The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	1777424	1784563	4641689		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1777424_1778063_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1778154_1779321_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1779317_1780226_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001272547.1|1780391_1781189_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141337.1|1781239_1781896_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1782001_1784563_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	2165145	2176355	4641689	integrase,tail	Enterobacteria_phage(50.0%)	17	2161455:2161471	2178365:2178381
2161455:2161471	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2165145_2165346_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|2165477_2165783_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|2165782_2166145_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|2166135_2166672_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|2166799_2167624_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|2167689_2168052_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|2168409_2168778_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|2168774_2169269_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|2169268_2169544_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|2169593_2170112_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|2170138_2170579_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|2170877_2171159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|2171193_2172525_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|2172521_2173442_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|2173438_2173801_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|2173953_2175111_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|2175422_2176355_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
2178365:2178381	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	2525757	2534428	4641689		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|2525757_2527152_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|2527326_2528220_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|2528592_2529678_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|2529677_2530577_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|2530634_2531516_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|2531515_2532073_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|2532069_2533317_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|2533324_2534428_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	2993008	3012219	4641689	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2993008_2993164_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2993330_2993738_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2993821_2994052_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2994348_2994498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2994934_2995267_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2995469_2995775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2995799_2996039_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2996038_2996326_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2996397_2996553_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2996769_2997021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2997087_2997366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393597.1|2997367_2998417_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_001047135.1|2998430_2999183_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2999460_2999550_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2999604_2999817_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3000117_3000333_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3001086_3001302_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3001306_3001618_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3001614_3002148_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3002144_3002642_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3003004_3003217_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3003227_3003416_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3003418_3003484_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|3003562_3003718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3003889_3004063_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3004214_3004625_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3004682_3004916_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|3005304_3005874_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|3005824_3006787_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|3006786_3007362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3007459_3008050_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3008366_3008600_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3008668_3008782_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|3009386_3010670_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|3010758_3012219_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	3136806	3235109	4641689	lysis,integrase,tail,tRNA,transposase	Escherichia_phage(41.67%)	85	3214057:3214075	3244432:3244450
WP_000826416.1|3136806_3138015_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|3138546_3139215_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|3139516_3140110_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|3140106_3141099_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|3141222_3142203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|3142194_3142734_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|3142796_3143021_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|3143160_3144816_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|3145040_3146384_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|3146600_3147524_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|3147561_3149202_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|3149600_3149750_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|3149821_3149995_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3150239_3150770_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|3152000_3153440_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|3153636_3154437_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|3154708_3158611_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|3158811_3159417_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|3159470_3160787_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|3160776_3162534_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|3162549_3163446_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|3163445_3164051_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|3164221_3166528_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|3166590_3167451_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|3167658_3170070_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|3171162_3172314_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|3172477_3173750_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|3176441_3176507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|3176610_3177201_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|3177182_3178133_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|3178233_3179547_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|3179573_3180779_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3180778_3181201_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|3181190_3182618_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|3182619_3183408_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|3183407_3184175_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|3184171_3185242_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|3185249_3185747_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|3185761_3186508_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3186516_3186804_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|3186815_3187745_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|3188029_3190075_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|3190322_3192596_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|3192653_3194153_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|3194388_3195294_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|3195465_3195792_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|3195799_3195985_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|3195981_3198621_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|3198828_3199818_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|3199928_3200351_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3200347_3200614_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|3200887_3204412_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|3204778_3205912_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3206052_3206487_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|3207265_3207379_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|3207447_3207681_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|3207997_3208588_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|3208685_3209261_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|3209260_3212623_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|3212945_3213926_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
3214057:3214075	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|3215691_3216051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|3216031_3216295_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|3216432_3217890_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3218086_3218272_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|3218359_3218920_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|3218942_3219689_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|3219695_3220553_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|3220565_3220988_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|3221010_3221307_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|3221430_3221907_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|3222360_3222516_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3222512_3223001_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3223442_3223664_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3223663_3223834_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3223908_3224184_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|3224285_3226886_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|3226878_3227688_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3227744_3227939_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3227931_3228141_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3228219_3228435_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3228436_3229672_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|3229723_3230659_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|3230787_3232161_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3232638_3233622_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3233876_3235109_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3244432:3244450	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	3427615	3441996	4641689	portal,tail,integrase,plate	Escherichia_phage(26.32%)	25	3424991:3425004	3443022:3443035
3424991:3425004	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|3427615_3428347_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3428567_3428972_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3429024_3429135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|3429671_3429995_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|3430097_3430262_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|3430495_3431329_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|3431435_3431990_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|3432061_3432556_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|3432555_3433158_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|3433129_3433543_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|3433544_3434174_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|3434177_3434762_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|3434752_3435544_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|3435470_3435944_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|3435943_3436126_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|3436137_3437505_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|3437494_3437674_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|3437849_3438407_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|3438450_3438651_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|3438741_3439416_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|3439590_3439899_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|3439836_3440178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|3440294_3440606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|3440642_3440888_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|3440868_3441996_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
3443022:3443035	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	4032497	4076860	4641689	lysis,integrase,terminase,protease,transposase	Enterobacteria_phage(56.0%)	49	4055572:4055618	4076874:4076920
WP_001300563.1|4032497_4033610_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|4033686_4033839_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|4034291_4035410_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|4035475_4035724_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|4035788_4036157_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|4036250_4036904_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|4037011_4038259_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|4038339_4039716_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|4039817_4042961_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|4042972_4044196_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|4044211_4044544_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|4044701_4046075_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|4046231_4046915_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|4046904_4048347_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|4048496_4050734_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|4050720_4053693_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|4053693_4054584_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|4054766_4055528_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4055572:4055618	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|4056041_4056995_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|4057244_4057994_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|4058896_4059523_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|4059577_4060321_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|4060295_4060841_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|4061229_4061424_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4061588_4061795_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|4062080_4062491_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|4062781_4063075_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4063165_4063348_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4063564_4064062_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|4064061_4064277_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|4064849_4065917_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|4065921_4066938_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|4067335_4067719_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|4067804_4067945_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|4067941_4068304_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|4068300_4068591_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|4068583_4068754_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|4068753_4069209_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|4069205_4069307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|4069423_4070221_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|4070230_4070782_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|4071246_4072773_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|4072830_4072980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|4073027_4073360_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000878218.1|4073670_4074537_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4074533_4074833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000145909.1|4074895_4074991_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|4075313_4075577_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|4075696_4076860_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
4076874:4076920	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP012870	Escherichia coli strain K-12 substr. MG1655_TMP32XR2 chromosome, complete genome	4641689	4310178	4360846	4641689	integrase,holin,transposase	Acinetobacter_phage(33.33%)	46	4301606:4301622	4363934:4363950
4301606:4301622	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|4310178_4312212_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|4312340_4312928_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|4312941_4314414_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|4314427_4316098_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|4316310_4316979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4317221_4317917_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4317909_4319337_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4319347_4320067_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4320593_4321448_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|4321673_4322999_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4323107_4323344_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4323355_4323949_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000878218.1|4325221_4326088_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4326084_4326384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000020224.1|4326430_4327318_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|4328432_4328534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4328897_4329161_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4329160_4329301_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4329335_4329563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|4330386_4330929_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4331003_4331591_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4331648_4332317_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|4332342_4334868_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|4334857_4336501_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|4336469_4337180_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4337492_4337822_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4338069_4338684_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|4339101_4339791_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4339787_4340744_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|4340740_4342939_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|4342948_4343905_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|4343883_4344294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|4344578_4345979_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|4346095_4346536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|4346532_4346757_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|4346875_4347730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|4347756_4348455_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|4348726_4349353_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|4349443_4350175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|4351369_4352374_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|4352512_4353271_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|4353275_4354886_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|4354897_4356280_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|4356506_4358474_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|4358488_4359397_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|4359691_4360846_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
4363934:4363950	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
