The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012687	Ralstonia solanacearum strain UY031 chromosome, complete genome	3412138	50635	89614	3412138	transposase,protease	Burkholderia_phage(50.0%)	36	NA	NA
WP_003261205.1|50635_51622_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003265059.1|53093_54659_+	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	26.8	2.2e-12
WP_003265060.1|54655_55558_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003265061.1|55554_56436_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_039557569.1|56682_57288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020956942.1|57294_57504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|57621_58608_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003263795.1|58939_59251_+	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_003263796.1|59330_60035_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003263797.1|60038_61064_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_039557497.1|61194_62325_-	porin	NA	NA	NA	NA	NA
WP_003263799.1|62814_63096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263800.1|63300_64611_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003261205.1|64772_65759_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_094472169.1|65846_66356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261391.1|67250_67511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003266067.1|67925_69059_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_003266068.1|69036_71760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263120.1|71766_72573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162835365.1|72844_73792_+	MFS transporter	NA	NA	NA	NA	NA
WP_020956938.1|73855_74392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|75015_76002_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_139111277.1|76031_76805_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_003261729.1|76886_77750_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_103010494.1|77927_78122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261727.1|78409_79978_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.3	9.0e-14
WP_003261726.1|80346_81135_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003261725.1|81339_82116_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003261724.1|82129_82801_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_003261722.1|82797_83559_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	2.7e-32
WP_003261721.1|83555_84863_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003261720.1|84869_85664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003261719.1|85893_86679_+	membrane protein	NA	NA	NA	NA	NA
WP_003261718.1|86713_87379_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.3e-25
WP_003261714.1|87354_88689_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003261713.1|88789_89614_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP012687	Ralstonia solanacearum strain UY031 chromosome, complete genome	3412138	914498	924644	3412138		Hokovirus(14.29%)	9	NA	NA
WP_003263057.1|914498_916466_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	51.3	9.5e-146
WP_003273455.1|916599_917745_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.0	1.9e-21
WP_003265103.1|917780_919667_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	36.9	8.8e-56
WP_003265102.1|919622_920309_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.3e-12
WP_003265101.1|920316_921024_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003265099.1|921030_921852_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.8e-34
WP_003265097.1|921908_922553_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	27.9	3.7e-06
WP_003265096.1|922584_923094_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003265095.1|923093_924644_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	34.5	7.3e-24
>prophage 3
NZ_CP012687	Ralstonia solanacearum strain UY031 chromosome, complete genome	3412138	1103339	1206080	3412138	plate,integrase,head,terminase,transposase,tail,tRNA,coat	Burkholderia_phage(23.53%)	101	1120130:1120149	1157449:1157468
WP_003263536.1|1103339_1105982_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.0	6.1e-79
WP_079693333.1|1106131_1106461_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003263538.1|1106464_1107505_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	42.9	5.4e-23
WP_003263540.1|1108047_1109154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263541.1|1109150_1110203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039556087.1|1110448_1112557_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003263543.1|1112591_1113299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263544.1|1113308_1114058_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	30.7	2.5e-22
WP_003263545.1|1114093_1115500_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_039556060.1|1115574_1116483_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003263547.1|1116591_1117809_+	MFS transporter	NA	NA	NA	NA	NA
WP_003263549.1|1117885_1118671_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_003279296.1|1118683_1118872_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003279298.1|1118912_1119950_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_039556057.1|1119966_1120548_+	NUDIX hydrolase	NA	NA	NA	NA	NA
1120130:1120149	attL	TGTTCCTGGCGCGCAATGCG	NA	NA	NA	NA
WP_003263554.1|1120586_1120814_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_003263555.1|1120858_1121242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003263556.1|1121252_1122503_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003263557.1|1122573_1123206_-	LysE family translocator	NA	NA	NA	NA	NA
WP_003263558.1|1123339_1123765_-	universal stress protein	NA	NA	NA	NA	NA
WP_003263559.1|1124017_1124410_+	RcnB family protein	NA	NA	NA	NA	NA
WP_003263560.1|1124481_1124844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039556084.1|1125006_1125627_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_003263562.1|1125860_1126685_+	endoglucanase	NA	NA	NA	NA	NA
WP_003263564.1|1129997_1130582_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_003263566.1|1130630_1131911_-	hypothetical protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	40.7	1.6e-77
WP_085059560.1|1132020_1132563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263567.1|1132629_1134183_-	DUF935 family protein	NA	J9SVY0	Pseudomonas_phage	40.9	1.0e-89
WP_003263569.1|1134175_1135852_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	52.1	1.4e-158
WP_003263570.1|1135838_1136339_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	37.5	4.7e-09
WP_003263571.1|1136342_1136711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003263572.1|1136707_1137205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957375.1|1137201_1137834_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	49.0	4.9e-35
WP_003263573.1|1137836_1138172_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	63.1	4.0e-28
WP_141213944.1|1138276_1138795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957373.1|1138791_1139160_-	helix-turn-helix transcriptional regulator	NA	A4JWN8	Burkholderia_virus	50.5	1.5e-15
WP_003263577.1|1139245_1139425_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	53.6	2.2e-09
WP_003263578.1|1139433_1140546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263579.1|1140549_1142232_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	36.9	7.5e-91
WP_003263580.1|1142244_1143192_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	42.7	1.1e-62
WP_039556050.1|1143204_1143408_+	hypothetical protein	NA	B5TA82	Burkholderia_phage	64.3	9.8e-06
WP_039556048.1|1143404_1143710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263582.1|1143696_1144284_+	hypothetical protein	NA	B5TA84	Burkholderia_phage	59.3	5.2e-47
WP_003263583.1|1144280_1144913_+	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	72.0	3.0e-77
WP_003263584.1|1144984_1145260_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	46.6	2.1e-11
WP_003263585.1|1145343_1146045_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	39.8	7.8e-34
WP_003263586.1|1146047_1146503_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_003263587.1|1146506_1146965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020957369.1|1147175_1147475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957368.1|1147477_1147960_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_003263590.1|1148106_1149090_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	33.3	5.1e-39
WP_003263592.1|1149157_1150060_+|head	Mu-like prophage major head subunit gpT family protein	head	H6V827	Pseudomonas_virus	42.2	5.1e-62
WP_003263593.1|1150149_1150404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263594.1|1150403_1150898_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_003263595.1|1150894_1151374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263596.1|1151370_1152843_+	glucose-6-phosphate isomerase	NA	A0A2P9JZJ8	Alteromonadaceae_phage	34.3	4.4e-63
WP_003263597.1|1152893_1153256_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_003263599.1|1153265_1153619_+	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	67.5	4.2e-36
WP_003263600.1|1153649_1153976_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003263602.1|1154205_1156350_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	37.7	3.4e-64
WP_003263604.1|1156349_1157510_+	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
1157449:1157468	attR	TGTTCCTGGCGCGCAATGCG	NA	NA	NA	NA
WP_103010507.1|1157496_1158558_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003263606.1|1158554_1159133_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	29.7	3.4e-11
WP_020957365.1|1159518_1160568_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	28.0	2.5e-15
WP_003263608.1|1160564_1161137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139111307.1|1161219_1162290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263611.1|1162293_1162833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1162862_1163849_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_155282217.1|1168494_1168644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265229.1|1169222_1169981_-	pirin family protein	NA	NA	NA	NA	NA
WP_003265228.1|1169970_1171044_-	alkene reductase	NA	NA	NA	NA	NA
WP_003265227.1|1171092_1171989_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003265226.1|1172091_1172964_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003265225.1|1173188_1173524_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003265224.1|1173516_1173993_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_039557225.1|1174198_1174384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039558847.1|1175254_1179043_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_020957362.1|1179149_1179833_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003265221.1|1179829_1180549_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_003265219.1|1180710_1181220_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003278028.1|1181384_1182041_-	OmpA family protein	NA	NA	NA	NA	NA
WP_039557126.1|1182449_1185107_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	3.0e-102
WP_003265216.1|1185233_1185803_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_039557129.1|1185916_1187053_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.8	2.4e-85
WP_014617563.1|1187141_1188257_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003265213.1|1188311_1189436_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_020957359.1|1189535_1190432_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_020957358.1|1190453_1191761_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003266086.1|1191791_1192484_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_013206609.1|1192622_1194311_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003266089.1|1194347_1194770_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_039550149.1|1194952_1195273_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003266092.1|1195276_1196554_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_003266094.1|1196613_1197987_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.6	7.3e-76
WP_051978125.1|1198012_1198960_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.3	4.0e-17
WP_003266096.1|1198956_1199952_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	33.0	8.2e-29
WP_003266098.1|1200077_1200395_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039557133.1|1200498_1201401_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	2.2e-52
WP_039557135.1|1201479_1202592_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_081008926.1|1203848_1205258_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.6e-155
WP_020957355.1|1205348_1206080_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP012687	Ralstonia solanacearum strain UY031 chromosome, complete genome	3412138	1224428	1238767	3412138	transposase,integrase,tRNA	Ralstonia_phage(81.25%)	16	1221879:1221893	1229953:1229967
1221879:1221893	attL	ACCAGTCCAGATCGG	NA	NA	NA	NA
WP_020957348.1|1224428_1225709_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	27.0	6.9e-12
WP_003262651.1|1227015_1228332_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.1	4.2e-97
WP_003262650.1|1228555_1229146_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	100.0	2.3e-103
WP_085059554.1|1229165_1229444_+	hypothetical protein	NA	A0A1W5LUF4	Ralstonia_phage	100.0	1.5e-25
WP_003262649.1|1229440_1230376_-	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	100.0	2.7e-175
1229953:1229967	attR	ACCAGTCCAGATCGG	NA	NA	NA	NA
WP_003262646.1|1230893_1232207_-	zonular occludens toxin	NA	A0A1W5LU16	Ralstonia_phage	100.0	2.1e-245
WP_003262644.1|1232211_1232541_-	DUF2523 domain-containing protein	NA	A0A1W5LU17	Ralstonia_phage	100.0	6.6e-52
WP_003262643.1|1232553_1234077_-	hypothetical protein	NA	A0A1W5LU35	Ralstonia_phage	100.0	3.2e-226
WP_003262642.1|1234151_1234370_-	hypothetical protein	NA	A0A1W5LU14	Ralstonia_phage	100.0	9.8e-28
WP_020747891.1|1234372_1234621_-	hypothetical protein	NA	A0A1W5LU65	Ralstonia_phage	100.0	9.8e-40
WP_003262641.1|1234623_1234833_-	hypothetical protein	NA	A0A1W5LU18	Ralstonia_phage	100.0	4.2e-28
WP_020957344.1|1235041_1235320_-	hypothetical protein	NA	A0A1W5LU15	Ralstonia_phage	100.0	5.6e-44
WP_039555742.1|1235329_1235575_-	hypothetical protein	NA	A0A1W5LUE4	Ralstonia_phage	100.0	3.5e-42
WP_003262639.1|1235574_1235901_-	hypothetical protein	NA	A0A1W5LU53	Ralstonia_phage	100.0	1.7e-52
WP_020957343.1|1236093_1236384_+	lambda repressor-like, dna-binding; protein	NA	A0A1W5LU58	Ralstonia_phage	100.0	2.0e-44
WP_003261205.1|1237780_1238767_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
>prophage 5
NZ_CP012687	Ralstonia solanacearum strain UY031 chromosome, complete genome	3412138	2252141	2308280	3412138	transposase,integrase,tRNA	Acinetobacter_phage(18.18%)	50	2289689:2289716	2308414:2308441
WP_004376877.1|2252141_2252888_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003276153.1|2252874_2253648_+	arginyltransferase	NA	NA	NA	NA	NA
WP_020957167.1|2253663_2253831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004376874.1|2253852_2254167_-	TM2 domain-containing protein	NA	A0A240F358	Aeromonas_phage	35.9	9.9e-05
WP_004376872.1|2254225_2254516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003276147.1|2254512_2255922_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_004376869.1|2255961_2256687_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_039556977.1|2256924_2257722_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004376865.1|2257803_2258982_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_039556976.1|2259411_2260119_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.4	6.7e-25
WP_003276139.1|2260129_2260576_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_039556975.1|2260631_2261549_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004376859.1|2261545_2262520_-	histone deacetylase	NA	NA	NA	NA	NA
WP_003267692.1|2262910_2263495_+	phasin family protein	NA	NA	NA	NA	NA
WP_039556973.1|2263856_2264414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004376853.1|2264511_2266302_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	1.9e-36
WP_004376852.1|2266356_2266932_-	MFS transporter	NA	NA	NA	NA	NA
WP_020957165.1|2267022_2268699_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004376849.1|2268854_2271545_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004376847.1|2271860_2274431_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003267679.1|2274475_2275108_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003276124.1|2275199_2276069_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.0	1.4e-35
WP_004376836.1|2276179_2278300_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	22.1	1.3e-34
WP_004376834.1|2278381_2279653_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_039556201.1|2279802_2280612_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_039556199.1|2280626_2281091_+	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_039548911.1|2281101_2281908_-	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_003276118.1|2282186_2282474_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_004376820.1|2282773_2283577_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004376817.1|2283589_2285020_-	amino acid permease	NA	NA	NA	NA	NA
WP_004376816.1|2285221_2286310_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_039548900.1|2286443_2286800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039556196.1|2287165_2288119_+	aldose epimerase	NA	NA	NA	NA	NA
WP_004376810.1|2288110_2288470_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004376808.1|2288587_2289508_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
2289689:2289716	attL	CTGGTCGGGGCGAGAGGATTTGAACCTC	NA	NA	NA	NA
WP_020957159.1|2289879_2290527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004376804.1|2290779_2291163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004376802.1|2291739_2292144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004376800.1|2292592_2296750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005263.1|2296759_2297943_-|transposase	IS3-like element ISRso20 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.0	4.4e-53
WP_051719662.1|2298022_2298595_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039557505.1|2298647_2299289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261984.1|2299295_2299964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005267.1|2300277_2301488_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.0	5.8e-101
WP_003261205.1|2301688_2302675_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_054277976.1|2302799_2303327_-	hypothetical protein	NA	A0A1L7N0I9	Ralstonia_phage	49.5	1.8e-22
WP_003264309.1|2303975_2304557_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	33.0	7.0e-12
WP_039557699.1|2304721_2305042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005263.1|2305956_2307139_+|transposase	IS3-like element ISRso20 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.0	4.4e-53
WP_003264306.1|2307149_2308280_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
2308414:2308441	attR	CTGGTCGGGGCGAGAGGATTTGAACCTC	NA	NA	NA	NA
>prophage 1
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	108732	178644	1999545	transposase	Burkholderia_phage(40.0%)	41	NA	NA
WP_003261205.1|108732_109719_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261548.1|109878_110652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039557221.1|110661_113976_+	DEAD/DEAH box helicase	NA	E3T5F3	Cafeteria_roenbergensis_virus	30.7	2.0e-07
WP_086005266.1|113982_114788_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	2.2e-24
WP_054277979.1|117526_119569_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_139111285.1|122004_122394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039557490.1|122552_122846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|123536_124523_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_086005279.1|124915_125720_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.0	4.9e-24
WP_170816276.1|125717_127019_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.9	2.3e-10
WP_003265634.1|127349_128333_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003265635.1|128411_129497_-	FUSC family protein	NA	NA	NA	NA	NA
WP_003265637.1|129751_130810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265639.1|130951_131227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265640.1|131653_132889_-	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_003265641.1|132978_133437_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_039557097.1|133525_134716_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_079693383.1|134924_135290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003265644.1|137545_138058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265645.1|138054_138597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265646.1|138593_139112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265647.1|139111_139957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265648.1|139953_141645_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_039557094.1|141641_142829_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_003265650.1|142841_143267_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_155283330.1|148560_148893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020957562.1|149986_152113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079693384.1|152183_153674_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_003261205.1|154032_155019_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_170816271.1|155291_156563_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_003261406.1|156702_157449_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_003261405.1|157427_158882_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003261404.1|158912_159110_-	MbtH family protein	NA	NA	NA	NA	NA
WP_155492524.1|159160_160111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172680717.1|160704_161331_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_155492525.1|161431_162043_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_054277983.1|161988_174597_-	non-ribosomal peptide synthase	NA	A0A2K9L3I8	Tupanvirus	26.6	4.7e-153
WP_039557529.1|174583_175201_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_003261402.1|175259_176174_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	31.7	2.2e-28
WP_094472174.1|176654_177257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|177657_178644_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
>prophage 2
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	326993	385923	1999545	transposase	Burkholderia_phage(44.44%)	41	NA	NA
WP_086005279.1|326993_327799_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.0	4.9e-24
WP_139384590.1|328011_328350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003262860.1|328378_328852_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020957916.1|328948_329293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039556914.1|329435_330080_+	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_039556917.1|330076_331108_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_039556919.1|331829_333065_+	MFS transporter	NA	NA	NA	NA	NA
WP_003262864.1|333099_333540_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020957912.1|333690_335928_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003262866.1|336208_336799_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003262867.1|337029_339456_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003262868.1|339552_340569_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	5.6e-41
WP_003262869.1|340571_341591_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	A0A1V0SL93	Klosneuvirus	22.4	7.4e-09
WP_003262870.1|341587_343489_+	IucC protein	NA	NA	NA	NA	NA
WP_003262871.1|343485_344709_+	MFS transporter	NA	NA	NA	NA	NA
WP_003262872.1|344714_346550_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_003262873.1|346546_348316_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_003262874.1|348312_349104_+	aldolase	NA	NA	NA	NA	NA
WP_003262875.1|349100_350342_+	type III PLP-dependent enzyme	NA	A0A060D2X4	Bovine_gammaherpesvirus	25.1	2.6e-16
WP_003262876.1|350431_351106_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003262877.1|351130_351691_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_003262878.1|352103_352385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|353027_354014_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_049281045.1|354473_356234_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_003262731.1|356260_358552_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_086005271.1|359241_360047_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.0	6.5e-24
WP_003261205.1|360378_361365_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_039555409.1|363080_363851_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003261978.1|364093_365215_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_020957908.1|365315_365588_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_003261976.1|365726_366689_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_003261975.1|366710_367883_+	chromate transporter	NA	NA	NA	NA	NA
WP_003261974.1|367896_368358_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_003261973.1|368424_368925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003261972.1|368989_369970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003261971.1|370271_371180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079693425.1|371480_380864_-	Type III effector protein (Skwp 4)	NA	NA	NA	NA	NA
WP_003261966.1|381736_382612_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020957903.1|382773_383163_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_003261205.1|383535_384522_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261205.1|384936_385923_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
>prophage 3
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	521614	551075	1999545	transposase,coat	Burkholderia_phage(66.67%)	21	NA	NA
WP_003263120.1|521614_522421_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003261205.1|522544_523531_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261205.1|524297_525284_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261205.1|525786_526773_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003266195.1|527089_528469_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.6	9.3e-63
WP_003266197.1|528523_528865_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_003266198.1|529161_530907_-	DUF2334 domain-containing protein	NA	NA	NA	NA	NA
WP_079693453.1|530924_531218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039557907.1|531892_532219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079693454.1|532263_532686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003266200.1|532735_533305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|533438_534425_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261201.1|535039_537553_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	2.2e-17
WP_003261200.1|537627_538266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261199.1|538270_540040_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_003261197.1|540057_540894_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003261195.1|541239_542358_+	Fic family protein	NA	NA	NA	NA	NA
WP_020957684.1|542671_543025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261191.1|543167_544598_-	amino acid permease	NA	NA	NA	NA	NA
WP_079693365.1|548938_550024_+	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_170816269.1|550616_551075_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	928528	946715	1999545	transposase,plate	Burkholderia_phage(66.67%)	14	NA	NA
WP_003261205.1|928528_929515_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003265064.1|929981_931034_-	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_003261205.1|931258_932245_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003266186.1|933743_936731_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	8.5e-45
WP_003276655.1|936791_937580_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_003266190.1|937576_938923_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003264060.1|938977_939658_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_003276660.1|939929_940577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003264062.1|940613_941126_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003264063.1|941118_942609_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003264065.1|942697_943201_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003264066.1|943261_943735_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003264067.1|943797_945648_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003264068.1|945611_946715_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	1316978	1395426	1999545	transposase	Burkholderia_phage(25.0%)	57	NA	NA
WP_003261205.1|1316978_1317965_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003265319.1|1318390_1318744_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003265318.1|1318794_1319976_-	amidohydrolase	NA	NA	NA	NA	NA
WP_039557445.1|1319972_1320671_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003265315.1|1320954_1321854_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_003265314.1|1321853_1324469_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_003265313.1|1324499_1327934_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_039557900.1|1328178_1329246_+	putative zinc-binding metallopeptidase	NA	NA	NA	NA	NA
WP_155283328.1|1329370_1329523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155419096.1|1329519_1329672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003265311.1|1329959_1330820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003277059.1|1331123_1331375_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_003265309.1|1331876_1332146_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_003265306.1|1332167_1333046_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_003265305.1|1333032_1333803_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003265304.1|1333799_1334288_+	DoxX family protein	NA	NA	NA	NA	NA
WP_003265303.1|1334453_1334888_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003265302.1|1335515_1336961_+	TolC family protein	NA	NA	NA	NA	NA
WP_003265301.1|1336965_1338132_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_039556171.1|1338134_1341230_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.5	3.0e-29
WP_003265298.1|1341358_1341883_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003265294.1|1343695_1345345_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003265293.1|1345379_1347719_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_003265292.1|1347718_1347967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003265291.1|1347963_1348782_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003265290.1|1348778_1350383_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003265289.1|1350523_1352419_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.6	1.7e-70
WP_003265287.1|1352772_1352976_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	1.8e-23
WP_020957835.1|1353175_1353382_+	cold-shock protein	NA	NA	NA	NA	NA
WP_020957836.1|1353457_1354981_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039556174.1|1354982_1356320_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_039556185.1|1356477_1357881_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.0	9.2e-18
WP_003262770.1|1358304_1359048_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_003262771.1|1359103_1359889_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003262774.1|1359930_1361199_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_003261205.1|1361858_1362845_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_054277986.1|1362920_1365683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039556188.1|1365928_1367053_-	oxidoreductase	NA	NA	NA	NA	NA
WP_039556177.1|1367305_1369435_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_039556179.1|1369537_1370449_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_003262779.1|1370759_1375946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003262780.1|1376541_1379094_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_039556181.1|1379152_1380394_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_003262782.1|1380445_1381894_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	23.9	1.9e-18
WP_003262783.1|1381886_1383284_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003262785.1|1383397_1384420_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	6.3e-24
WP_020957842.1|1384977_1385895_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.5	1.9e-08
WP_003262788.1|1385994_1386372_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003262789.1|1386417_1387404_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079693399.1|1388378_1388795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1389064_1390051_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_139111272.1|1390243_1390582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005273.1|1391117_1391922_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	2.9e-24
WP_039565473.1|1391946_1392348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079693452.1|1392750_1393074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005278.1|1393446_1394252_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.8	1.3e-24
WP_003263120.1|1394619_1395426_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	1614017	1671992	1999545	transposase	Burkholderia_phage(50.0%)	51	NA	NA
WP_003261205.1|1614017_1615004_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_039556572.1|1615469_1616549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263364.1|1616585_1618091_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_003263363.1|1618217_1619603_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003263362.1|1619763_1620231_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_003263361.1|1620233_1623569_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_003263360.1|1623568_1624156_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_003263358.1|1624152_1624905_-	PilW family protein	NA	NA	NA	NA	NA
WP_003263355.1|1624901_1625438_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_003263354.1|1625434_1626139_-	type II transport protein GspH	NA	NA	NA	NA	NA
WP_003263353.1|1626893_1627316_-	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	46.7	2.2e-15
WP_003263352.1|1627312_1627498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003263351.1|1627494_1628943_-	DUF4178 domain-containing protein	NA	NA	NA	NA	NA
WP_039556569.1|1629026_1630061_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_003277411.1|1630102_1630492_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_003263349.1|1630843_1632103_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003263348.1|1632151_1633021_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003263345.1|1633017_1633986_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020957889.1|1633982_1634732_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	2.8e-13
WP_003263344.1|1634728_1635439_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	5.0e-12
WP_003263343.1|1635583_1637167_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	26.8	2.5e-11
WP_003263342.1|1637180_1638803_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003263341.1|1638833_1639529_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003263340.1|1639675_1640038_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003263339.1|1640177_1641053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039556570.1|1641065_1648493_+	type III effector protein skwp2	NA	NA	NA	NA	NA
WP_020957892.1|1648599_1649073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003266071.1|1649269_1650256_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_039555603.1|1650534_1650825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1652147_1653134_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_139111291.1|1653412_1653817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139111290.1|1654001_1654241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005278.1|1654271_1655077_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.8	1.3e-24
WP_139111303.1|1655129_1656062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039557942.1|1656443_1657076_-	LysE family translocator	NA	NA	NA	NA	NA
WP_039557230.1|1657187_1657640_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014618693.1|1658526_1658811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1658898_1659885_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_004377303.1|1660083_1660458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004377307.1|1660475_1660730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003276399.1|1660813_1661035_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_020957653.1|1661064_1661328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079693401.1|1662120_1662354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004377313.1|1662547_1663153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003276395.1|1663149_1663788_-	SCO family protein	NA	NA	NA	NA	NA
WP_004377316.1|1663798_1664401_-	cytochrome c	NA	NA	NA	NA	NA
WP_003276391.1|1664411_1665023_-	cbb3-type cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_004377318.1|1665025_1666615_-	cbb3-type cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_004377322.1|1667019_1667910_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080726872.1|1668111_1668345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1671005_1671992_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
>prophage 7
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	1819118	1880564	1999545	tail,transposase	Ralstonia_phage(31.25%)	48	NA	NA
WP_003263120.1|1819118_1819925_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003261205.1|1820106_1821093_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003265743.1|1821335_1821998_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_003265745.1|1821997_1822399_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	32.3	5.0e-09
WP_020957621.1|1822556_1823684_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_039552298.1|1823705_1824323_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_020957620.1|1824403_1825282_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_020957619.1|1825764_1827582_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	8.9e-05
WP_003263515.1|1827745_1828237_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003263514.1|1828318_1830508_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003263513.1|1830526_1830940_-	response regulator	NA	W8CYM9	Bacillus_phage	37.5	2.1e-10
WP_003263512.1|1830987_1831932_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003263511.1|1832009_1832870_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003263509.1|1833320_1833881_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003263508.1|1833955_1834273_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003263506.1|1835266_1835713_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_003263505.1|1835798_1837412_+	membrane protein	NA	NA	NA	NA	NA
WP_003263504.1|1838031_1839189_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039558176.1|1839451_1840603_+	CoA transferase	NA	NA	NA	NA	NA
WP_003263501.1|1840673_1842014_-	gallate dioxygenase	NA	NA	NA	NA	NA
WP_003263500.1|1842023_1843352_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_003263498.1|1843550_1844750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020957616.1|1844868_1846008_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_003263497.1|1846035_1847064_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003263496.1|1847089_1847785_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003263495.1|1847849_1848944_+	porin	NA	NA	NA	NA	NA
WP_039558173.1|1848999_1849929_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039558171.1|1850290_1851940_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003263492.1|1851920_1852601_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.9e-32
WP_003263491.1|1852770_1853247_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_079693330.1|1853641_1853830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020957615.1|1853879_1855082_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	37.9	2.2e-68
WP_020957614.1|1855554_1856937_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_003263483.1|1857439_1858285_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003263482.1|1858297_1860055_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_039558164.1|1860069_1862610_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.3e-17
WP_086005265.1|1863314_1864120_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.8	1.3e-24
WP_003261205.1|1864366_1865353_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_039563184.1|1865488_1867333_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.0	2.2e-107
WP_039563185.1|1867337_1867736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014615737.1|1867732_1868215_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	52.0	8.6e-16
WP_039563186.1|1868218_1869385_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.1	1.9e-45
WP_039563187.1|1869399_1872987_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.2	0.0e+00
WP_039559478.1|1872987_1873383_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	49.2	3.8e-30
WP_039559476.1|1873388_1877489_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.5	1.1e-26
WP_003278075.1|1877563_1877815_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003278076.1|1877811_1878225_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_086005266.1|1879759_1880564_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	2.2e-24
>prophage 8
NZ_CP012688	Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence	1999545	1884031	1932110	1999545	capsid,portal,head,terminase,transposase	Acidithiobacillus_phage(30.43%)	52	NA	NA
WP_039562664.1|1884031_1884805_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	44.0	2.8e-48
WP_039562654.1|1884912_1885359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039562650.1|1885365_1885668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039562646.1|1885670_1886675_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.3	1.1e-110
WP_039562645.1|1886681_1887059_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	2.3e-24
WP_039562644.1|1887076_1888327_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.0	6.0e-61
WP_039562639.1|1888336_1889863_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.0	8.5e-150
WP_039562638.1|1889862_1890084_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	2.0e-12
WP_039562631.1|1890083_1890476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039562629.1|1890486_1890996_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	46.2	8.8e-27
WP_039562627.1|1891039_1893019_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.2	0.0e+00
WP_039562624.1|1893018_1893555_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	80.3	1.1e-72
WP_039562623.1|1893568_1893919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562621.1|1894034_1894508_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	62.5	2.7e-22
WP_039562680.1|1894634_1894985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003261205.1|1895130_1896117_-|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_053062623.1|1896193_1896916_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_039562491.1|1897208_1897637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039562493.1|1897623_1898811_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_039562497.1|1898785_1899040_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_039562499.1|1899423_1899708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562502.1|1899704_1900202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562504.1|1900198_1901071_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	6.4e-102
WP_039562526.1|1901089_1901722_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	60.1	6.5e-64
WP_039562505.1|1901731_1902199_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	55.2	8.3e-40
WP_039562508.1|1902204_1902594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562510.1|1902577_1904887_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.8	2.6e-296
WP_039562512.1|1905118_1905331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562514.1|1905320_1905728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039562516.1|1906140_1907544_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.9	8.8e-162
WP_039562519.1|1907540_1908776_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.3	7.2e-192
WP_047942537.1|1908735_1908981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039562521.1|1909134_1909323_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	63.2	2.0e-13
WP_039562523.1|1909486_1909855_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	48.1	1.6e-17
WP_003261205.1|1910122_1911109_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_003261205.1|1911335_1912322_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
WP_085059558.1|1912463_1912793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139111273.1|1913001_1913553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263465.1|1913713_1914688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957609.1|1914684_1915980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957608.1|1916159_1917068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003263468.1|1917342_1918803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263470.1|1919032_1919224_-	recombinase family protein	NA	NA	NA	NA	NA
WP_047942661.1|1919551_1920427_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003263474.1|1920619_1921507_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047942676.1|1922020_1922524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263475.1|1922717_1924277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079693389.1|1926284_1927970_+	glycoside hydrolase family 6 protein	NA	NA	NA	NA	NA
WP_079693390.1|1928367_1928595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155282251.1|1929066_1929237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005265.1|1930071_1930877_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.8	1.3e-24
WP_003261205.1|1931123_1932110_+|transposase	IS5-like element IS1021 family transposase	transposase	E5E3P6	Burkholderia_phage	84.6	1.5e-155
