The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012873	Weissella cibaria strain CH2 chromosome, complete genome	2466961	7664	16543	2466961	protease	Staphylococcus_phage(42.86%)	12	NA	NA
WP_043708935.1|7664_8129_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.0	1.2e-27
WP_043708933.1|8144_9338_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.3	5.9e-90
WP_043708931.1|9343_9931_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.2	2.7e-27
WP_043710717.1|9930_10956_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	30.3	1.8e-31
WP_010371280.1|11417_11741_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_010371283.1|11740_12067_-	multidrug resistance protein SMR	NA	NA	NA	NA	NA
WP_153280279.1|12165_12318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043708927.1|12324_12921_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	48.1	3.6e-40
WP_060653499.1|13179_13611_-	DUF1810 family protein	NA	A0A2H4UVK5	Bodo_saltans_virus	41.2	4.5e-16
WP_043710719.1|13666_14428_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_043708921.1|14643_15492_-	DegV family protein	NA	NA	NA	NA	NA
WP_060653501.1|15700_16543_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	30.3	2.6e-23
>prophage 2
NZ_CP012873	Weissella cibaria strain CH2 chromosome, complete genome	2466961	1197107	1205749	2466961		Synechococcus_phage(50.0%)	9	NA	NA
WP_043711455.1|1197107_1197596_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	1.7e-19
WP_060654447.1|1197588_1198707_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_060654449.1|1198688_1199429_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.5	2.2e-31
WP_043708231.1|1199431_1199689_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_043708230.1|1199690_1200374_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_043708228.1|1200370_1202593_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	1.7e-138
WP_060654451.1|1202577_1204113_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	1.4e-48
WP_043708226.1|1204124_1205165_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	41.2	4.8e-56
WP_060654454.1|1205155_1205749_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	8.4e-21
>prophage 3
NZ_CP012873	Weissella cibaria strain CH2 chromosome, complete genome	2466961	1296468	1361531	2466961	terminase,integrase,protease,tRNA,capsid,portal,head,lysis,tail	Lactobacillus_phage(41.67%)	79	1296393:1296412	1337830:1337849
1296393:1296412	attL	TAAGTTCTCAAAGTAATTTG	NA	NA	NA	NA
WP_060654526.1|1296468_1297536_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	31.9	1.4e-34
WP_167715826.1|1297694_1298741_-	Abi family protein	NA	A0A0N7IRA5	Lactobacillus_phage	27.4	4.2e-23
WP_060654530.1|1298917_1299319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003610500.1|1299435_1299708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060654532.1|1299873_1300377_-	Ltp family lipoprotein	NA	A0A0A1ERB0	Lactobacillus_phage	69.6	5.6e-10
WP_060654534.1|1300447_1300846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060654536.1|1300849_1301197_-	XRE family transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	36.2	2.5e-09
WP_145558329.1|1301457_1301661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081276017.1|1301673_1302381_+	ORF6C domain-containing protein	NA	A0A097BYE0	Leuconostoc_phage	42.2	7.4e-40
WP_060654541.1|1302383_1302671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654542.1|1302667_1302865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654544.1|1302861_1303050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654546.1|1303046_1303265_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167715828.1|1303330_1303477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654548.1|1303558_1304485_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_060654551.1|1304495_1305341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654554.1|1305354_1306053_+	hypothetical protein	NA	D7RWH3	Brochothrix_phage	37.9	4.9e-36
WP_081276018.1|1306027_1306408_+	DNA replication protein	NA	A0A0S2MYA8	Enterococcus_phage	68.1	2.3e-40
WP_060654556.1|1306534_1307059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654559.1|1307073_1307583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715831.1|1307632_1307800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715834.1|1307927_1308101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654561.1|1308100_1308295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654562.1|1308287_1308476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654563.1|1308559_1308973_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_065214038.1|1309427_1309847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654564.1|1309951_1310644_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_060654565.1|1311075_1311780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654566.1|1312418_1312742_+	hypothetical protein	NA	U5U409	Lactobacillus_phage	43.5	2.4e-06
WP_060654567.1|1312769_1313309_+	HNH endonuclease	NA	Q8LTL4	Lactococcus_phage	46.3	1.8e-38
WP_060654568.1|1313493_1313976_+|terminase	phage terminase small subunit P27 family	terminase	Q9AZT2	Lactococcus_phage	48.1	8.3e-35
WP_060654569.1|1313965_1315846_+|terminase	terminase large subunit	terminase	Q94MB3	Lactococcus_phage	64.5	7.0e-247
WP_043941329.1|1315835_1316048_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_150116736.1|1316087_1317218_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	57.1	1.0e-120
WP_060654572.1|1317204_1317906_+|protease	Clp protease ClpP	protease	Q9AZS8	Lactococcus_phage	54.2	6.3e-60
WP_060654574.1|1317925_1319149_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	63.6	5.9e-138
WP_043941474.1|1319165_1319483_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	46.0	5.1e-17
WP_060654576.1|1319469_1319808_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_060654577.1|1319810_1320236_+	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	45.9	5.4e-22
WP_060654580.1|1320232_1320604_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_060655590.1|1320628_1321246_+|tail	phage tail protein	tail	Q9AZS2	Lactococcus_phage	49.7	3.1e-42
WP_060654582.1|1321350_1321734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715837.1|1321769_1321922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654584.1|1321947_1326378_+	hypothetical protein	NA	Q9AZL4	Lactococcus_phage	51.8	6.6e-94
WP_060654586.1|1326382_1326769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654588.1|1326829_1329331_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_060654590.1|1329343_1334356_+|tail	phage tail protein	tail	A0A1I9KKS3	Lactobacillus_phage	32.9	8.3e-45
WP_060654592.1|1334365_1334767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654594.1|1334939_1335518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654596.1|1335569_1335821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654598.1|1335827_1336088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715841.1|1336087_1336264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654600.1|1336295_1336610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654602.1|1336611_1337628_+	hypothetical protein	NA	I6PBG3	Weissella_phage	39.2	2.2e-13
WP_060654604.1|1338039_1338996_+	TerC family protein	NA	K7QKE8	Escherichia_phage	35.3	1.2e-40
1337830:1337849	attR	TAAGTTCTCAAAGTAATTTG	NA	NA	NA	NA
WP_010372845.1|1339125_1339929_+	hypothetical protein	NA	A0A288TXV9	Enterococcus_phage	51.6	6.8e-50
WP_060654605.1|1340100_1340769_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_043708159.1|1340930_1341434_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_043708158.1|1341436_1342177_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010372859.1|1342294_1342651_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_010372861.1|1342847_1344134_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_010372864.1|1344348_1345305_+	YitT family protein	NA	NA	NA	NA	NA
WP_003609051.1|1345329_1345515_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_060654606.1|1345613_1347119_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_060654607.1|1347505_1348954_+	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	33.6	2.3e-11
WP_010372451.1|1349007_1349652_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.0	9.0e-45
WP_010372453.1|1349869_1350265_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_043709490.1|1350445_1351285_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_060654608.1|1351287_1351482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043709493.1|1351483_1352209_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010372463.1|1352385_1352805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010372466.1|1352898_1353306_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_043709503.1|1353390_1353903_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060654609.1|1354225_1355743_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010372475.1|1355890_1356622_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_043711515.1|1356723_1357836_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_060654610.1|1357835_1359803_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_060654611.1|1359804_1360629_+	DUF916 domain-containing protein	NA	NA	NA	NA	NA
WP_043709516.1|1360760_1361531_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 4
NZ_CP012873	Weissella cibaria strain CH2 chromosome, complete genome	2466961	1399465	1451348	2466961	integrase,terminase,tRNA,capsid,portal,head,tail	Lactobacillus_phage(25.0%)	70	1393071:1393087	1423418:1423434
1393071:1393087	attL	TGCAACTGCTGCTGAAA	NA	NA	NA	NA
WP_043709039.1|1399465_1400776_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_043711550.1|1400781_1402587_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060654646.1|1402754_1403120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715844.1|1403182_1403980_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010372988.1|1404089_1404971_+	YitT family protein	NA	NA	NA	NA	NA
WP_003610426.1|1405103_1405289_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_043709047.1|1405380_1405824_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	37.3	6.7e-15
WP_010372981.1|1405919_1406909_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.0	9.9e-51
WP_010372976.1|1406914_1407397_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010372974.1|1407380_1407809_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_010372971.1|1407860_1408769_+	GTPase Era	NA	NA	NA	NA	NA
WP_060654650.1|1408817_1409612_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_010372965.1|1409677_1409851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654652.1|1409996_1410731_+	nicotinamide mononucleotide transporter	NA	A0A2K9VDE7	Lactobacillus_phage	42.5	1.0e-44
WP_060654654.1|1411025_1411952_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_043709056.1|1411953_1414035_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_060654655.1|1414085_1414829_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060654657.1|1415044_1416202_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8Y2	Streptococcus_phage	27.6	5.1e-30
WP_060654659.1|1416390_1417008_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_060654661.1|1417059_1417467_-	hypothetical protein	NA	D6PSS8	Lactobacillus_phage	30.1	3.1e-06
WP_060654663.1|1417459_1417801_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	50.8	1.0e-10
WP_060654665.1|1418069_1418297_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060654668.1|1418299_1418581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654670.1|1418618_1418801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654672.1|1418913_1419114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654674.1|1419110_1419296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654676.1|1419292_1419478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654678.1|1419478_1419784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654680.1|1419859_1420051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164239487.1|1420050_1420212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654682.1|1420213_1420912_+	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	46.9	5.9e-50
WP_060654684.1|1420914_1421487_+	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_060654686.1|1421486_1422368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654688.1|1422371_1423787_+	hypothetical protein	NA	NA	NA	NA	NA
1423418:1423434	attR	TGCAACTGCTGCTGAAA	NA	NA	NA	NA
WP_060654690.1|1424035_1424521_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_060654692.1|1424581_1424851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654694.1|1424984_1425368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654696.1|1425367_1425577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715847.1|1425576_1425750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654698.1|1425749_1426226_+	hypothetical protein	NA	Q8LTB0	Lactobacillus_phage	61.1	5.6e-52
WP_060654700.1|1426225_1426426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654702.1|1426573_1426759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654704.1|1426848_1427262_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_060654706.1|1427673_1428255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715850.1|1428301_1428466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654709.1|1429038_1429245_+	CsbD family protein	NA	NA	NA	NA	NA
WP_060654711.1|1429605_1430028_+|terminase	terminase small subunit	terminase	A0A1Q1PVS8	Bacillus_phage	35.4	3.3e-11
WP_081276024.1|1430020_1431301_+|terminase	PBSX family phage terminase large subunit	terminase	Q4ZE37	Staphylococcus_virus	57.6	1.0e-140
WP_060654715.1|1431309_1432857_+|portal	phage portal protein	portal	D2IYW2	Enterococcus_phage	58.4	7.5e-162
WP_060654717.1|1432843_1433779_+|capsid	minor capsid protein	capsid	D2IYW4	Enterococcus_phage	42.8	4.1e-62
WP_060654719.1|1433896_1434472_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	41.4	5.8e-11
WP_060654721.1|1434489_1435392_+	hypothetical protein	NA	D2IYW7	Enterococcus_phage	56.1	6.9e-83
WP_060654723.1|1435410_1435701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654724.1|1435711_1436053_+|head,tail	phage head-tail connector protein	head,tail	K4I470	Lactobacillus_virus	42.1	2.6e-19
WP_060654726.1|1436052_1436337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654728.1|1436339_1436702_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	38.1	3.3e-12
WP_060654730.1|1436698_1437067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654733.1|1437075_1437690_+|tail	phage major tail protein, TP901-1 family	tail	A0A2K9VC22	Lactobacillus_phage	57.3	2.0e-57
WP_060654735.1|1437774_1438221_+	hypothetical protein	NA	D2IZN3	Enterococcus_phage	33.1	5.7e-14
WP_060654737.1|1438313_1438520_+	hypothetical protein	NA	D2IYX5	Enterococcus_phage	46.0	3.1e-07
WP_060654740.1|1438536_1441671_+|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	51.0	4.8e-06
WP_060654742.1|1441680_1442577_+|tail	phage tail family protein	tail	D2IYX7	Enterococcus_phage	40.7	1.4e-51
WP_060654744.1|1442586_1447977_+|tail	phage tail protein	tail	A0A1B1SDS2	Weissella_phage	54.1	5.8e-137
WP_167715853.1|1447992_1448166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167715856.1|1448152_1448296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654746.1|1448288_1448537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654748.1|1448549_1448780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654750.1|1448766_1449087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060654752.1|1449088_1450108_+	hypothetical protein	NA	I6PBG3	Weissella_phage	38.8	2.9e-13
WP_010372950.1|1450391_1451348_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	36.2	9.6e-43
>prophage 5
NZ_CP012873	Weissella cibaria strain CH2 chromosome, complete genome	2466961	2135537	2145301	2466961	transposase,integrase	Streptococcus_phage(25.0%)	11	2133927:2133945	2141997:2142015
2133927:2133945	attL	TACTTCTTGTTGAACTTGT	NA	NA	NA	NA
WP_060655428.1|2135537_2136542_-	hypothetical protein	NA	I6PBG3	Weissella_phage	41.2	2.7e-11
WP_060655429.1|2136543_2136864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060472676.1|2137414_2138209_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.7	6.1e-27
WP_043708826.1|2138978_2139329_+	helix-turn-helix transcriptional regulator	NA	M1PKY8	Streptococcus_phage	41.7	7.6e-14
WP_052497177.1|2139315_2139738_+	ImmA/IrrE family metallo-endopeptidase	NA	E3W8B8	Leuconostoc_phage	34.4	1.3e-12
WP_010374093.1|2139957_2140323_+	phage protein	NA	NA	NA	NA	NA
WP_060655430.1|2140768_2141407_+	Arm DNA-binding domain-containing protein	NA	Q6EVM3	Oenoccocus_phage	32.8	7.4e-23
WP_060655431.1|2141408_2141837_+|integrase	site-specific integrase	integrase	Q6EVM3	Oenoccocus_phage	43.7	4.3e-19
WP_010374216.1|2141983_2142226_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
2141997:2142015	attR	TACTTCTTGTTGAACTTGT	NA	NA	NA	NA
WP_043708823.1|2142361_2144212_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	5.8e-20
WP_060655432.1|2144479_2145301_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.8	6.3e-43
