266_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060472429.1|2111278_2112019_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.1e-25
WP_060472430.1|2112028_2112703_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003627894.1|2112683_2113343_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060472431.1|2113510_2113744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082990772.1|2114051_2115281_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.1	4.2e-115
WP_150121929.1|2115821_2117567_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041808687.1|2117891_2118425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472434.1|2118464_2118812_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_150121930.1|2118830_2119100_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_190299886.1|2119093_2119270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082990773.1|2119348_2120518_-	MFS transporter	NA	NA	NA	NA	NA
WP_060472437.1|2120731_2121028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472438.1|2121141_2121435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472439.1|2123017_2123680_+	serine dehydratase	NA	NA	NA	NA	NA
WP_060472440.1|2123695_2124577_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_060472647.1|2124581_2124908_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_060472648.1|2126700_2127321_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_054607281.1|2127434_2127668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472441.1|2127711_2128566_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_060472442.1|2128565_2129246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472443.1|2130341_2130554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060472444.1|2131108_2133220_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_150121931.1|2133774_2134002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472446.1|2134119_2134977_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060472447.1|2135119_2136301_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060472448.1|2136540_2137785_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_060472449.1|2137876_2138851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472450.1|2138901_2140080_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	2172387	2224265	2317164	tRNA,transposase,protease	unidentified_phage(14.29%)	37	NA	NA
WP_060472478.1|2172387_2173437_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	2.1e-46
WP_060472479.1|2173494_2174832_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060471001.1|2175039_2176317_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060472480.1|2176411_2177407_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_060472481.1|2177525_2178989_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_060472482.1|2179010_2180177_-	galactokinase	NA	NA	NA	NA	NA
WP_060471693.1|2180741_2181920_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_082990777.1|2183369_2184383_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060472650.1|2184450_2185089_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_060472483.1|2185103_2185574_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_082990778.1|2185818_2186436_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060472484.1|2186685_2188029_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|2188041_2188311_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_060471558.1|2191518_2192127_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.6	2.6e-33
WP_060472485.1|2193106_2195023_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_060472489.1|2197351_2198359_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060472490.1|2198603_2200490_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	4.8e-94
WP_060472491.1|2200473_2201430_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_060472492.1|2201534_2202527_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
WP_060472493.1|2202663_2203002_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060472494.1|2203044_2203695_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_082990779.1|2205380_2206643_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	36.6	8.8e-60
WP_060472496.1|2206949_2207939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472497.1|2208039_2208945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471015.1|2209757_2210936_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472498.1|2211051_2211330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472499.1|2211582_2212920_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_060472500.1|2214096_2215017_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_060472501.1|2215095_2215497_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003627075.1|2215555_2215783_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_060472502.1|2215783_2216464_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627079.1|2216484_2217045_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_060472503.1|2217094_2217244_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_060472504.1|2217320_2219429_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_060472505.1|2219519_2222111_+	YfhO family protein	NA	NA	NA	NA	NA
WP_060472506.1|2222218_2223142_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_082990780.1|2223233_2224265_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.0	2.8e-32
>prophage 25
NZ_CP012890	Lactobacillus gallinarum strain HFD4 chromosome, complete genome	2317164	2227360	2296641	2317164	tRNA,transposase	Bacillus_phage(20.0%)	54	NA	NA
WP_060472509.1|2227360_2229775_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_060472510.1|2229778_2230828_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_060472511.1|2231112_2231463_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060472512.1|2231574_2232342_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_060472513.1|2232439_2232712_+	acylphosphatase	NA	NA	NA	NA	NA
WP_060472514.1|2232758_2233721_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003627102.1|2233770_2234259_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_060472515.1|2234295_2235855_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_060472516.1|2235841_2236558_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	1.8e-25
WP_060472517.1|2236721_2237276_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_060472518.1|2237277_2238429_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003627111.1|2238434_2238782_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_060472519.1|2238803_2239397_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_060472520.1|2239377_2240043_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_025283797.1|2240053_2241163_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_014563231.1|2241155_2241680_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_060472521.1|2241824_2242181_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_060472522.1|2242224_2242425_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_082990781.1|2242446_2242980_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.2	6.8e-14
WP_082990782.1|2246859_2247027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060472524.1|2247439_2247694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060471015.1|2248424_2249603_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472525.1|2251438_2252617_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472526.1|2253426_2253948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472527.1|2254105_2256040_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.7	1.4e-96
WP_060472528.1|2256330_2257239_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.8	1.8e-27
WP_060472529.1|2257270_2258602_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_060472530.1|2258604_2259072_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_060472531.1|2259074_2259677_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_060472532.1|2259673_2260504_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_060472533.1|2260512_2263176_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.5	1.2e-61
WP_060471001.1|2263417_2264695_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060472534.1|2266153_2266576_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060472535.1|2266686_2267946_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_060472538.1|2270110_2271148_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	41.2	3.2e-60
WP_060472539.1|2271149_2272601_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.0	1.4e-56
WP_060472540.1|2272585_2274805_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.4	4.2e-142
WP_060472541.1|2274801_2275473_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_060472542.1|2275469_2275724_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_060472543.1|2275724_2276441_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	38.7	2.4e-38
WP_060471001.1|2278253_2279531_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.0	9.0e-12
WP_060472544.1|2279647_2280823_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_060472545.1|2280788_2281274_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	8.1e-22
WP_060472546.1|2281285_2282947_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_060472547.1|2283145_2284021_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_060472548.1|2284036_2284354_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_082990783.1|2284858_2286082_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.3	1.6e-122
WP_060471015.1|2286377_2287556_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060472552.1|2288380_2289955_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_060472553.1|2290017_2291331_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_190299887.1|2292063_2292237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472556.1|2294930_2295578_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_060472557.1|2295597_2295918_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_060472558.1|2295987_2296641_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
