The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	28621	60680	4599046	transposase	Gordonia_phage(33.33%)	30	NA	NA
WP_082405816.1|28621_28951_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	76.7	9.0e-33
WP_156366319.1|29125_29788_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	74.8	4.6e-60
WP_156366628.1|29877_31077_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.5e-32
WP_156366320.1|31060_31429_+|transposase	transposase	transposase	A0A160DCU2	Gordonia_phage	71.1	3.7e-43
WP_156366321.1|31456_31765_-	MFS transporter	NA	NA	NA	NA	NA
WP_054678462.1|31910_32504_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054678465.1|32630_33167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678468.1|33529_35515_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082405819.1|35454_37050_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_054678479.1|37173_38580_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_082405820.1|39011_39239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156366322.1|39540_39930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366323.1|40023_40521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678490.1|41242_42040_-	DNA replication protein	NA	A0A2L1IVB6	Escherichia_phage	44.4	1.3e-48
WP_082405821.1|42039_43242_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_054678492.1|43759_45007_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	7.0e-78
WP_054678494.1|45103_45571_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_054678497.1|45593_46436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678500.1|46601_47834_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	55.4	3.5e-114
WP_054678502.1|48496_49282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081766114.1|49877_51320_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	26.6	3.5e-12
WP_156366324.1|51859_52240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678507.1|52236_52677_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054678510.1|53001_53655_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156366325.1|53891_55577_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054678519.1|55573_56734_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_054678525.1|56944_57655_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_156366326.1|57780_58728_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_054678529.1|58752_59322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678531.1|59378_60680_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.8	4.3e-179
>prophage 2
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	184598	267147	4599046	transposase	Corynebacterium_phage(15.38%)	60	NA	NA
WP_054678492.1|184598_185846_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	7.0e-78
WP_156366332.1|188116_188476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366333.1|188798_189236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678858.1|189415_190768_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054678861.1|190780_192130_-	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_082405841.1|192156_193071_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.9e-11
WP_082405842.1|193024_193939_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_054678866.1|193949_194840_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_054678870.1|195914_197444_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_054678873.1|197612_199193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678876.1|199508_200552_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081766114.1|200694_202137_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	26.6	3.5e-12
WP_054678879.1|202408_204145_-	monooxygenase	NA	NA	NA	NA	NA
WP_054678883.1|204251_205670_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_054678887.1|205804_206857_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054678890.1|206900_207734_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_082406451.1|207763_209518_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	4.1e-39
WP_082405843.1|209514_211401_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.3e-38
WP_054678897.1|211427_212498_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054678901.1|215878_216154_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_054678904.1|216150_216579_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054678908.1|216828_218535_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_054678911.1|218531_220136_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_054678914.1|220190_221009_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054686729.1|221163_222147_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054686730.1|222221_223043_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_054678918.1|223075_224137_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_054686731.1|224226_225216_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_156366334.1|225272_226115_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.7	3.6e-09
WP_156366335.1|226570_226753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678500.1|226805_228038_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	55.4	3.5e-114
WP_156366336.1|228081_229035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686733.1|229048_229345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366337.1|230629_233470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678927.1|233469_234561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678930.1|234550_240127_+	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.9	1.4e-45
WP_156366338.1|240114_241344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678938.1|241344_243366_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_054678942.1|243326_244778_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_054678945.1|245128_245662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366339.1|245670_246174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678948.1|246362_246647_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082405845.1|246609_248787_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_054678951.1|248783_249833_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_156366340.1|249829_250993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366341.1|251177_251873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678960.1|252942_253281_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054678964.1|253313_254288_+	ATPase	NA	NA	NA	NA	NA
WP_054678966.1|254646_255012_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_054678969.1|255017_255569_+	single-stranded DNA-binding protein	NA	A6N1Y1	Microbacterium_phage	95.0	1.5e-59
WP_054678972.1|255759_256014_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_054678975.1|256025_256478_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_054678978.1|256882_259465_+	replicative DNA helicase	NA	Q19X89	Mycobacterium_phage	32.6	8.9e-51
WP_054678980.1|259556_260381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366342.1|260377_261316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054678985.1|261312_262185_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_054678490.1|262510_263308_-	DNA replication protein	NA	A0A2L1IVB6	Escherichia_phage	44.4	1.3e-48
WP_082405821.1|263307_264510_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_156366628.1|265640_266840_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.5e-32
WP_054678991.1|266820_267147_+|transposase	transposase	transposase	A0A2P1JR32	Mycobacterium_phage	54.8	2.5e-19
>prophage 3
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	1404247	1416947	4599046	tail	Microbacterium_phage(33.33%)	12	NA	NA
WP_082406006.1|1404247_1405219_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MY35	Enterococcus_phage	34.1	2.1e-13
WP_082406009.1|1405215_1405812_-	hypothetical protein	NA	A0A2H4P8G3	Corynebacterium_phage	46.8	8.1e-32
WP_082406011.1|1405808_1406381_-	hypothetical protein	NA	A0A222ZG41	Arthrobacter_phage	48.7	2.5e-30
WP_054681222.1|1406421_1407030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054681223.1|1407026_1408082_-	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	39.3	5.3e-10
WP_054681225.1|1408065_1409577_-	hypothetical protein	NA	W8PF50	Microbacterium_phage	30.2	2.4e-64
WP_054681227.1|1409576_1410539_-	hypothetical protein	NA	W8P069	Microbacterium_phage	35.5	4.5e-40
WP_054681229.1|1410535_1414246_-|tail	phage tail tape measure protein	tail	W8NWJ5	Microbacterium_phage	27.6	3.5e-88
WP_054681231.1|1414292_1414673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366429.1|1414753_1415476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054681234.1|1415588_1416350_-	hypothetical protein	NA	D0U212	Clavibacter_phage	33.7	4.1e-28
WP_054681236.1|1416359_1416947_-	hypothetical protein	NA	D0U211	Clavibacter_phage	40.9	1.5e-25
>prophage 4
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	2318040	2329277	4599046	portal,capsid,protease,head	Arthrobacter_phage(44.44%)	13	NA	NA
WP_054682568.1|2318040_2320263_-	hypothetical protein	NA	A0A0E3XB61	Gordonia_phage	44.8	4.6e-72
WP_054682570.1|2320272_2320500_-	hypothetical protein	NA	A0A0U4JRG2	Arthrobacter_phage	54.3	3.2e-13
WP_054682572.1|2320640_2320907_-	hypothetical protein	NA	A0A160DDA7	Gordonia_phage	38.8	1.2e-11
WP_054682575.1|2320986_2321847_-	hypothetical protein	NA	A0A2R4A127	Microbacterium_phage	64.8	1.2e-65
WP_054682577.1|2321915_2322344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682578.1|2322346_2322610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366466.1|2322614_2322860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682582.1|2322952_2323471_-	hypothetical protein	NA	A0A2R4A2C7	Microbacterium_phage	37.3	1.5e-18
WP_054682584.1|2323488_2323686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682586.1|2323742_2324978_-|capsid	phage major capsid protein	capsid	A0A0U4K7R9	Arthrobacter_phage	56.7	5.5e-115
WP_054682587.1|2325000_2325747_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1D8ET51	Propionibacterium_phage	70.1	8.0e-61
WP_082406156.1|2325758_2327705_-|portal	phage portal protein	portal	A0A249XRE6	Arthrobacter_phage	49.5	8.5e-171
WP_054682591.1|2327720_2329277_-	hypothetical protein	NA	A0A0U4JKK7	Arthrobacter_phage	42.7	1.0e-97
>prophage 5
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	2527905	2573494	4599046	integrase,transposase	Mycobacterium_phage(16.67%)	32	2533577:2533593	2564686:2564702
WP_054678531.1|2527905_2529207_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.8	4.3e-179
WP_082406195.1|2530671_2531187_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_058631432.1|2531302_2531635_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025104937.1|2532188_2532668_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	53.0	2.0e-36
WP_156366483.1|2532710_2533262_-	hypothetical protein	NA	NA	NA	NA	NA
2533577:2533593	attL	CGGAGGGCGCCCGGGAG	NA	NA	NA	NA
WP_025104939.1|2533639_2534425_-	acetoin reductase	NA	NA	NA	NA	NA
WP_054682937.1|2534583_2536365_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_156366484.1|2536502_2536967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682941.1|2537051_2538428_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	1.4e-39
WP_054682943.1|2538527_2538917_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_054682946.1|2538931_2539732_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	32.2	5.4e-31
WP_054686999.1|2539728_2541423_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_054678531.1|2541573_2542875_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.8	4.3e-179
WP_054682948.1|2543479_2545258_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_054682950.1|2545288_2547859_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_054682954.1|2547851_2549525_-	restriction endonuclease	NA	A0A2H4UUH6	Bodo_saltans_virus	28.0	2.4e-33
WP_156366485.1|2549947_2551489_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054682959.1|2551485_2553294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682961.1|2553290_2555399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682963.1|2555391_2555808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082406199.1|2555816_2556380_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_054682968.1|2556668_2556950_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054682970.1|2557023_2557419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682972.1|2557450_2557858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366486.1|2557826_2558660_+	hypothetical protein	NA	U5PVK8	Bacillus_phage	31.9	5.5e-18
WP_054682976.1|2558708_2558891_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	56.9	1.2e-15
WP_082406201.1|2558905_2562559_+	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.3	1.3e-47
WP_082406203.1|2562600_2564865_+	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	23.0	4.6e-19
2564686:2564702	attR	CTCCCGGGCGCCCTCCG	NA	NA	NA	NA
WP_143003726.1|2564940_2566087_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.9e-39
WP_054682987.1|2566646_2570036_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_054682989.1|2570104_2572123_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156366487.1|2572412_2573494_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.6e-39
>prophage 6
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	2582238	2628475	4599046	integrase,transposase,tail	Gordonia_phage(36.36%)	44	2617060:2617108	2629009:2629057
WP_054683006.1|2582238_2582490_-|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	69.9	2.3e-28
WP_054683009.1|2582512_2583583_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156366488.1|2583802_2584084_-	hypothetical protein	NA	A0A1B3AZE5	Gordonia_phage	65.0	1.4e-05
WP_143003726.1|2584198_2585346_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.9e-39
WP_054683012.1|2586238_2587375_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054683014.1|2587371_2588382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683017.1|2588378_2588843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683018.1|2588904_2589336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683020.1|2589646_2590720_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_054683022.1|2590719_2591652_+	DNA primase	NA	G8I4I7	Mycobacterium_phage	35.8	1.2e-13
WP_054683024.1|2591684_2592326_+	DUF2637 domain-containing protein	NA	A0A222YXY9	Mycobacterium_phage	46.2	9.1e-21
WP_054683026.1|2592322_2592727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683028.1|2592820_2593708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683030.1|2593704_2594706_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_054683032.1|2594742_2595435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683034.1|2595448_2597059_+	M23 family metallopeptidase	NA	A0A2P1JY73	Gordonia_phage	43.9	2.4e-25
WP_013601305.1|2597065_2597332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683036.1|2597477_2597798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054687006.1|2597829_2599206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683038.1|2599209_2600679_+	PrgI family protein	NA	NA	NA	NA	NA
WP_156366489.1|2600728_2601547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683040.1|2603403_2604234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683042.1|2604230_2605751_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_054687008.1|2605913_2606273_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054687010.1|2606230_2608174_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.9	5.8e-95
WP_082406207.1|2608193_2609591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683046.1|2609980_2610304_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054683048.1|2610305_2611391_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	29.9	6.9e-05
WP_054683050.1|2611568_2612120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683052.1|2612116_2613895_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_034224863.1|2613975_2614416_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_082406209.1|2614453_2614993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683056.1|2614997_2615213_+	hypothetical protein	NA	NA	NA	NA	NA
2617060:2617108	attL	GGTGGACCTGAGGGGACTCGAACCCCTGACCCCCTGCATGCCATGCAGG	NA	NA	NA	NA
WP_054678492.1|2617315_2618563_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	7.0e-78
WP_082406213.1|2619207_2619483_+	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
WP_156366490.1|2619479_2619917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683061.1|2619913_2623126_-|tail	phage tail tape measure protein	tail	W8NWJ5	Microbacterium_phage	30.7	1.1e-106
WP_054683064.1|2623233_2623467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683066.1|2623463_2623736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683068.1|2623782_2624544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683070.1|2624710_2626096_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_054683072.1|2626092_2626737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082406215.1|2626858_2627077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054683074.1|2627170_2628475_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	28.2	2.0e-14
2629009:2629057	attR	GGTGGACCTGAGGGGACTCGAACCCCTGACCCCCTGCATGCCATGCAGG	NA	NA	NA	NA
>prophage 7
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	2901589	2956945	4599046	integrase,transposase	Mycobacterium_phage(16.67%)	54	2894263:2894285	2942415:2942437
2894263:2894285	attL	GGTGAGGGTGCCGGTCTTGTCGA	NA	NA	NA	NA
WP_054678500.1|2901589_2902822_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	55.4	3.5e-114
WP_054683644.1|2903038_2903605_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082406256.1|2903818_2904895_+	site-specific DNA-methyltransferase	NA	A0A249XTU6	Mycobacterium_phage	40.7	3.1e-82
WP_054683649.1|2904968_2905436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366502.1|2905583_2906960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082406257.1|2907099_2908083_+	hypothetical protein	NA	G8I4I7	Mycobacterium_phage	33.7	5.1e-15
WP_082406258.1|2908088_2908925_+	DUF2637 domain-containing protein	NA	A0A1D8EVB7	Mycobacterium_phage	42.6	3.0e-16
WP_054683654.1|2908917_2909352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366503.1|2909867_2911547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683662.1|2911533_2912010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683665.1|2912085_2912775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082406518.1|2912791_2913964_+	M23 family metallopeptidase	NA	A0A2P1JY73	Gordonia_phage	47.1	1.9e-24
WP_054683670.1|2914047_2914359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683673.1|2914441_2914765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683676.1|2914798_2916232_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_054683678.1|2916380_2917841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683681.1|2917841_2918720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054678490.1|2919808_2920606_-	DNA replication protein	NA	A0A2L1IVB6	Escherichia_phage	44.4	1.3e-48
WP_082405821.1|2920605_2921808_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_054687008.1|2922624_2922984_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054687010.1|2922941_2924885_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.9	5.8e-95
WP_082406207.1|2924904_2926302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683046.1|2926691_2927015_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054683048.1|2927016_2928102_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	29.9	6.9e-05
WP_054687050.1|2928417_2928783_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026937616.1|2928901_2930407_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.3	1.9e-114
WP_026937615.1|2930499_2930919_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_054683684.1|2930915_2931338_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	38.3	7.5e-16
WP_054683686.1|2931365_2932580_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_054683691.1|2932576_2933581_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A218MNF3	uncultured_virus	46.2	1.1e-09
WP_054687051.1|2933577_2934642_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_054683694.1|2934677_2935004_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	48.5	6.6e-20
WP_054683697.1|2935000_2935969_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	50.5	8.2e-74
WP_156366504.1|2936042_2937743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683702.1|2937802_2938132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082406519.1|2938135_2939251_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054678492.1|2939258_2940506_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	7.0e-78
WP_054683705.1|2941049_2941409_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054683708.1|2941366_2943319_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.8	2.9e-94
2942415:2942437	attR	TCGACAAGACCGGCACCCTCACC	NA	NA	NA	NA
WP_054683711.1|2943315_2943870_+	signal peptidase II	NA	NA	NA	NA	NA
WP_010157044.1|2943866_2944175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683714.1|2944741_2945743_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_054683717.1|2945739_2946840_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_054683720.1|2946836_2947163_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	1.1e-19
WP_054683723.1|2947159_2948134_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	50.6	3.6e-77
WP_082406520.1|2948222_2949884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082406262.1|2949973_2950189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054683731.1|2950340_2950802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366505.1|2950798_2951338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082406263.1|2951437_2953249_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_082406264.1|2953323_2953842_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_082406265.1|2953950_2954616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054683737.1|2954612_2954813_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081766114.1|2955502_2956945_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	26.6	3.5e-12
>prophage 8
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	4244589	4252544	4599046	protease,tRNA	Pandoravirus(16.67%)	8	NA	NA
WP_054687259.1|4244589_4245387_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.6	7.3e-20
WP_054686433.1|4245398_4245986_-	GTP cyclohydrolase I	NA	E7DN69	Pneumococcus_phage	41.1	3.7e-29
WP_054686434.1|4245992_4247990_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	44.7	1.1e-104
WP_054686435.1|4248054_4248606_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	28.0	7.6e-08
WP_054686436.1|4248700_4249234_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_054686437.1|4249349_4250351_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_054686438.1|4250472_4251006_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.3	1.0e-33
WP_054686439.1|4251089_4252544_-	M23 family metallopeptidase	NA	G8I8L5	Mycobacterium_phage	39.7	1.7e-14
>prophage 9
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	4276554	4283975	4599046		Gordonia_phage(57.14%)	8	NA	NA
WP_054686465.1|4276554_4277553_-	hypothetical protein	NA	A0A166XYQ6	Gordonia_phage	28.5	4.4e-22
WP_054686466.1|4277556_4277997_-	hypothetical protein	NA	A0A0K1Y5S7	Streptomyces_phage	40.0	9.9e-11
WP_054686467.1|4278019_4278745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686468.1|4278819_4279860_-	hypothetical protein	NA	A0A142K8Z1	Gordonia_phage	46.6	3.1e-34
WP_156366598.1|4279846_4281247_-	hypothetical protein	NA	G8EJN3	Gordonia_phage	30.2	4.1e-50
WP_054686470.1|4281255_4283010_-	hypothetical protein	NA	A0A1B3AY92	Gordonia_phage	44.3	7.5e-126
WP_054686471.1|4283013_4283451_-	hypothetical protein	NA	A0A192YAT6	Mycobacterium_phage	43.4	8.6e-15
WP_082406401.1|4283504_4283975_-	HNH endonuclease	NA	A0A0K1Y8U5	Streptomyces_phage	52.1	1.2e-33
>prophage 10
NZ_CP012697	Microbacterium sp. No. 7, complete genome	4599046	4289891	4303921	4599046		Gordonia_phage(28.57%)	27	NA	NA
WP_156366684.1|4289891_4290545_-	adenine methyltransferase	NA	A0A166Y0E3	Gordonia_phage	75.4	1.2e-55
WP_054686483.1|4290553_4290931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686484.1|4290927_4291230_-	hypothetical protein	NA	A0A142K943	Gordonia_phage	62.1	1.5e-18
WP_054686485.1|4291219_4291792_-	hypothetical protein	NA	A0A249XQ08	Mycobacterium_phage	37.9	2.1e-29
WP_054686486.1|4291791_4291983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366600.1|4291975_4292137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686487.1|4292270_4292564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686488.1|4292560_4292899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686489.1|4292895_4293096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686490.1|4293092_4293521_-	hypothetical protein	NA	A0A142KA40	Gordonia_phage	56.9	2.1e-29
WP_054686491.1|4293522_4293900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686492.1|4293939_4294386_-	single-stranded DNA-binding protein	NA	A6N1Y1	Microbacterium_phage	43.8	2.2e-21
WP_156366601.1|4294385_4294565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366602.1|4294986_4295154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366603.1|4295150_4295639_-	hypothetical protein	NA	A0A1D8ETM2	Propionibacterium_phage	44.3	1.0e-16
WP_054687262.1|4295786_4296281_-	hypothetical protein	NA	G9L661	Escherichia_phage	55.9	4.5e-36
WP_156366685.1|4296398_4296755_-	hypothetical protein	NA	A0A286N2Z4	Arthrobacter_phage	71.8	7.5e-09
WP_082406404.1|4297162_4297927_-	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	50.8	7.4e-62
WP_156366604.1|4297981_4298479_-	hypothetical protein	NA	A0A159B6E8	Gordonia_phage	29.6	4.7e-09
WP_156366605.1|4298904_4299111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054686496.1|4299264_4299810_-	hypothetical protein	NA	G1BSJ5	Mycobacterium_virus	41.1	3.6e-34
WP_156366606.1|4300078_4300507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366607.1|4300516_4300930_-	HNH endonuclease	NA	A0A1B0XTQ2	Freshwater_phage	41.0	4.3e-08
WP_156366608.1|4300926_4301064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156366609.1|4301072_4301498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082406405.1|4301494_4302655_-	hypothetical protein	NA	A0A1P8VV67	Rathayibacter_phage	43.5	5.2e-51
WP_082406406.1|4303540_4303921_-	hypothetical protein	NA	Q775A8	Bordetella_phage	48.3	2.6e-23
>prophage 1
NZ_CP012698	Microbacterium sp. No. 7 plasmid A, complete sequence	135111	74543	116735	135111	integrase,transposase	Leptospira_phage(25.0%)	36	76799:76822	124724:124747
WP_082405821.1|74543_75746_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_156366701.1|75781_75991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054687423.1|75998_76223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054687425.1|76219_76777_-	hypothetical protein	NA	NA	NA	NA	NA
76799:76822	attL	GTTGTGTATCTGACATGCACAACA	NA	NA	NA	NA
WP_156366702.1|77143_78013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054687429.1|78009_78465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054687431.1|78464_78869_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_054687434.1|78865_79243_+	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_054687436.1|79701_81366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682956.1|81465_82878_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054682959.1|82874_84683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682961.1|84679_86788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682963.1|86780_87197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082406199.1|87205_87769_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_054682968.1|88057_88339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054682970.1|88412_88808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054682972.1|88839_89247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156366486.1|89215_90049_+	hypothetical protein	NA	U5PVK8	Bacillus_phage	31.9	5.5e-18
WP_054682976.1|90097_90280_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	56.9	1.2e-15
WP_082406201.1|90294_93948_+	DUF3883 domain-containing protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	25.5	1.9e-38
WP_082406203.1|93989_96254_+	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	23.0	4.6e-19
WP_143003726.1|96329_97476_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.9e-39
WP_054682987.1|98035_101425_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_054682989.1|101493_103512_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156366487.1|103801_104883_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.6e-39
WP_054682993.1|106291_106975_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_054682994.1|107157_107403_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_054682996.1|107497_109501_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.3	6.6e-110
WP_054682998.1|109606_110032_+	cupin domain-containing protein	NA	A0A2H4UUZ4	Bodo_saltans_virus	33.0	3.1e-09
WP_054683000.1|110108_111014_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054683002.1|111231_111474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054683004.1|111504_113457_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.3	1.3e-62
WP_054683006.1|113627_113879_-|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	69.9	2.3e-28
WP_054683009.1|113901_114972_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156366488.1|115191_115473_-	hypothetical protein	NA	A0A1B3AZE5	Gordonia_phage	65.0	1.4e-05
WP_143003726.1|115587_116735_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	5.9e-39
124724:124747	attR	GTTGTGTATCTGACATGCACAACA	NA	NA	NA	NA
