The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	41113	71755	3096705	portal,capsid,integrase,protease,transposase,terminase,head	Acidithiobacillus_phage(30.77%)	39	31070:31084	73981:73995
31070:31084	attL	GGCGCGAGTTTGTTG	NA	NA	NA	NA
WP_062214601.1|41113_42001_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	30.5	1.3e-25
WP_062214603.1|42011_43205_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_082389109.1|43598_44000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062214607.1|43999_45322_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	49.3	5.1e-111
WP_062214609.1|45318_45774_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	37.3	5.3e-15
WP_082388978.1|46111_46786_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	30.2	1.3e-17
WP_062214611.1|46889_47561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214613.1|48059_48389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214615.1|48413_48905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214617.1|48904_49651_+	ATP-binding protein	NA	A0A1B1INN1	uncultured_Mediterranean_phage	44.6	1.0e-52
WP_062214619.1|49673_50189_+	DUF669 domain-containing protein	NA	A0A173H0W0	Pseudoalteromonas_phage	49.6	4.0e-27
WP_062214620.1|50252_50615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214622.1|50614_51559_+	hypothetical protein	NA	A0A173H0P7	Pseudoalteromonas_phage	50.0	8.8e-73
WP_082388979.1|51552_53292_+	DEAD/DEAH box helicase	NA	A0A2H4GY70	Pseudomonas_phage	44.6	3.4e-123
WP_062214624.1|53288_53513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214626.1|53512_55783_+	DUF3987 domain-containing protein	NA	M4QC51	Vibrio_phage	23.1	5.9e-22
WP_062214634.1|56171_56660_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	60.0	3.5e-49
WP_062220653.1|57093_57294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214639.1|57286_57712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214643.1|58202_59435_+	ParB N-terminal domain-containing protein	NA	A0A0A8ILE7	Aurantimonas_phage	53.7	9.0e-126
WP_062214645.1|59431_59692_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	64.8	4.3e-14
WP_062214648.1|59669_60023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082388980.1|60195_60510_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	57.4	1.9e-08
WP_062214650.1|60534_60804_-	hypothetical protein	NA	A0A0K0PVN5	Roseobacter_phage	54.2	2.2e-13
WP_062214652.1|60918_61515_+	hypothetical protein	NA	A0A2K9V2Q9	Faecalibacterium_phage	34.6	8.2e-16
WP_082388981.1|61402_63328_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	47.8	2.1e-153
WP_062214654.1|63331_63547_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	43.5	7.2e-07
WP_082388982.1|63550_65050_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	56.3	6.6e-147
WP_062214656.1|65054_66164_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	45.7	4.7e-41
WP_062214658.1|66170_66542_+|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	36.9	4.9e-11
WP_062214660.1|66581_67595_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	33.0	1.8e-39
WP_062214662.1|67594_67906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214665.1|67902_68535_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	52.4	3.0e-53
WP_062214667.1|68524_68770_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.6	3.1e-06
WP_062214669.1|68847_69273_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	53.6	2.5e-35
WP_062214671.1|69571_70027_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_062214673.1|70116_71058_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	54.8	1.8e-94
WP_062214675.1|71057_71420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169775292.1|71587_71755_+	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	55.6	5.2e-05
73981:73995	attR	CAACAAACTCGCGCC	NA	NA	NA	NA
>prophage 2
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	318307	370944	3096705	tRNA,integrase,holin,protease	Tupanvirus(10.0%)	55	324772:324787	378257:378272
WP_062215054.1|318307_318886_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_062215056.1|318917_319547_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_062220727.1|319649_321503_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	34.0	2.2e-75
WP_062215058.1|321662_322085_+	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_062220731.1|322174_322537_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_062215060.1|322851_323682_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.7	3.9e-48
WP_062215062.1|323930_324170_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_062215064.1|324282_325323_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.1	9.5e-20
324772:324787	attL	CGCAAAGGCGCGTGCG	NA	NA	NA	NA
WP_062215066.1|325319_326156_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_062215068.1|326239_327160_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_074906214.1|327301_327985_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_062215070.1|327981_329442_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062215072.1|329452_331111_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	32.8	8.0e-61
WP_062215074.1|331191_331935_-	ribonuclease activity regulator RraA	NA	NA	NA	NA	NA
WP_062215076.1|332130_332442_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_062220734.1|332488_333232_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_062215077.1|333512_334196_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156320724.1|334180_334351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082389006.1|334526_335513_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062215079.1|335607_336138_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_062215080.1|336140_337421_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_062215081.1|337631_338189_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_062215082.1|338276_338873_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062215083.1|338884_339589_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.1	4.3e-08
WP_062220737.1|339723_340620_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_062220740.1|340631_341525_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_062215084.1|341785_342553_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_062215086.1|342636_343509_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_082389007.1|343935_344166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062215090.1|344135_344696_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_062215094.1|345192_346428_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_062220743.1|346433_346898_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_062215097.1|346899_347151_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_062215100.1|347154_347976_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_062215103.1|348111_349308_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_062215105.1|349327_350317_-	oxidoreductase	NA	NA	NA	NA	NA
WP_062215110.1|350397_351111_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062215113.1|351652_352168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062215116.1|352350_353745_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_062215119.1|353863_354052_+	DUF4169 family protein	NA	NA	NA	NA	NA
WP_062215122.1|354048_354282_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062215125.1|354254_355034_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_062215128.1|355030_356665_-	citramalate synthase	NA	NA	NA	NA	NA
WP_062215131.1|356661_358068_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.6	5.4e-42
WP_062220745.1|358263_359094_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_062215134.1|359190_360204_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062215137.1|360559_361039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062215139.1|361119_362277_-	ribonuclease D	NA	NA	NA	NA	NA
WP_074906217.1|362387_362978_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.5	1.5e-25
WP_062215143.1|362974_364021_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.1	1.6e-62
WP_062215146.1|364426_365593_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	55.3	1.5e-109
WP_062215149.1|365615_366626_+	GDP-mannose 4,6-dehydratase	NA	A0A1D8EQC0	Escherichia_phage	30.1	4.3e-25
WP_062215151.1|366658_368035_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_062215154.1|368079_368997_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_062215166.1|369252_370944_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
378257:378272	attR	CGCACGCGCCTTTGCG	NA	NA	NA	NA
>prophage 3
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	1938491	1996685	3096705	tail,portal,capsid,protease,transposase,terminase,head	Acidithiobacillus_phage(17.14%)	71	NA	NA
WP_156320740.1|1938491_1939587_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	3.1e-53
WP_156320744.1|1940324_1941483_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.6e-45
WP_143090058.1|1941621_1941735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218532.1|1941731_1943261_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.2e-15
WP_062218534.1|1943257_1944259_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062218536.1|1944272_1945247_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062218538.1|1945328_1946120_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062218540.1|1946204_1947161_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082389135.1|1947378_1949247_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_062218542.1|1949221_1950031_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062218543.1|1950089_1951400_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_062218544.1|1951476_1952472_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_062218545.1|1952482_1953478_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_062218546.1|1953467_1954751_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_062218547.1|1954766_1956197_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062218549.1|1956207_1957086_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_062218551.1|1957096_1958476_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	1.4e-34
WP_062218554.1|1958472_1959246_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062218556.1|1959440_1960091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218558.1|1960087_1960591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218562.1|1961559_1961850_-	hypothetical protein	NA	A0A2I7S7G4	Vibrio_phage	64.7	9.4e-10
WP_062218564.1|1961896_1963012_-|head	head decoration protein	head	A0A0K2FIZ6	Escherichia_phage	66.3	5.4e-21
WP_062218566.1|1963710_1963968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218568.1|1963964_1964897_-	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	40.4	5.0e-20
WP_062218570.1|1964988_1965300_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	64.8	8.2e-28
WP_062218572.1|1965397_1965643_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_062218575.1|1965632_1965923_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	56.4	7.0e-21
WP_062218577.1|1965919_1966150_-	hypothetical protein	NA	A0A1B1IV72	uncultured_Mediterranean_phage	54.4	2.9e-06
WP_062218579.1|1966149_1968753_-	host specificity protein J	NA	W6AQX5	Acinetobacter_phage	37.8	1.5e-45
WP_062218581.1|1968756_1969161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218583.1|1969235_1969538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.2	3.5e-23
WP_062218585.1|1969527_1969818_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.4	9.4e-18
WP_062218587.1|1969831_1970392_-	hypothetical protein	NA	A0A1W6JS16	Salmonella_phage	31.9	1.1e-17
WP_156320745.1|1970388_1970931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218591.1|1970984_1973498_-|tail	phage tail tape-measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	55.6	6.0e-44
WP_062221160.1|1973541_1973823_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	43.7	6.5e-08
WP_062218593.1|1973834_1974125_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_062221163.1|1974095_1974275_-	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	55.6	5.6e-05
WP_062218595.1|1974457_1974820_-	hypothetical protein	NA	G8DH52	Emiliania_huxleyi_virus	34.9	3.9e-13
WP_062218597.1|1974819_1975761_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.4	6.7e-97
WP_062221166.1|1976047_1976449_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_062218599.1|1976445_1976868_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_062218600.1|1976875_1977298_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	56.4	2.0e-37
WP_062218602.1|1977329_1977674_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_062218605.1|1977673_1977931_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_062218606.1|1977992_1978622_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	52.9	3.6e-54
WP_062218609.1|1978618_1978930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169775314.1|1978929_1979943_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	34.2	5.2e-47
WP_062218613.1|1980010_1980382_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	38.2	2.0e-12
WP_062218615.1|1980386_1981454_-|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	48.7	3.1e-42
WP_082389076.1|1981458_1982982_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	57.1	1.1e-146
WP_062221172.1|1982985_1983201_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	45.8	6.8e-05
WP_062218617.1|1983255_1983597_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_062218619.1|1983593_1983905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062218621.1|1983892_1985818_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	47.3	7.1e-154
WP_062218623.1|1985738_1986302_-	hypothetical protein	NA	A0A2K9V2Q9	Faecalibacterium_phage	31.4	2.7e-13
WP_143090042.1|1986413_1986632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062218627.1|1986654_1987284_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_062218629.1|1987346_1987568_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	67.6	7.2e-18
WP_062218634.1|1987564_1988797_-	ParB N-terminal domain-containing protein	NA	A0A0A8ILE7	Aurantimonas_phage	53.5	6.9e-126
WP_082389137.1|1989310_1989553_-	CcdB family protein	NA	NA	NA	NA	NA
WP_062218638.1|1989588_1989843_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_062218640.1|1989911_1990337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062221175.1|1990326_1990530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062221178.1|1990535_1991021_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	63.2	8.9e-53
WP_062218642.1|1991067_1991490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218644.1|1991486_1993901_-	AAA family ATPase	NA	A0A1B2LRS1	Wolbachia_phage	50.6	1.9e-71
WP_062218646.1|1993897_1994665_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	52.0	6.3e-69
WP_062218647.1|1994664_1994865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218649.1|1995175_1995775_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	55.6	2.8e-56
WP_062218651.1|1995788_1996685_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	62.0	2.0e-95
>prophage 4
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	2005086	2062353	3096705	tail,tRNA,capsid,protease,head	Paracoccus_phage(21.05%)	56	NA	NA
WP_062218668.1|2005086_2005806_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_062218670.1|2005802_2008298_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_062218672.1|2008297_2009329_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	39.0	1.4e-44
WP_062218674.1|2009454_2010846_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	27.7	1.2e-25
WP_062218676.1|2010842_2012060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218678.1|2012160_2012910_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_062218680.1|2013058_2016034_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_062218682.1|2016576_2017914_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_062218684.1|2017964_2019758_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_062218686.1|2019917_2020586_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_062218688.1|2020720_2021758_-	zinc-dependent alcohol dehydrogenase family protein	NA	M1PHA2	Moumouvirus	32.4	1.3e-16
WP_062218691.1|2021920_2022151_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_062218693.1|2022177_2022945_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.1	1.2e-46
WP_062218695.1|2023183_2023498_+	DUF1476 domain-containing protein	NA	NA	NA	NA	NA
WP_062218697.1|2023799_2025833_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_062218699.1|2025982_2027017_+	betaine--homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_062218701.1|2027093_2027789_+	corrinoid protein	NA	NA	NA	NA	NA
WP_169775315.1|2027785_2028421_+	DUF1638 domain-containing protein	NA	NA	NA	NA	NA
WP_062218703.1|2028437_2028848_-	SufE family protein	NA	NA	NA	NA	NA
WP_062218705.1|2028998_2029502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062218707.1|2029566_2030526_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_062218709.1|2030565_2031969_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	42.1	1.1e-39
WP_074906414.1|2031973_2032636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062221198.1|2032776_2033466_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_062218711.1|2033553_2033961_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_062218713.1|2034043_2034922_+	DMT family transporter	NA	NA	NA	NA	NA
WP_062218715.1|2035076_2036354_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.4	3.3e-147
WP_062221199.1|2036474_2036993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218718.1|2037157_2037625_+	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	43.1	4.7e-27
WP_062218720.1|2037713_2037968_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_062218722.1|2038165_2039269_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_062218724.1|2039341_2040598_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.9	9.0e-65
WP_062218726.1|2040659_2041460_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	39.3	2.3e-42
WP_062218728.1|2041549_2042107_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.2	3.2e-38
WP_062218730.1|2042099_2042606_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	58.8	1.4e-45
WP_062218732.1|2042816_2043992_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_062218740.1|2044233_2045163_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_062218742.1|2045360_2045663_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_062218744.1|2045902_2046904_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_062218746.1|2046925_2048299_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_062218750.1|2048310_2049615_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_062218752.1|2049706_2050525_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_062218754.1|2050687_2051395_-	DUF2793 domain-containing protein	NA	A0A0K1Y6G9	Rhodobacter_phage	49.1	8.5e-20
WP_062218758.1|2051387_2055329_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	39.5	5.8e-227
WP_062218760.1|2055328_2055784_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	45.7	3.0e-26
WP_062218762.1|2055783_2056692_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	44.5	4.7e-63
WP_062218764.1|2056691_2057324_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.3	7.2e-55
WP_062218766.1|2057353_2058016_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	30.3	2.5e-13
WP_062218768.1|2058008_2058260_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_062218770.1|2058270_2058585_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_062218771.1|2058588_2059002_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_062218773.1|2059029_2059440_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_062218775.1|2059436_2059748_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_062218777.1|2059747_2060344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062218779.1|2060518_2061724_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.2	2.4e-67
WP_082389077.1|2061720_2062353_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.7	1.9e-31
>prophage 5
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	2835341	2885477	3096705	integrase,transposase	Ruegeria_phage(12.5%)	60	2862912:2862959	2892557:2892604
WP_062221375.1|2835341_2836526_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1X9HVL9	Ruegeria_phage	41.1	3.2e-80
WP_062220115.1|2836526_2837468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220117.1|2837565_2837760_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220119.1|2837885_2838170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220123.1|2838472_2838994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220125.1|2839507_2839756_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_062220127.1|2839745_2840030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	1.4e-21
WP_169775321.1|2840447_2840621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220129.1|2840613_2841882_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_062220131.1|2841892_2842372_+	DUF2948 family protein	NA	NA	NA	NA	NA
WP_062220133.1|2842535_2843849_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_062220135.1|2843841_2844321_+	UPF0262 family protein	NA	NA	NA	NA	NA
WP_062220137.1|2844325_2844784_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_062220139.1|2844936_2845155_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_062220142.1|2845176_2845755_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_062220144.1|2845751_2846786_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_062220146.1|2846785_2846992_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_062220148.1|2847385_2847889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220150.1|2847885_2848527_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_062220152.1|2848592_2849402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220154.1|2849583_2850354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220157.1|2850917_2851376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220160.1|2851964_2852321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062214603.1|2852936_2854130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_062214601.1|2854140_2855028_-|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	30.5	1.3e-25
WP_169775322.1|2855205_2855724_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220164.1|2855791_2856379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074906436.1|2856447_2856762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220166.1|2856870_2857365_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220168.1|2857361_2857826_+	cytochrome c	NA	NA	NA	NA	NA
WP_062220170.1|2857822_2858167_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_062220172.1|2858172_2859051_+	CopD family protein	NA	NA	NA	NA	NA
WP_062220174.1|2859064_2860492_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_062220176.1|2860491_2860893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220178.1|2860897_2861209_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_143090049.1|2861341_2861824_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_062220180.1|2861816_2862605_+	glutaredoxin	NA	NA	NA	NA	NA
2862912:2862959	attL	TTGAAAATCCTCGTGTCGGTGGTTCGATTCCGCCCCTGGGCACCATTT	NA	NA	NA	NA
WP_062220182.1|2863327_2863606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143090045.1|2863630_2864209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220188.1|2864744_2865986_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062220190.1|2866114_2866651_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_062220192.1|2866738_2867479_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220194.1|2867911_2868478_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6DWU1	Sphingobium_phage	32.0	4.8e-18
WP_062220196.1|2868673_2869405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220198.1|2869401_2870043_-	ATP-binding protein	NA	A0A1D8KU37	Synechococcus_phage	25.5	9.1e-05
WP_062220199.1|2870110_2870929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074906433.1|2871284_2871896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220203.1|2872143_2872476_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_062220206.1|2872468_2872927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220207.1|2873346_2873988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220209.1|2874616_2874979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220211.1|2875316_2876375_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_074906430.1|2876427_2877945_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_062220215.1|2877941_2878619_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	31.4	1.3e-06
WP_062220217.1|2878618_2879782_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.4	8.7e-14
WP_143090044.1|2879825_2881268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220221.1|2881342_2882341_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	36.6	9.4e-41
WP_062220223.1|2882391_2883477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074906427.1|2883473_2884820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074906424.1|2885111_2885477_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2892557:2892604	attR	TTGAAAATCCTCGTGTCGGTGGTTCGATTCCGCCCCTGGGCACCATTT	NA	NA	NA	NA
>prophage 6
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	3045876	3088635	3096705	tail,portal,capsid,integrase,transposase,terminase,head	Emiliania_huxleyi_virus(25.0%)	53	3040676:3040690	3066137:3066151
3040676:3040690	attL	AGATCGGCAAAGCCG	NA	NA	NA	NA
WP_143090011.1|3045876_3046125_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	63.2	9.2e-14
WP_062220498.1|3047110_3047299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220499.1|3048241_3048883_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	30.8	5.3e-13
WP_062220501.1|3049134_3049767_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	29.0	2.7e-09
WP_062220503.1|3050034_3050619_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_062220505.1|3050618_3053690_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_062220507.1|3053694_3054771_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_062220509.1|3054887_3055490_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220511.1|3055517_3056192_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_062220513.1|3056536_3057922_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_062220514.1|3058150_3059374_-	MFS transporter	NA	NA	NA	NA	NA
WP_062220516.1|3059560_3060193_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	27.3	5.1e-08
WP_062220518.1|3060330_3060777_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062220520.1|3060883_3061483_+	LysE family translocator	NA	NA	NA	NA	NA
WP_062220522.1|3062009_3063269_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.5	4.8e-34
WP_062220524.1|3063279_3063876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220526.1|3064108_3065116_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_062220528.1|3065443_3065695_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062220529.1|3065691_3065970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220532.1|3065966_3066419_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
3066137:3066151	attR	CGGCTTTGCCGATCT	NA	NA	NA	NA
WP_062220535.1|3066415_3067423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062220537.1|3067419_3068118_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	43.0	1.5e-37
WP_062220539.1|3068212_3068458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220542.1|3068454_3068862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156320751.1|3068892_3069069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220544.1|3069514_3070777_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	53.5	2.1e-122
WP_062220546.1|3070773_3070983_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	60.6	2.3e-13
WP_062220548.1|3070992_3071556_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_062220550.1|3071772_3072054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220553.1|3072067_3072286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220556.1|3072297_3072480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062220559.1|3072602_3073169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062221428.1|3073215_3075222_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	59.6	4.6e-212
WP_062220562.1|3075222_3075519_-	CcdB family protein	NA	NA	NA	NA	NA
WP_062220565.1|3075518_3075764_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_062220567.1|3075824_3076034_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	50.7	5.4e-07
WP_062220569.1|3076033_3077524_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	66.9	5.3e-181
WP_062220571.1|3077530_3077929_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_062220574.1|3077925_3078177_-	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_062221431.1|3078252_3079677_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	46.9	9.6e-63
WP_062220576.1|3079737_3080118_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	54.0	1.6e-25
WP_062220579.1|3080174_3081197_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	54.5	3.7e-101
WP_062220582.1|3081209_3081521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220585.1|3081517_3082150_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	53.4	2.3e-53
WP_062220587.1|3082158_3082449_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_062220591.1|3082436_3082721_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_062220595.1|3082810_3083236_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	52.9	1.9e-35
WP_062220598.1|3083261_3084203_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	55.7	5.7e-96
WP_062220601.1|3084202_3084565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156320752.1|3084729_3084912_+	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	58.8	3.6e-07
WP_062220604.1|3084959_3087482_+|tail	phage tail tape-measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	57.4	6.2e-49
WP_062220608.1|3087478_3088078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220611.1|3088074_3088635_+	hypothetical protein	NA	A0A1W6JS16	Salmonella_phage	31.9	1.4e-17
>prophage 7
NZ_CP012023	Celeribacter marinus strain IMCC12053 chromosome, complete genome	3096705	3091674	3096258	3096705	head	uncultured_Mediterranean_phage(16.67%)	10	NA	NA
WP_062220617.1|3091674_3091905_+	hypothetical protein	NA	A0A1B1IV72	uncultured_Mediterranean_phage	56.1	1.3e-06
WP_062220622.1|3091901_3092192_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	57.0	3.1e-21
WP_062218572.1|3092181_3092427_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_062220625.1|3092524_3092836_+	hypothetical protein	NA	I3UM16	Rhodobacter_phage	65.9	3.7e-28
WP_062218568.1|3092927_3093860_+	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	40.4	5.0e-20
WP_062218566.1|3093856_3094114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220628.1|3094249_3094603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143090059.1|3094611_3094806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062220632.1|3094805_3095921_+|head	head decoration protein	head	A0A0K2FIZ6	Escherichia_phage	65.3	3.5e-20
WP_062220635.1|3095967_3096258_+	hypothetical protein	NA	A0A2I7S7G4	Vibrio_phage	64.7	9.4e-10
