The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012752	Kibdelosporangium phytohabitans strain KLBMP1111 chromosome, complete genome	11759770	861830	932962	11759770	integrase	Bacillus_phage(42.86%)	54	909968:909984	935835:935851
WP_054288190.1|861830_862790_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169798848.1|864317_865925_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLI2	Bacillus_phage	32.9	9.9e-08
WP_169798849.1|867431_871349_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_169798850.1|872296_872866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169798851.1|872864_873074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232798.1|873028_873484_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_054288197.1|873696_875124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232799.1|875120_875702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063809958.1|875934_876294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169798810.1|876968_878306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288201.1|878334_878643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288202.1|879241_880990_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	2.1e-51
WP_083471493.1|881007_881475_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_054288203.1|881471_881732_-	lasso peptide biosynthesis PqqD family chaperone	NA	NA	NA	NA	NA
WP_054288204.1|881728_883591_-	asparagine synthase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_157232801.1|883621_883747_-	lasso RiPP family leader peptide-containing protein	NA	NA	NA	NA	NA
WP_054288205.1|884512_884701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232802.1|885840_886137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288208.1|886646_887189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288209.1|887619_888771_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157232803.1|889492_891217_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054288210.1|891213_891759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232804.1|892771_894133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232805.1|894700_895273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232806.1|896247_896484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288215.1|897083_897902_+	lipase family protein	NA	A0A2P0VP29	Tetraselmis_virus	36.0	1.0e-08
WP_157232807.1|897972_898437_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_054288217.1|898922_899603_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	34.5	1.1e-16
WP_157232808.1|899894_900296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232809.1|901029_901845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288219.1|901841_903065_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_157232810.1|904143_904518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232811.1|904751_905465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232812.1|905597_906551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232813.1|906838_907543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288224.1|908181_908769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288225.1|909005_909872_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157232814.1|909942_910761_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
909968:909984	attL	CGATGCTTGTCGAGGAG	NA	NA	NA	NA
WP_083472553.1|910959_911169_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_054288228.1|912018_912225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288229.1|913505_917573_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_063810299.1|917572_918436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054296408.1|918941_919301_+	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	47.0	3.4e-17
WP_054288231.1|919665_919998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179950841.1|920334_921204_+	radical SAM protein	NA	NA	NA	NA	NA
WP_054288232.1|921220_921964_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_054288233.1|921960_922812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288234.1|922966_924055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288235.1|924287_925709_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054288236.1|925705_926284_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054288237.1|926280_926541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232815.1|927030_928227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288239.1|928534_930181_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	28.4	1.6e-05
WP_157232816.1|931081_932962_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLI2	Bacillus_phage	32.9	1.2e-07
935835:935851	attR	CTCCTCGACAAGCATCG	NA	NA	NA	NA
>prophage 2
NZ_CP012752	Kibdelosporangium phytohabitans strain KLBMP1111 chromosome, complete genome	11759770	1755036	1813303	11759770	protease,integrase	Planktothrix_phage(25.0%)	48	1757414:1757433	1816963:1816982
WP_054288866.1|1755036_1756341_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_179950846.1|1756484_1757486_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
1757414:1757433	attL	GGTCGAGACCCTCGACGGCG	NA	NA	NA	NA
WP_054288867.1|1757492_1758008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288868.1|1758132_1761153_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_054288869.1|1761552_1762494_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_054288870.1|1763230_1764400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042194088.1|1764503_1765004_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_179950813.1|1765079_1766177_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_054288871.1|1766236_1766926_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.3	4.8e-28
WP_054288872.1|1766968_1767874_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_054288873.1|1767905_1768388_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	53.4	1.8e-37
WP_083472583.1|1768459_1769260_+	amidohydrolase	NA	NA	NA	NA	NA
WP_054288875.1|1769256_1770528_-	acyltransferase	NA	NA	NA	NA	NA
WP_054288876.1|1770648_1771293_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_083471566.1|1771280_1772567_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_054296494.1|1773498_1774395_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054288877.1|1774546_1775764_+	lipase	NA	NA	NA	NA	NA
WP_054288878.1|1776094_1776538_+	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
WP_054288879.1|1776497_1777436_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054288880.1|1777475_1778201_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_054288881.1|1778210_1778447_+	maleylpyruvate isomerase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_169798877.1|1778455_1778665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288883.1|1778747_1779611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083472584.1|1779626_1781411_+	biotin carboxylase	NA	NA	NA	NA	NA
WP_054288885.1|1781440_1782364_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_054288886.1|1782371_1782572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288887.1|1782772_1783141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288888.1|1783158_1783377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054288889.1|1783342_1785667_-	ATP-dependent helicase HrpB	NA	A0A1V0SBU4	Catovirus	26.2	9.9e-33
WP_083471567.1|1785748_1786252_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_054288890.1|1786257_1787061_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_054288891.1|1787043_1788345_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_157232908.1|1788997_1790038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169798878.1|1790301_1790673_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_169798879.1|1790938_1791280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288895.1|1791288_1793154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288896.1|1793150_1793384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157232909.1|1793939_1795271_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_157232910.1|1797546_1798140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232911.1|1799826_1800012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054288901.1|1800144_1801329_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	28.1	4.6e-18
WP_157232912.1|1801376_1801601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157232913.1|1803445_1803964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083471571.1|1804019_1806224_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063809990.1|1806217_1807210_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_054288905.1|1807675_1809583_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_054288906.1|1809615_1812021_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083472586.1|1812073_1813303_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1816963:1816982	attR	GGTCGAGACCCTCGACGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP012752	Kibdelosporangium phytohabitans strain KLBMP1111 chromosome, complete genome	11759770	3387150	3446456	11759770	transposase,integrase	Staphylococcus_phage(25.0%)	53	3381263:3381291	3424360:3424388
3381263:3381291	attL	GCGTTGTCCAGCACGATCAGCATCCGGCG	NA	NA	NA	NA
WP_083471710.1|3387150_3388320_-|integrase	site-specific integrase	integrase	A0A0A7S2C0	Mycobacterium_phage	36.6	1.2e-50
WP_054290076.1|3388332_3388920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290077.1|3389020_3389278_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083471711.1|3389270_3389495_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_083471712.1|3389524_3390670_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_054290079.1|3390708_3391170_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_054290080.1|3391166_3392714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290081.1|3392750_3393407_-	YdcF family protein	NA	NA	NA	NA	NA
WP_179950849.1|3393418_3394645_-	helix-turn-helix domain-containing protein	NA	A0A0M4RQ74	Streptomyces_phage	36.9	6.5e-52
WP_157233034.1|3395134_3395548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083471713.1|3395664_3395832_+	FxLD family lanthipeptide	NA	NA	NA	NA	NA
WP_063810042.1|3395912_3398978_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	21.0	1.5e-25
WP_054290084.1|3398974_3400150_+	lanthionine synthetase C family protein	NA	A0A2H4PQH9	Staphylococcus_phage	23.1	2.0e-10
WP_054290085.1|3400221_3401433_+	methyltransferase, FxLD system	NA	A0A1J0MC50	Streptomyces_phage	37.0	1.7e-23
WP_054290086.1|3401965_3404404_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_054290087.1|3404400_3406080_+	DEAD/DEAH box helicase family protein	NA	A0A140XG92	Salmonella_phage	29.7	9.0e-28
WP_054290088.1|3406076_3406694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083472641.1|3406695_3407199_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	37.3	2.7e-12
WP_169798924.1|3407222_3408356_+	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	27.2	1.5e-18
WP_054290091.1|3408418_3409249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290092.1|3409224_3411069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157233035.1|3411128_3414632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290094.1|3414855_3417318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290095.1|3417377_3418022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179950850.1|3418592_3418790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169798925.1|3418837_3419470_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	34.8	9.6e-15
WP_054290097.1|3419366_3420761_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	2.9e-32
WP_169798926.1|3420793_3420934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157233037.1|3420864_3421365_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_169798927.1|3421503_3421683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157233038.1|3423228_3426165_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
3424360:3424388	attR	CGCCGGATGCTGATCGTGCTGGACAACGC	NA	NA	NA	NA
WP_169798813.1|3427360_3427792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290099.1|3429402_3429753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290100.1|3430389_3430587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290101.1|3431475_3431733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157233785.1|3432228_3435882_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_054290103.1|3436081_3436435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179950851.1|3436718_3437756_+	cytochrome P450	NA	NA	NA	NA	NA
WP_054290106.1|3437801_3438299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169798928.1|3438496_3438856_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_054290108.1|3439172_3439490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290109.1|3439482_3439683_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_054290110.1|3439771_3440224_-	ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_157233039.1|3440237_3440426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290112.1|3440614_3441124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290113.1|3441653_3442064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290115.1|3442513_3442909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290116.1|3443140_3443341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290117.1|3444023_3444338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290118.1|3444437_3444797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054290119.1|3444785_3445025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054290120.1|3445522_3445855_-|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	64.4	7.0e-33
WP_083471721.1|3445835_3446456_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	57.1	2.9e-40
>prophage 4
NZ_CP012752	Kibdelosporangium phytohabitans strain KLBMP1111 chromosome, complete genome	11759770	5775062	5783302	11759770		Mycobacterium_phage(33.33%)	7	NA	NA
WP_054291799.1|5775062_5776346_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.6	1.8e-132
WP_054291800.1|5776592_5777183_-	GTP cyclohydrolase I	NA	A0A172Q012	Pseudomonas_phage	46.5	1.4e-36
WP_063810424.1|5777179_5777944_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A142F2D5	Mycobacterium_phage	41.9	1.0e-39
WP_054291802.1|5777943_5778396_-	6-carboxytetrahydropterin synthase	NA	A0A2P1JXS3	Rhodococcus_phage	34.1	6.0e-11
WP_054291803.1|5778392_5779103_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2L0HKG0	Mycobacterium_phage	52.6	1.1e-54
WP_054291804.1|5779751_5780204_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_054291805.1|5780236_5783302_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	27.3	1.9e-39
>prophage 5
NZ_CP012752	Kibdelosporangium phytohabitans strain KLBMP1111 chromosome, complete genome	11759770	7774395	7837012	11759770	plate,tail,transposase	Staphylococcus_phage(22.22%)	58	NA	NA
WP_054293302.1|7774395_7774713_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	39.4	1.1e-08
WP_054293303.1|7774769_7775303_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054297151.1|7775299_7776202_-	pirin family protein	NA	NA	NA	NA	NA
WP_054297152.1|7776198_7776495_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_083472799.1|7776656_7777196_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054293305.1|7777240_7777693_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054293306.1|7777756_7778125_+	VOC family protein	NA	NA	NA	NA	NA
WP_054293307.1|7778117_7778615_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_169798824.1|7778514_7778973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054293309.1|7780102_7780639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054293310.1|7780635_7781532_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.0	1.4e-40
WP_054293311.1|7781521_7782340_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054293312.1|7782353_7783448_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_054293313.1|7783444_7784095_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.3	7.1e-05
WP_054293314.1|7784087_7785209_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_054293315.1|7785261_7786197_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_054293316.1|7786175_7786616_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054293317.1|7786753_7787704_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	44.8	1.4e-57
WP_054297153.1|7788934_7789696_-	DUF899 domain-containing protein	NA	NA	NA	NA	NA
WP_054293318.1|7790442_7790847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293319.1|7790894_7791542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293320.1|7791517_7791847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293321.1|7791843_7792041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293322.1|7792103_7792574_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_054293323.1|7792566_7792755_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_054293325.1|7796261_7796897_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054293326.1|7796957_7797236_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_054293327.1|7797330_7798092_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_054297154.1|7798218_7799163_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_083472801.1|7799190_7800312_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_054293329.1|7800313_7800622_+	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
WP_054293330.1|7800611_7801073_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_054293331.1|7801069_7802110_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_054293332.1|7802146_7802893_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_083472129.1|7802910_7803807_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.6	1.3e-60
WP_054297156.1|7803867_7804518_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_054297157.1|7804545_7805319_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_054297158.1|7805302_7807210_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	38.6	1.7e-06
WP_054293334.1|7808953_7810792_+	dynamin family protein	NA	NA	NA	NA	NA
WP_054293335.1|7810788_7812420_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_054297159.1|7812535_7812928_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_054293336.1|7813017_7814409_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.8	2.2e-19
WP_054293337.1|7814405_7816958_-	Hsp70 family protein	NA	A0A2P1ELQ7	Moumouvirus	26.7	4.0e-27
WP_054293338.1|7817137_7818118_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054293339.1|7818119_7819262_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_054293340.1|7819258_7821649_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_083472132.1|7821764_7824110_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_054293342.1|7824116_7825622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054293343.1|7826608_7827154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293344.1|7827150_7829115_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_054293345.1|7829111_7829528_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_054293346.1|7829547_7831203_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_054293347.1|7831195_7831873_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054293348.1|7831873_7833799_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_054293349.1|7833917_7834382_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_054293351.1|7834547_7834904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054293352.1|7834965_7835397_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_054293353.1|7835419_7837012_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.5	5.3e-62
