The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	638219	665177	6058802	transposase,integrase	Bacillus_phage(33.33%)	28	659157:659176	668983:669002
WP_060710806.1|638219_639371_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_145981237.1|639683_640379_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169452.1|640404_640572_-	hypothetical protein	NA	M4R1H4	Synechococcus_phage	42.0	1.6e-06
WP_145981568.1|641341_641908_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060714365.1|642010_642535_-	DsbA family protein	NA	NA	NA	NA	NA
WP_060710810.1|642577_643918_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	38.3	2.7e-51
WP_060710811.1|645446_645815_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_145981569.1|645831_645963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710812.1|646161_647727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710813.1|647728_647914_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060710814.1|647913_649140_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	28.9	1.9e-27
WP_060710815.1|649148_649367_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_145981219.1|650468_651728_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|651820_652576_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060711070.1|652774_654070_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060710806.1|654429_655581_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_145981238.1|656825_657293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375127.1|657285_657594_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_060710816.1|657839_658394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710817.1|658384_658852_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_060710818.1|658859_659603_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
659157:659176	attL	GCGCAGCTCGACGGCGTCGC	NA	NA	NA	NA
WP_060710819.1|659760_660084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710820.1|660211_661021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064485362.1|661082_661979_+	cell division protein FtsK	NA	A0A1I9S6D5	Bacillus_phage	27.5	3.2e-08
WP_060710821.1|661975_662293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710822.1|662292_663819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710823.1|663834_664023_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060710824.1|664019_665177_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	30.9	7.3e-37
668983:669002	attR	GCGACGCCGTCGAGCTGCGC	NA	NA	NA	NA
>prophage 2
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	694039	743896	6058802	tRNA,transposase,protease	Bacillus_phage(28.57%)	46	NA	NA
WP_060710839.1|694039_694948_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.9e-28
WP_060710840.1|694944_695235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082375131.1|695194_695938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710842.1|695968_696442_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060710843.1|696482_697904_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_145981239.1|698150_698453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710845.1|698470_699622_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_193394020.1|701823_702864_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_060710849.1|704101_704716_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169435.1|704702_705086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169453.1|705010_705841_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060710852.1|705855_706644_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_060710853.1|707476_707977_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_193393998.1|707976_708195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714374.1|708269_709031_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_060710854.1|709027_709828_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_060710855.1|709867_710731_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082375733.1|710738_712160_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060714376.1|712207_712981_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060710856.1|713322_713964_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060710857.1|714662_715208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710858.1|715318_715852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710859.1|715848_716412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981241.1|716408_716774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714377.1|716917_717997_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.2e-20
WP_060710861.1|718069_718834_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	6.1e-08
WP_082375132.1|718830_719964_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_064485546.1|719960_720926_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060710862.1|721116_722550_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_082375134.1|722711_723713_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060710864.1|723681_724401_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_060710865.1|724397_725774_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_060710866.1|727934_728744_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_060714380.1|729019_730774_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_193394021.1|730809_732033_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_060710868.1|732029_732785_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_060710869.1|732795_733407_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060710870.1|733407_733824_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_043280142.1|733896_735957_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.7	9.6e-56
WP_060710871.1|736135_737026_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_060710872.1|737527_738784_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.5	1.8e-81
WP_145981242.1|738672_739209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711070.1|739409_740705_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060710875.1|741566_742142_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_060710876.1|742145_743432_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	37.4	4.9e-50
WP_060710877.1|743587_743896_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
>prophage 3
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	855028	917084	6058802	transposase	Shigella_phage(18.18%)	56	NA	NA
WP_060710839.1|855028_855937_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.9e-28
WP_060710840.1|855933_856224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060710942.1|857996_859328_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_060710943.1|859407_860196_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060710944.1|860229_860613_+	VOC family protein	NA	NA	NA	NA	NA
WP_145981575.1|860632_860866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710946.1|861021_861969_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060710947.1|862137_862959_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_060710948.1|862989_863703_+	MSMEG_4193 family putative phosphomutase	NA	NA	NA	NA	NA
WP_060710949.1|863799_864384_+	DUF3090 domain-containing protein	NA	NA	NA	NA	NA
WP_060714409.1|864434_865304_+	SCO1664 family protein	NA	NA	NA	NA	NA
WP_145981247.1|865300_867604_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_060710950.1|867792_868668_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060710840.1|868756_869047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060710839.1|869043_869952_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.9e-28
WP_082375150.1|870036_871473_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	32.5	8.8e-32
WP_060710952.1|871494_873144_-	MFS transporter	NA	NA	NA	NA	NA
WP_060710953.1|873336_873807_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_060710954.1|873783_874938_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	31.5	2.7e-31
WP_082375151.1|875038_876715_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_060710955.1|877023_877617_-	DinB family protein	NA	NA	NA	NA	NA
WP_060710956.1|877727_878030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710957.1|878046_879759_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_060710958.1|879890_881408_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_082375152.1|881463_882330_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_060710959.1|882506_883265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082375153.1|883261_884779_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_145981248.1|884916_885213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710961.1|885927_887382_-	glycosyltransferase family 2 protein	NA	A0A1V0S9E5	Catovirus	30.5	2.0e-31
WP_060710962.1|887501_888401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020623434.1|888510_889515_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	38.1	1.7e-45
WP_060710963.1|889537_889858_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060710964.1|889959_890937_+	transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	26.9	2.8e-05
WP_060710965.1|890996_891956_-	asparaginase	NA	NA	NA	NA	NA
WP_168169455.1|891957_892590_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060710967.1|892771_893446_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060714414.1|893445_894234_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_060710968.1|894230_894878_+	carboxyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060710969.1|894874_895822_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_060710970.1|895818_896307_+	VOC family protein	NA	NA	NA	NA	NA
WP_060710971.1|896488_897820_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.3	1.5e-46
WP_060710972.1|897816_898626_+	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
WP_060710973.1|900173_901091_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168169456.1|904015_904879_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_060714314.1|904927_905683_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|905775_907035_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060710974.1|908012_909251_+	helix-turn-helix transcriptional regulator	NA	A0A0K1Y5U6	Streptomyces_phage	34.3	1.1e-41
WP_060714415.1|909247_909814_+	flavoprotein	NA	NA	NA	NA	NA
WP_060710976.1|910285_910531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981251.1|910818_911526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375743.1|911633_912137_+	WhiB family transcriptional regulator	NA	A0A1D8ERX1	Mycobacterium_phage	41.2	5.5e-05
WP_060710978.1|912136_912682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710979.1|912681_912945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710980.1|912941_914849_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_060710981.1|914845_915514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710983.1|916121_917084_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	928041	972145	6058802	transposase,integrase	Paenibacillus_phage(12.5%)	40	949906:949925	976985:977004
WP_145981255.1|928041_928938_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.2	8.5e-17
WP_145981576.1|929026_930217_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082375157.1|930342_931413_-	ribonucleotide-diphosphate reductase subunit beta	NA	M4QT54	Vibrio_phage	26.6	7.0e-26
WP_082375158.1|931409_934295_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	9.3e-166
WP_060710993.1|934687_935512_-	amidohydrolase	NA	NA	NA	NA	NA
WP_060710862.1|935768_937202_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145981256.1|937493_938072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710995.1|938034_939321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710996.1|939317_939755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710997.1|939751_940669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981577.1|940665_940938_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060710999.1|940990_941734_-	CbtA family protein	NA	NA	NA	NA	NA
WP_060711000.1|941765_941975_-	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_060711070.1|942082_943378_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060711001.1|943515_944670_-	bifunctional 2-methylcitrate synthase/citrate synthase	NA	NA	NA	NA	NA
WP_060711002.1|944666_945425_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_168169457.1|945449_946328_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_060711003.1|946392_947685_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_060711004.1|947897_949322_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060711005.1|949327_951109_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	35.5	2.1e-51
949906:949925	attL	GGATCCCGGATCCGGGGTCG	NA	NA	NA	NA
WP_082375160.1|951427_953026_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_193394022.1|953034_954195_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060711008.1|954191_955286_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_060711009.1|955282_956167_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_060711010.1|956163_956949_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_082375161.1|956992_957658_-	CbtA family protein	NA	NA	NA	NA	NA
WP_060710806.1|957760_958912_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_060711012.1|959072_959294_-	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_060711013.1|959483_960230_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060711014.1|960226_961231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981257.1|961617_963507_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_064485370.1|963529_964555_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060711018.1|964551_965895_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_082375745.1|966018_966996_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082375163.1|966992_968081_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_060711020.1|968077_968881_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.1e-10
WP_060711021.1|968877_969603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711022.1|969948_970239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981258.1|970444_970924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711023.1|970930_972145_-|integrase	tyrosine-type recombinase/integrase	integrase	G9FH48	Rhodococcus_phage	35.4	9.0e-46
976985:977004	attR	GGATCCCGGATCCGGGGTCG	NA	NA	NA	NA
>prophage 5
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	1002562	1047774	6058802	bacteriocin,transposase	Shigella_phage(28.57%)	36	NA	NA
WP_060711044.1|1002562_1003471_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|1003467_1003758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060711045.1|1003853_1004828_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_060711046.1|1004962_1005964_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_060711047.1|1005981_1006554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714427.1|1006718_1007693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711048.1|1007753_1008293_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_064485374.1|1008345_1009512_-	geranylgeranyl reductase family protein	NA	NA	NA	NA	NA
WP_060711049.1|1009673_1011143_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_060711050.1|1011213_1012545_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082375747.1|1012702_1013110_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711051.1|1014679_1015453_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_060711052.1|1018397_1019270_+	4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_060711053.1|1020041_1020392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711054.1|1020388_1022221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711055.1|1022220_1024227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375749.1|1024250_1025546_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020627541.1|1025584_1025914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711056.1|1026019_1026832_-	YceI family protein	NA	NA	NA	NA	NA
WP_060711057.1|1026824_1027649_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_060711058.1|1027835_1028765_+	diiron oxygenase	NA	NA	NA	NA	NA
WP_060711059.1|1028778_1030278_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060711060.1|1030407_1031220_-	LmeA family phospholipid-binding protein	NA	NA	NA	NA	NA
WP_060711061.1|1031579_1032425_+	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	28.4	6.1e-17
WP_060711062.1|1032435_1033008_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_060711063.1|1033010_1033832_+|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_145981219.1|1034183_1035443_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|1035535_1036291_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_082375167.1|1036399_1036801_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060711066.1|1038381_1039677_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060714430.1|1039734_1040508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145981260.1|1041721_1042732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060711070.1|1044080_1045376_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060711071.1|1045549_1046548_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.9	1.8e-79
WP_060710840.1|1046578_1046869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060711072.1|1046865_1047774_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	3.7e-28
>prophage 6
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	1315211	1434679	6058802	tRNA,transposase,integrase	Mycobacterium_phage(33.33%)	112	1333746:1333764	1361771:1361789
WP_082375200.1|1315211_1316249_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_060714455.1|1316257_1317115_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_051050199.1|1317169_1318660_+	GTPase HflX	NA	NA	NA	NA	NA
WP_060711213.1|1318695_1319760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711214.1|1319789_1320548_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	31.0	4.4e-14
WP_145981269.1|1320789_1321014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711216.1|1321177_1321894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020623044.1|1322519_1323011_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_060711217.1|1323153_1326024_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	36.7	1.8e-169
WP_060711218.1|1326118_1326760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193394000.1|1326772_1327774_-	alpha/beta hydrolase	NA	A0A023W7H4	Mycobacterium_phage	31.9	2.5e-17
WP_082375204.1|1328906_1329902_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_060711220.1|1329912_1330383_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_145981270.1|1330387_1330585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711221.1|1330679_1331432_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_020623051.1|1331446_1331659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060711222.1|1331881_1332958_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060711223.1|1333183_1333675_+	DUF3145 domain-containing protein	NA	NA	NA	NA	NA
WP_060711224.1|1333719_1334265_+	hypothetical protein	NA	NA	NA	NA	NA
1333746:1333764	attL	CGGCGTCCTGCTGGTGGCG	NA	NA	NA	NA
WP_060711225.1|1334308_1335556_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_020623056.1|1335599_1335842_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_060711226.1|1335895_1336876_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_060711227.1|1336881_1337805_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_168169586.1|1337995_1339231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714458.1|1339336_1340083_+	pirin family protein	NA	NA	NA	NA	NA
WP_020624180.1|1340173_1340377_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	60.0	5.6e-17
WP_060711228.1|1340601_1343394_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_020624178.1|1343766_1344198_+	DUF3052 domain-containing protein	NA	NA	NA	NA	NA
WP_060711229.1|1344194_1344659_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_060711230.1|1344834_1346640_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	25.0	4.1e-18
WP_060711231.1|1346775_1347567_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060711232.1|1347571_1347988_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711233.1|1347991_1348516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375205.1|1348512_1349070_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711235.1|1349092_1349671_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_145981585.1|1349656_1350598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711237.1|1350999_1351260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060711238.1|1351259_1351493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981271.1|1351786_1352089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981272.1|1352085_1352472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375764.1|1352609_1353041_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981273.1|1353040_1353574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981586.1|1353612_1355514_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_145981274.1|1355510_1356362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711244.1|1356349_1357018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711245.1|1357014_1357881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711246.1|1358083_1362394_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
1361771:1361789	attR	CGCCACCAGCAGGACGCCG	NA	NA	NA	NA
WP_060711247.1|1362596_1363505_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|1363501_1363792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060711248.1|1363978_1365055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169463.1|1365074_1365284_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_060711250.1|1365285_1366212_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_060714459.1|1366204_1367227_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_060710764.1|1367387_1368812_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
WP_168169464.1|1368945_1370109_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_145981276.1|1370189_1371329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711070.1|1371328_1372624_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060711253.1|1372671_1373298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375207.1|1373202_1373943_-	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	35.2	1.6e-05
WP_145981277.1|1374014_1374500_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060714314.1|1374548_1375304_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|1375396_1376656_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_082375209.1|1376753_1376891_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_193394025.1|1376902_1377706_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_082375765.1|1377716_1378004_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060711254.1|1378318_1379953_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.3	3.3e-152
WP_193394019.1|1380362_1381166_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_193394026.1|1381359_1382163_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_193394027.1|1382356_1383160_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060710862.1|1383460_1384894_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060711255.1|1385051_1385762_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060711256.1|1385823_1387317_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	32.2	1.1e-37
WP_145981278.1|1388519_1388681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060711258.1|1389154_1391608_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_168169465.1|1391604_1391781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711259.1|1392067_1392268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711260.1|1393351_1395988_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I664	Streptococcus_phage	26.9	1.4e-06
WP_060711261.1|1396291_1396678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711262.1|1396678_1396975_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_145981279.1|1396971_1397151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711259.1|1398043_1398244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082375766.1|1399418_1399841_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_145981282.1|1400379_1401753_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_082375214.1|1402475_1403411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711268.1|1403952_1405131_-	cytochrome P450	NA	NA	NA	NA	NA
WP_060714463.1|1406275_1406839_-	DUF3887 domain-containing protein	NA	NA	NA	NA	NA
WP_060711269.1|1407119_1408682_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060711270.1|1408818_1409547_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981283.1|1411293_1412598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064485381.1|1413240_1413621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981576.1|1413941_1415132_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_060714464.1|1415348_1416317_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_060711272.1|1416330_1416744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711273.1|1416761_1417139_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169466.1|1417524_1418598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711275.1|1418626_1419118_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	42.3	1.6e-25
WP_060711276.1|1419265_1419733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082375215.1|1419743_1420142_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_082375216.1|1420140_1420683_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711278.1|1420835_1421411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711279.1|1421419_1422790_-	MFS transporter	NA	NA	NA	NA	NA
WP_060711280.1|1422876_1423626_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_060711281.1|1423650_1423998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020623321.1|1424256_1424439_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_060711282.1|1424465_1425191_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060714465.1|1425336_1425966_+	DUF3159 domain-containing protein	NA	NA	NA	NA	NA
WP_060711283.1|1427245_1427845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714467.1|1427871_1429734_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_060714468.1|1429795_1430254_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_145981285.1|1430342_1430738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711285.1|1432578_1433106_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_060710764.1|1433254_1434679_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
>prophage 7
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	1858853	1914877	6058802	transposase	Enterobacteria_phage(22.22%)	46	NA	NA
WP_082375268.1|1858853_1859846_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_145981219.1|1859921_1861181_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|1861273_1862029_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_168169479.1|1862123_1862285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981597.1|1862260_1862521_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_020624641.1|1862856_1863300_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_060711562.1|1863420_1863918_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711563.1|1864017_1864407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169480.1|1864698_1865415_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711565.1|1865471_1866770_-	MFS transporter	NA	NA	NA	NA	NA
WP_020624380.1|1866917_1867895_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_060711566.1|1867914_1868913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981598.1|1868909_1870247_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_060711567.1|1870267_1871767_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_060711568.1|1871763_1872606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711569.1|1872984_1874226_+	MFS transporter	NA	NA	NA	NA	NA
WP_060711570.1|1874398_1875196_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	2.4e-10
WP_168169481.1|1875192_1876272_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_168169589.1|1876268_1877237_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_082375273.1|1877278_1878376_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060711571.1|1878372_1879161_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_060714314.1|1879427_1880183_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|1880275_1881535_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_064485399.1|1882072_1882915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711573.1|1883011_1883830_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_082375786.1|1884985_1885306_+	M23 family metallopeptidase	NA	A0A1B0XUH3	Freshwater_phage	40.4	5.0e-12
WP_060711574.1|1886794_1888288_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_060711575.1|1888483_1889617_+	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_020623755.1|1889721_1890690_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.7	2.0e-43
WP_060711576.1|1890705_1891422_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_082375275.1|1891515_1892433_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_060711577.1|1892467_1893640_+	acetoin utilization protein AcuC	NA	A0A2K9L4C2	Tupanvirus	32.0	6.1e-23
WP_060711578.1|1893648_1896372_+	bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_060711579.1|1896624_1898274_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_060711580.1|1898385_1900761_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-44
WP_060711581.1|1901101_1901941_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_060714532.1|1901976_1902723_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_060711582.1|1902705_1903506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020624352.1|1903510_1903678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711583.1|1903860_1905018_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_060711584.1|1905250_1906105_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_082375787.1|1906390_1907911_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060711585.1|1908004_1909348_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_060714534.1|1910974_1912270_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060711586.1|1912632_1913889_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.2	3.6e-82
WP_060711587.1|1913953_1914877_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	1962621	1995204	6058802	transposase,integrase,protease	Mycobacterium_phage(25.0%)	33	1963931:1963950	2004500:2004519
WP_060711626.1|1962621_1963512_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_060714540.1|1963554_1965360_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
1963931:1963950	attL	ACCAGCGTCCCGGCCGGGAC	NA	NA	NA	NA
WP_168169482.1|1965761_1966832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981311.1|1966866_1967433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064485400.1|1967895_1968789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060711629.1|1968992_1969541_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168169483.1|1969631_1970294_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_060711631.1|1970341_1972021_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_060711633.1|1972484_1972952_+	DoxX family protein	NA	NA	NA	NA	NA
WP_060714542.1|1973112_1973976_+	aminotransferase class I and II	NA	NA	NA	NA	NA
WP_060711634.1|1973972_1974404_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_060711635.1|1974465_1974942_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_060711636.1|1975083_1976130_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_060711637.1|1976201_1976687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981600.1|1976689_1977985_-	cytochrome P450	NA	NA	NA	NA	NA
WP_060711639.1|1978147_1979023_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_193394006.1|1979079_1980423_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060711640.1|1980488_1980788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020624102.1|1980808_1981063_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_145981312.1|1981137_1981542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375281.1|1981541_1982222_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060714544.1|1982304_1983099_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060711643.1|1983290_1984037_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020624097.1|1984922_1985351_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_060711644.1|1985630_1986308_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_060711645.1|1986334_1987210_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_060711646.1|1987236_1987764_+	TIGR02611 family protein	NA	NA	NA	NA	NA
WP_082375790.1|1987987_1988452_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060711648.1|1988420_1989845_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.6e-89
WP_060711070.1|1990068_1991364_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_082375283.1|1991516_1992041_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	57.4	2.6e-42
WP_060714314.1|1993468_1994224_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_082375284.1|1994256_1995204_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
2004500:2004519	attR	GTCCCGGCCGGGACGCTGGT	NA	NA	NA	NA
>prophage 9
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	2034110	2068568	6058802	transposase,integrase	Burkholderia_virus(12.5%)	30	2026270:2026288	2080873:2080891
2026270:2026288	attL	GGACGTGCTGCGGCACCGC	NA	NA	NA	NA
WP_060711681.1|2034110_2035130_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_082375793.1|2035134_2035728_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_145981319.1|2036496_2037793_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	1.9e-49
WP_060710806.1|2037889_2039041_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_060710840.1|2039363_2039654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060710839.1|2039650_2040559_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.9e-28
WP_060711685.1|2041874_2042198_-	urease subunit beta	NA	NA	NA	NA	NA
WP_060711686.1|2042194_2042497_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_060711687.1|2042745_2044689_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	31.0	1.8e-24
WP_060711688.1|2044721_2045060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711689.1|2045191_2045635_+	YidC/Oxa1 family membrane protein insertase	NA	NA	NA	NA	NA
WP_060711690.1|2045562_2046999_-	PucR family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060711691.1|2047092_2048469_+	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_060714547.1|2048473_2049280_+	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_060711692.1|2049276_2052000_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	26.3	9.1e-38
WP_060711693.1|2052009_2052888_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_060711694.1|2053028_2054084_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_060714548.1|2054471_2055194_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981601.1|2055352_2056537_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060711696.1|2056549_2057461_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060714549.1|2057466_2058201_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	1.2e-16
WP_060711697.1|2058197_2059028_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_060711698.1|2059024_2059675_+	phosphonatase-like hydrolase	NA	NA	NA	NA	NA
WP_060711699.1|2059686_2059974_-	YrhK family protein	NA	A0A2H4IYD3	uncultured_Caudovirales_phage	41.9	3.4e-12
WP_060711700.1|2060029_2060503_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060711701.1|2060574_2062377_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.9e-38
WP_060711702.1|2062392_2063982_-	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_139318721.1|2064019_2064241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082375288.1|2064438_2065401_+	MEDS domain-containing protein	NA	NA	NA	NA	NA
WP_168169486.1|2067428_2068568_-|transposase	transposase	transposase	NA	NA	NA	NA
2080873:2080891	attR	GGACGTGCTGCGGCACCGC	NA	NA	NA	NA
>prophage 10
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	2826831	2851851	6058802	transposase	Gordonia_phage(25.0%)	20	NA	NA
WP_082375386.1|2826831_2827524_+	Ltp family lipoprotein	NA	A0A0K0MWU9	Gordonia_phage	62.5	3.0e-09
WP_060711070.1|2829233_2830529_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_145981349.1|2830639_2831937_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.5e-49
WP_060712184.1|2832057_2832288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060714667.1|2832414_2832741_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.2	9.0e-17
WP_060712185.1|2832737_2833220_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	46.4	1.4e-26
WP_060714314.1|2833260_2834016_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060712186.1|2835766_2837017_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_060712187.1|2837107_2837557_-	NfeD family protein	NA	NA	NA	NA	NA
WP_060714668.1|2837670_2838510_-	DUF3097 domain-containing protein	NA	NA	NA	NA	NA
WP_060712188.1|2838655_2839450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060712189.1|2839473_2840373_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060712190.1|2840444_2841644_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712191.1|2841682_2842216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981621.1|2843699_2844890_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082375831.1|2845523_2846459_-	response regulator receiver protein	NA	NA	NA	NA	NA
WP_145981350.1|2846954_2847146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060712196.1|2847495_2848218_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060712197.1|2848214_2849378_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	38.9	4.1e-19
WP_060710764.1|2850426_2851851_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
>prophage 11
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	2983879	3006095	6058802	transposase,protease	Staphylococcus_phage(50.0%)	14	NA	NA
WP_060712284.1|2983879_2984611_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060712285.1|2986351_2988244_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_168169593.1|2988365_2988908_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060712287.1|2989083_2991012_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_060712288.1|2991085_2991583_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060712289.1|2991669_2992641_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	25.4	1.2e-11
WP_060712290.1|2992809_2993721_+	TIGR03619 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_064485425.1|2993796_2994810_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082375395.1|2994846_2995833_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060712291.1|2995880_2998613_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060710862.1|3000354_3001788_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060714681.1|3002099_3003395_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.4	2.1e-32
WP_060712295.1|3003651_3004779_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.7e-35
WP_060711586.1|3004838_3006095_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.2	3.6e-82
>prophage 12
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	3762358	3783009	6058802	tRNA,transposase,protease	Catovirus(16.67%)	12	NA	NA
WP_060712782.1|3762358_3764995_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.1	5.2e-147
WP_060712783.1|3766440_3766896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193393975.1|3767013_3767682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711311.1|3767809_3769219_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.3	2.4e-119
WP_060712784.1|3770015_3771290_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.8e-36
WP_060710840.1|3772826_3773117_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060710839.1|3773113_3774022_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.9e-28
WP_060712785.1|3775159_3775582_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020625699.1|3779221_3779368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060712786.1|3779364_3780750_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_020625701.1|3780885_3782175_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	6.1e-141
WP_051050275.1|3782346_3783009_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	42.3	5.5e-37
>prophage 13
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	3823142	3883249	6058802	tRNA,transposase	Planktothrix_phage(20.0%)	53	NA	NA
WP_060712813.1|3823142_3823604_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_168169536.1|3823596_3823848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169537.1|3823817_3824456_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981641.1|3825716_3826523_-	YceI family protein	NA	NA	NA	NA	NA
WP_082375487.1|3826767_3829347_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	58.2	1.2e-108
WP_043277545.1|3829426_3831115_-	ribonuclease J	NA	NA	NA	NA	NA
WP_060712820.1|3831254_3832286_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_060712821.1|3832324_3832951_-	TIGR03085 family protein	NA	NA	NA	NA	NA
WP_060714783.1|3833151_3834429_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_060712822.1|3834617_3835358_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_020627863.1|3835397_3836162_-	FAD-dependent thymidylate synthase	NA	A0A166Y9A6	Gordonia_phage	55.3	1.3e-50
WP_060712823.1|3836313_3836907_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_060712824.1|3836903_3838040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714784.1|3838141_3838549_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060714785.1|3838553_3839801_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060712825.1|3839864_3840758_-	3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_060712826.1|3840911_3841442_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020627870.1|3841446_3842190_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_020627871.1|3842210_3842690_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_060712827.1|3842922_3843906_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060712828.1|3843907_3844864_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060712829.1|3844860_3846933_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	5.0e-20
WP_145981406.1|3846974_3847277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193394042.1|3847417_3848221_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060711070.1|3848336_3849632_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060714314.1|3849714_3850470_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|3850562_3851822_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060710806.1|3852439_3853591_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_060712831.1|3853750_3854425_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_064485636.1|3854716_3857917_+	arabinosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060712833.1|3858182_3858671_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_082375490.1|3858725_3859529_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060712835.1|3859576_3860497_+	TIGR03564 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_020622181.1|3860682_3860886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714787.1|3861017_3862643_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.7e-18
WP_060712836.1|3862639_3863542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060712837.1|3863538_3864489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060714788.1|3864485_3866087_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060712838.1|3866113_3867490_-	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_060712839.1|3867486_3868740_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712840.1|3869637_3870732_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060712841.1|3870760_3871561_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	1.7e-24
WP_060712842.1|3871550_3872447_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082375491.1|3873188_3874034_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060712843.1|3874006_3874750_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	6.6e-23
WP_060712844.1|3874746_3875862_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712845.1|3875858_3876944_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_060714790.1|3877012_3877423_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060712846.1|3877419_3878403_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060712847.1|3878478_3879648_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712848.1|3880155_3881391_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060710840.1|3882053_3882344_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060712849.1|3882340_3883249_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	8.3e-28
>prophage 14
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	3931889	4002446	6058802	transposase	Shigella_phage(22.22%)	46	NA	NA
WP_060711070.1|3931889_3933185_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060712885.1|3933441_3934566_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_060714800.1|3934629_3935856_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_060712886.1|3935978_3937586_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712887.1|3937589_3938363_-	cyclase family protein	NA	NA	NA	NA	NA
WP_060712888.1|3938485_3939460_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_060712889.1|3939611_3940403_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060714801.1|3940408_3941932_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060712890.1|3942096_3942936_+	PaaX family transcriptional regulator	NA	NA	NA	NA	NA
WP_060712891.1|3943236_3943650_-	RidA family protein	NA	NA	NA	NA	NA
WP_064485640.1|3943651_3945331_-	indolepyruvate oxidoreductase subunit beta family protein	NA	NA	NA	NA	NA
WP_060712892.1|3945342_3947511_-	indolepyruvate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_060712893.1|3947643_3947940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060712894.1|3947988_3949317_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_060714804.1|3950385_3950841_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_082375496.1|3950837_3951728_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_145981644.1|3951745_3954022_+	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_060712896.1|3954094_3954943_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_060712897.1|3954939_3956178_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_193394043.1|3956363_3956879_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_060714805.1|3956885_3958985_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_060712899.1|3959136_3962595_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_060712900.1|3962748_3963192_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064485454.1|3963231_3964455_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_060712901.1|3964465_3964981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060712902.1|3965314_3965551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060712903.1|3965600_3965834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981646.1|3968074_3969280_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_145981219.1|3970714_3971974_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060712907.1|3974437_3975106_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_082375498.1|3975472_3976372_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	4.8e-28
WP_060711044.1|3977456_3978365_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|3978361_3978652_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060710840.1|3979090_3979381_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060712910.1|3979571_3979835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071331843.1|3981132_3981396_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	47.0	7.7e-11
WP_060710862.1|3981667_3983101_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060712913.1|3983738_3985409_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.1	2.8e-21
WP_145981349.1|3985873_3987170_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.5e-49
WP_060712915.1|3988200_3988602_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_168169539.1|3995297_3995738_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060712917.1|3995741_3996545_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_060712918.1|3996893_3997838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710806.1|3998193_3999345_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_145981415.1|3999411_4000257_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	58.8	4.6e-89
WP_060712920.1|4001189_4002446_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.0	1.4e-81
>prophage 15
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	4229321	4281456	6058802	tRNA,transposase	uncultured_virus(25.0%)	42	NA	NA
WP_145981255.1|4229321_4230218_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.2	8.5e-17
WP_060713067.1|4230231_4231137_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060713068.1|4231174_4232329_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_060713069.1|4232368_4234387_-	protein meaA	NA	NA	NA	NA	NA
WP_060713070.1|4234605_4234938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713071.1|4234942_4235794_-	DUF1206 domain-containing protein	NA	NA	NA	NA	NA
WP_020621462.1|4235891_4237160_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_060713072.1|4237284_4237878_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_060713073.1|4237939_4238389_-	DUF2550 domain-containing protein	NA	NA	NA	NA	NA
WP_060713074.1|4238409_4238781_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_060713075.1|4238799_4240233_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_060713076.1|4240232_4241225_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_060713077.1|4241237_4242875_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_060713078.1|4242949_4243780_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060713079.1|4243779_4244328_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_020621511.1|4244391_4244637_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_020621510.1|4244761_4245535_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_145981426.1|4245895_4246372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713081.1|4248588_4249872_-	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	43.9	2.9e-87
WP_193393979.1|4249948_4250611_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_082375875.1|4250670_4251642_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_060713083.1|4251641_4252718_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	5.3e-05
WP_020623493.1|4252806_4253028_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_060714832.1|4253160_4255482_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_060713084.1|4255884_4256787_-	homoserine kinase	NA	NA	NA	NA	NA
WP_060714833.1|4256786_4257872_-	threonine synthase	NA	NA	NA	NA	NA
WP_060713085.1|4257967_4259347_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_060713086.1|4259446_4260895_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_060713087.1|4260896_4262546_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060713088.1|4262620_4264723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713089.1|4264778_4265594_+	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_060713090.1|4265590_4266265_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_060713091.1|4266723_4267140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060711070.1|4268724_4270020_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060710806.1|4270401_4271553_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_082375517.1|4271609_4272545_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	48.8	3.2e-67
WP_060714314.1|4272568_4273324_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_193394025.1|4274865_4275669_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145981428.1|4276310_4277654_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_064485652.1|4278178_4279261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981429.1|4279263_4280073_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_060711070.1|4280160_4281456_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
>prophage 16
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	4522540	4547409	6058802	transposase,integrase	Enterobacteria_phage(25.0%)	25	4516338:4516353	4533306:4533321
4516338:4516353	attL	CGAGGCGCTGCTCGCC	NA	NA	NA	NA
WP_145981219.1|4522540_4523800_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|4523892_4524648_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060713267.1|4524822_4526118_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060710840.1|4526187_4526478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060711044.1|4526474_4527383_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060713268.1|4527414_4527603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145981440.1|4527602_4528976_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060713270.1|4529212_4530031_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_060713271.1|4530206_4530923_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_193393981.1|4530919_4531879_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_060713272.1|4531959_4533603_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
4533306:4533321	attR	CGAGGCGCTGCTCGCC	NA	NA	NA	NA
WP_060713273.1|4533615_4533837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713274.1|4533856_4534450_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981652.1|4534446_4534941_-	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_060713276.1|4534975_4535575_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_060713277.1|4535746_4537042_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.0	2.4e-129
WP_043279643.1|4537195_4537606_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060713278.1|4537739_4538564_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_060713279.1|4538608_4539757_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_060713280.1|4539753_4540989_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_060713281.1|4541014_4541758_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_060713282.1|4541794_4542721_-	MazG family protein	NA	NA	NA	NA	NA
WP_158071447.1|4542720_4543644_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_060713285.1|4545628_4546606_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_145981407.1|4546611_4547409_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	4597027	4689002	6058802	tRNA,transposase	uncultured_virus(15.79%)	76	NA	NA
WP_060713319.1|4597027_4598818_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9L3E6	Tupanvirus	31.2	1.6e-70
WP_060713320.1|4598930_4599503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713321.1|4599506_4601336_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_060713322.1|4601332_4602748_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	37.0	3.8e-72
WP_020627555.1|4602842_4603325_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_060713323.1|4603340_4604516_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_082375556.1|4604560_4605538_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_060713325.1|4605461_4607057_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_060713326.1|4607121_4607688_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_060713327.1|4607747_4608716_+	CopD family protein	NA	NA	NA	NA	NA
WP_060713328.1|4608720_4608924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713329.1|4609526_4610936_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	52.1	8.4e-120
WP_060711311.1|4611230_4612640_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.3	2.4e-119
WP_145981407.1|4613633_4614431_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060711070.1|4615168_4616464_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_145981444.1|4617036_4618263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981654.1|4618465_4619059_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082375558.1|4619136_4620357_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_060713336.1|4620359_4621262_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	2.7e-47
WP_060714883.1|4621373_4621946_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_082375559.1|4622053_4622398_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713338.1|4622498_4623149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713339.1|4625003_4625474_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713340.1|4625496_4626801_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_060713341.1|4626800_4628069_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_168169545.1|4628087_4628255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713342.1|4628422_4628842_+	antitoxin	NA	NA	NA	NA	NA
WP_020623795.1|4628911_4629409_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_060713343.1|4629626_4631414_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.8	7.4e-12
WP_060713344.1|4631472_4632930_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	1.3e-17
WP_060713345.1|4632926_4633622_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	3.7e-36
WP_060714884.1|4633698_4634556_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060713346.1|4634629_4635316_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_060713347.1|4635348_4636155_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_060713348.1|4636322_4637417_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060713349.1|4637442_4638000_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_193394048.1|4638117_4638798_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_060713351.1|4638847_4641187_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_060714885.1|4641191_4641827_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_060713352.1|4641953_4642934_+	dehydrogenase	NA	NA	NA	NA	NA
WP_060714886.1|4642927_4643608_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	37.9	5.6e-29
WP_082375881.1|4643590_4644334_+	creatininase family protein	NA	NA	NA	NA	NA
WP_060714887.1|4645236_4646061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713353.1|4646099_4647125_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_060713354.1|4647155_4647554_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_064485474.1|4647957_4649217_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_060713356.1|4649325_4649895_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060714888.1|4649923_4651237_-	MFS transporter	NA	NA	NA	NA	NA
WP_060713357.1|4651364_4652162_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_060713358.1|4652568_4653036_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060713359.1|4653397_4655149_-	recombinase family protein	NA	NA	NA	NA	NA
WP_060713360.1|4655646_4656240_-	recombinase family protein	NA	NA	NA	NA	NA
WP_082375882.1|4656312_4657608_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060713357.1|4659363_4660161_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_082375562.1|4661066_4662416_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_082375563.1|4662412_4662982_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_082375564.1|4663038_4664976_+	hypothetical protein	NA	Q58MH7	Prochlorococcus_phage	37.4	1.3e-33
WP_168169546.1|4665458_4666190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375565.1|4666183_4667203_+	NAD-dependent epimerase/dehydratase family protein	NA	G9E529	Ostreococcus_lucimarinus_virus	26.8	3.4e-14
WP_060714889.1|4667211_4668237_+	radical SAM protein	NA	NA	NA	NA	NA
WP_082375566.1|4668243_4669230_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.3	6.2e-37
WP_168169547.1|4669348_4670734_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_082375568.1|4670730_4671570_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_168169548.1|4671599_4672508_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	3.6e-15
WP_168169549.1|4672576_4673248_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060711070.1|4674459_4675755_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_145981407.1|4675940_4676738_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_064485667.1|4677279_4677771_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	29.6	1.4e-10
WP_082375570.1|4677767_4678385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_145981219.1|4681100_4682360_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|4682452_4683208_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060710862.1|4684377_4685811_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_082375571.1|4686764_4687085_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060711044.1|4687065_4687974_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|4687970_4688261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060713369.1|4688279_4689002_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	5206722	5263721	6058802	protease,transposase,integrase	Shigella_phage(11.11%)	58	5194439:5194456	5250728:5250745
5194439:5194456	attL	CCGGGCGGGTCGGCCGGC	NA	NA	NA	NA
WP_060711044.1|5206722_5207631_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|5207627_5207918_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168169573.1|5207877_5208147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981491.1|5208143_5208446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713739.1|5208739_5208970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713740.1|5208969_5209305_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060713741.1|5209467_5209803_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060713742.1|5209947_5211336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713743.1|5211348_5212266_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_060713744.1|5212311_5213637_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	26.0	4.6e-11
WP_060713745.1|5214083_5216090_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_060713746.1|5216149_5217193_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060714948.1|5217295_5217901_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713747.1|5217872_5218574_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_060713748.1|5218634_5219687_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.0	4.1e-10
WP_060713749.1|5219697_5220432_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_145981492.1|5220916_5222548_+	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_060713751.1|5224719_5225253_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082375914.1|5225249_5225705_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_060714949.1|5225721_5227239_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	W5S5G3	Pithovirus	26.5	1.5e-10
WP_060713753.1|5227267_5228533_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_060713754.1|5228529_5228943_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_168169574.1|5228982_5229234_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_082375629.1|5229273_5230419_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_060713756.1|5230402_5230756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713757.1|5230777_5231185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713758.1|5231205_5231607_+	VOC family protein	NA	NA	NA	NA	NA
WP_193393986.1|5231638_5232139_-	DinB family protein	NA	NA	NA	NA	NA
WP_060713759.1|5232205_5232625_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_060713760.1|5232678_5233101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064485498.1|5233325_5233928_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082375630.1|5234032_5234734_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_145981493.1|5235738_5236302_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713762.1|5236391_5238056_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060713763.1|5238052_5239792_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.1	1.8e-18
WP_060714951.1|5239788_5240109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713764.1|5240142_5240601_-	cyanase	NA	NA	NA	NA	NA
WP_060713765.1|5240604_5241765_-	NAD-dependent formate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	25.5	1.4e-11
WP_060713766.1|5241905_5242853_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713767.1|5242831_5244616_-	cytochrome c biogenesis protein DipZ	NA	NA	NA	NA	NA
WP_060713768.1|5244778_5245468_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_060714314.1|5246919_5247675_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|5247767_5249027_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145981494.1|5249106_5250364_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.4e-49
WP_060713770.1|5250510_5251605_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
5250728:5250745	attR	CCGGGCGGGTCGGCCGGC	NA	NA	NA	NA
WP_060713771.1|5251580_5252045_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_082375631.1|5252214_5252937_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_060713772.1|5253018_5254524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713773.1|5254551_5255157_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060713774.1|5255256_5255787_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060713775.1|5255819_5257028_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_145981495.1|5257338_5258205_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_082375632.1|5258201_5258966_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_145981496.1|5259027_5259588_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060713778.1|5259687_5260134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981497.1|5260314_5261529_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060714954.1|5262004_5262550_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.1	7.7e-21
WP_060714955.1|5262881_5263721_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 19
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	5396019	5497979	6058802	tRNA,transposase,integrase	Mycobacterium_phage(23.08%)	92	5395941:5395994	5495801:5498051
5395941:5395994	attL	GCCTTGAAAGCGGGCGTCCGAAAGGACCGGGGGTTCGAATCCCCCCGCTTCCGC	NA	NA	NA	NA
WP_060713873.1|5396019_5397231_-|integrase	site-specific integrase	integrase	G8I4Q2	Mycobacterium_phage	28.2	7.7e-29
5395941:5395994	attL	GCCTTGAAAGCGGGCGTCCGAAAGGACCGGGGGTTCGAATCCCCCCGCTTCCGC	NA	NA	NA	NA
WP_060713874.1|5397230_5397419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060713875.1|5397433_5398972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713876.1|5398971_5399313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714967.1|5399309_5400194_-	AAA family ATPase	NA	A0A0K2D0J0	Bacillus_phage	30.0	1.3e-12
WP_082375644.1|5400273_5401095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713878.1|5401197_5401521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713879.1|5401707_5402595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713880.1|5402591_5403371_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_060710764.1|5403549_5404974_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
WP_060713881.1|5405646_5406075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713882.1|5406110_5406959_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060713883.1|5408182_5409034_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
5407093:5407146	attR	GCCTTGAAAGCGGGCGTCCGAAAGGACCGGGGGTTCGAATCCCCCCGCTTCCGC	NA	NA	NA	NA
WP_060714534.1|5409155_5410451_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
5407093:5407146	attR	GCCTTGAAAGCGGGCGTCCGAAAGGACCGGGGGTTCGAATCCCCCCGCTTCCGC	NA	NA	NA	NA
WP_145981504.1|5411007_5413293_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_060713885.1|5413282_5413789_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_060713886.1|5413781_5414933_-	DNA polymerase III subunit delta'	NA	D9ZNI9	Clostridium_phage	26.4	8.7e-06
WP_082375645.1|5414929_5416258_-	MFS transporter	NA	NA	NA	NA	NA
WP_145981505.1|5416334_5416961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714969.1|5417056_5419369_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_082375646.1|5419603_5419966_+	WhiB family transcriptional regulator	NA	A0A2L0HJX8	Mycobacterium_phage	50.0	6.3e-11
WP_060713889.1|5419984_5420662_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_060713890.1|5420664_5421129_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145981668.1|5421212_5421464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020626605.1|5421466_5422630_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_060714972.1|5422626_5423679_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_020626603.1|5423844_5424015_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_020626602.1|5424011_5424470_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	36.1	3.1e-15
WP_060713891.1|5424482_5425046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713892.1|5425069_5427919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714973.1|5428143_5429037_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_060713893.1|5429167_5429635_+	VOC family protein	NA	NA	NA	NA	NA
WP_060713894.1|5429789_5430596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713895.1|5430592_5431381_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060713896.1|5431487_5432240_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060713897.1|5432240_5432909_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_193394052.1|5432914_5433658_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.5e-27
WP_060710840.1|5433855_5434146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060712849.1|5434142_5435051_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	8.3e-28
WP_082375916.1|5435180_5436476_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_145981506.1|5436503_5436833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714314.1|5437289_5438045_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|5438137_5439397_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060710862.1|5439751_5441185_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060714430.1|5441620_5442394_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060713900.1|5442558_5442783_+	hypothetical protein	NA	E3SK81	Synechococcus_phage	57.9	1.0e-08
WP_060713901.1|5442802_5443282_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060713902.1|5443344_5444037_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_060713903.1|5444108_5444519_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_060713904.1|5444515_5444800_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060713905.1|5444974_5445274_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_060710764.1|5445395_5446820_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
WP_060710654.1|5447163_5448420_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.5	3.3e-83
WP_145981646.1|5448793_5449999_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_060712903.1|5452239_5452473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713906.1|5452522_5452759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981507.1|5453535_5454144_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_060713909.1|5454172_5454937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060713910.1|5454984_5457843_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.5	2.6e-216
WP_145981508.1|5457861_5458536_+	SdpI family protein	NA	NA	NA	NA	NA
WP_082375649.1|5458699_5459368_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_193393988.1|5459437_5460949_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	35.1	1.7e-57
WP_020621934.1|5461238_5461658_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060713914.1|5461654_5463949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713915.1|5464215_5466015_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_082375917.1|5466143_5466605_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145981509.1|5466601_5467249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713918.1|5467441_5468455_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.2	4.7e-72
WP_020622767.1|5468505_5468832_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	57.7	1.8e-25
WP_060713919.1|5469034_5470195_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A0RR05	Acinetobacter_phage	48.1	1.1e-05
WP_060713920.1|5470270_5470966_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060714975.1|5471318_5472599_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_060713921.1|5472688_5473639_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060713923.1|5475980_5476952_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_174525577.1|5476953_5477772_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	39.3	4.7e-22
WP_060713925.1|5477917_5478592_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_145981670.1|5478588_5479080_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_060713927.1|5479248_5480376_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_020622602.1|5480416_5480782_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_060713928.1|5480823_5481210_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_020622600.1|5481237_5481375_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_060713929.1|5481855_5483613_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_060713930.1|5484653_5485808_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	41.3	2.5e-61
WP_060713931.1|5485951_5486896_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	39.6	3.0e-57
WP_060713932.1|5486932_5488120_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_043283048.1|5488360_5488894_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_060713933.1|5489313_5491380_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	6.1e-135
WP_082375650.1|5491429_5493940_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	6.4e-86
WP_145981671.1|5494273_5494753_+	DUF3566 domain-containing protein	NA	NA	NA	NA	NA
WP_082375651.1|5495201_5495777_-|integrase	site-specific integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	38.3	2.4e-17
WP_060714314.1|5495871_5496627_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|5496719_5497979_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
5495801:5498051	attR	TGTCAACGGCGGGTTGGGAGTGACCCCGTAGCGACGGATTGGAACTGACCCCCGGCGTGGTGTGGTGATGGTCAGTCGTTGCTGGCGCGGTTGTGTTTGGCCAGGAGCTCGCGTCGGGCGCGGGTGCGGTAGGAGTCCCCGGACAGGGTCAGGACTTCGGCGTGGTGGACGAGGCGGTCGATCATGGCTGCGGCGACGACGTCGTCGGAGAAGGTCTCGCCCCAGCGGCCGAAGGGCAGATTGCTGGTGACCATGACGCTGCCTTGTTCATAGCGGGAAGCGATGAGCTGGAAGAACAGGTTCGCTGCGTCCTGGTCGAACGGGATGTAGCCGACCTCGTCGATGATGATCAGTTTGTAGCGGCGGATCTTCTTCAGCTCGGCCTCGAGCCGGCCGCTCTGGTGCGCGGCGGCGAGTCTGGTGATCCAGTTGCTGGCGGTGTCGAACAGGACCGAGTAGCCGGCGTGGGCGGCTTTGACGCCGAGCCCGATCGCGAGGTGGGTCTTCCCGATCCCGGGCGGGCCGAGCAGGATCACGTTCTCGCACTTGGCGACGAACGTGCTCGTGGCCAGGTGGGCCAGGATGTCGCGGCGCAGCGAGGGCAGATGGTCGAGGTTGAAGTCCTCCAAGGTCTTGACCTGGGGGAAGTGCGCGGTGCGGATCCGCATGACCGTGCCCTTGGACTCGCGGTCGGCGACCTGGCGCTGCAGCAGCGCGCCCAGATACTCCTCGTGCGACCAGTTCTCCTCACGGGCCTGGGCGGCAAGCTGTTCCCAGCTGGCCGCGATGGTCGGGGTCTTCAGGACCCGGGTCAGGTAGGCGATCATCGCCGGCAGTCCGTCGGGGACCGCGGCCAGCACCGGACCGGCCGGCCCCGAGCTCCCAGCGGGGTCGGTGGTGATCTTCGGTGGTGTGGTTGTCATGAGCTGCTCGCTTCCTCGGCAGTGGAGACGAAGTCGACACCGAACAGGGCGTCGTAGTCGGGCAGTGCGCGCAGGGTCACCGGGTGGCCGTCGAGGTGACGGCGTGCTGCGGCCTGTCGGGTGTTGCGGTCGTGGGCCAGGGCGCGGCGCATCGCCGCGGCGGTGTGCTGGTGCGCCGGGTCGGTGATCACCGCGTGGCGGGCCCAGCTGCGGTCGTGACGGGCGACGACCTGGCCGGCGCAGTAGACGACGACCTCGCGCGGTGAGGCGGCGACATCGACGAACCGGCCGATCATCTGCGGATCCACGGAGTAGTCGTTGGCATCGACGCGGACGTAGTAGTCCCGTGCCAGCCGGATCCGCTGGGCCAGCCCGATCGGCGGGTCCAGCGGCGGCAGCGGAGTCATCGCCGCGTAGTCGTGGGCGAGCACGTCCACCGGGCGGCCGCCGATCGCTCGGACGGTGCGGGTGTTGGCCCGGGCCAGCCAGTCGTCGATCTGGTGGTTGAAGTCGGCTGGGGAGGCGAAGCGACGTCCGGGCAGGAACGAGGTCTCGAAGTAGCCGTTGTTGCGTTCGACCAGCCCCTTGAACTCCGGATCCCGCGGTGGGGCAAGCCGGATCCGGGTGGCCAGAGTGCCGGCGAACGCAGCGGCCGGTGCCGAGACCCGCCCGGTCCCGCCGATCGCAGACTCCCGGTCCCAGACCAGCGTGCGGGTCACCCGCCCGACGTCGCTGATCAGCTGCCACATCCCGGACAGGATGTCCCCGGCCTGGCGCGAGGGGATCATCGTCGCGGACAAGAACCGCGAGTAGCCCAGCGTCATCACCAGCACCGGTAGGACCCGTTCCTGGCCTGGGCCGACGGGGATCGTGGTCTCGGGGAACCACAGGTCGCACTGGGTGATCTCGCCCGGTGCGTAGGCGACCCGGTCGACCGGGTCGATCCCGACATACTCGGGGCGGATCTGGCGGATCCGGTCCTTGAGCACGGTCAGCGAGTGCTCCCACCCGATCCGCTCTGCGATCACCGTGGCCGGCATGCGTGGGAACTGCGCCAGCAATGCCCGCACCTGCGGCTCGACCGCATCCGCCAGCGATCCCCGCGGGCCCCGTTCCCGCTTCGGCGGGCCCGGCGCCCGCAACGCGGAGCGCACCGTGTTGCGGGCCACCCCCAGCCGGCGGGCGATCTCCTTGATCGGGACACCCTCGGCCCGATGCAGACGACGGATCTCGGCCCAGTCCTCCACCGACAACACCCCCTCAGCGTCGTGCAGAGGGGGTCAATCCCAAGCCGACGCTAGGGGGTCAGTCTGAGCCCGTCGTCGACA	NA	NA	NA	NA
>prophage 20
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	5663925	5771096	6058802	tRNA,transposase,integrase	Tupanvirus(22.22%)	76	5743282:5743299	5776261:5776278
WP_082375669.1|5663925_5665317_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.5	9.1e-42
WP_060714064.1|5665331_5666306_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_060714065.1|5666339_5667197_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_060714066.1|5667193_5668033_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.5	1.8e-13
WP_082375670.1|5668034_5669063_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060714068.1|5669211_5670315_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060714069.1|5670308_5671151_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_060714070.1|5671591_5672674_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_060714071.1|5672684_5673449_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_060714072.1|5673445_5674864_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_060714073.1|5674897_5676370_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_145981521.1|5676635_5676977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714074.1|5677475_5678183_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168169577.1|5679707_5680883_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060714075.1|5681803_5682592_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_060714998.1|5683454_5684165_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_060714076.1|5684225_5684840_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_060714077.1|5685007_5685874_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_145981523.1|5685870_5686803_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_060714079.1|5686851_5687637_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060714999.1|5687761_5688985_+	cytochrome P450	NA	NA	NA	NA	NA
WP_082375671.1|5688981_5690442_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_082375925.1|5690619_5691228_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082375926.1|5691407_5692961_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.3	5.4e-19
WP_060714082.1|5692951_5693584_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_060714083.1|5693648_5694281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714084.1|5694308_5695040_+	hypothetical protein	NA	A0A2I7RQW7	Vibrio_phage	37.1	3.6e-21
WP_145981621.1|5695083_5696274_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_060711070.1|5696406_5697702_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060710862.1|5698060_5699494_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060714085.1|5700060_5701419_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_064485699.1|5701669_5703349_-	MFS transporter	NA	NA	NA	NA	NA
WP_060714087.1|5703510_5704026_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082375672.1|5704071_5704347_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060714089.1|5704617_5705982_+	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	24.3	4.5e-09
WP_060714090.1|5706249_5707572_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_193393990.1|5707647_5708031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711044.1|5708371_5709280_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060714092.1|5709276_5709510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145981219.1|5709589_5710849_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|5710941_5711697_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060713267.1|5711871_5713167_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060714094.1|5713234_5714482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168169578.1|5714644_5719960_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	21.9	1.1e-71
WP_082375676.1|5720127_5721573_-	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	41.4	7.9e-65
WP_060710806.1|5721760_5722912_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_060714096.1|5723392_5739673_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.1	1.7e-123
WP_060714097.1|5739756_5740920_-	cytochrome P450	NA	NA	NA	NA	NA
WP_060714098.1|5740964_5742215_-	cytochrome P450	NA	NA	NA	NA	NA
WP_060714099.1|5742531_5743356_+	amidinotransferase	NA	NA	NA	NA	NA
5743282:5743299	attL	GTCGGCGTCGAGCTCGCC	NA	NA	NA	NA
WP_082375677.1|5743387_5745652_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.2	9.0e-47
WP_060711898.1|5745726_5746956_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_060715002.1|5747177_5748443_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_082375678.1|5748487_5749240_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060714102.1|5749311_5750268_-	chlorinating enzyme	NA	NA	NA	NA	NA
WP_060714103.1|5750301_5750550_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_145981524.1|5750812_5751031_+	MbtH family protein	NA	NA	NA	NA	NA
WP_193393991.1|5751086_5751755_-	LmbU family transcriptional regulator	NA	NA	NA	NA	NA
WP_060714104.1|5752883_5753546_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_082375679.1|5753559_5754357_+	thioesterase	NA	NA	NA	NA	NA
WP_168169579.1|5754602_5758127_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145981349.1|5758347_5759645_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.5e-49
WP_060711070.1|5759735_5761031_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_060714107.1|5761282_5761711_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_145981525.1|5761707_5762514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981526.1|5762510_5763395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714110.1|5763468_5763870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082375681.1|5764193_5764382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714111.1|5764386_5764725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010223771.1|5764724_5764913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060713651.1|5765384_5766254_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.3	5.2e-11
WP_060714112.1|5767369_5767585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714113.1|5767569_5768247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714114.1|5768348_5769704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714115.1|5769696_5769924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060714116.1|5769923_5771096_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	38.9	3.9e-54
5776261:5776278	attR	GTCGGCGTCGAGCTCGCC	NA	NA	NA	NA
>prophage 21
NZ_CP011868	Pseudonocardia sp. HH130629-09 chromosome, complete genome	6058802	5814444	5846865	6058802	transposase,protease	Cedratvirus(25.0%)	31	NA	NA
WP_145981532.1|5814444_5815650_+|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_060714145.1|5815721_5816927_+	MFS transporter	NA	NA	NA	NA	NA
WP_060714146.1|5816908_5817733_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060714147.1|5817825_5818677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060714148.1|5818666_5819941_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.8	5.4e-65
WP_060715012.1|5820160_5820727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060714149.1|5820727_5822119_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_060714150.1|5822579_5823107_-	DUF3558 family protein	NA	NA	NA	NA	NA
WP_060714151.1|5823181_5823859_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_064485708.1|5823979_5825035_-	FUSC family protein	NA	NA	NA	NA	NA
WP_060714153.1|5825127_5825541_-	DUF3151 domain-containing protein	NA	NA	NA	NA	NA
WP_060714154.1|5825612_5826641_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_064485709.1|5826865_5827555_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_060714155.1|5827551_5827896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981535.1|5827965_5828970_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_060714156.1|5829017_5829665_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_020625733.1|5829661_5830222_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020625732.1|5830218_5830992_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060714157.1|5831252_5832746_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060714158.1|5832742_5833753_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_060711247.1|5834039_5834948_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	2.9e-28
WP_060710840.1|5834944_5835235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060713267.1|5835304_5836600_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_082375688.1|5836722_5837700_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_145981536.1|5837976_5838330_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060714159.1|5838477_5839137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714160.1|5839492_5840329_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_145981219.1|5841211_5842471_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060714314.1|5842563_5843319_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_060710862.1|5844420_5845854_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_060714162.1|5846292_5846865_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	0	1859	242173		Bandra_megavirus(100.0%)	1	NA	NA
WP_060715039.1|1112_1859_+	J domain-containing protein	NA	A0A2K9V7V1	Bandra_megavirus	43.1	1.4e-09
>prophage 2
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	6553	7504	242173		Lactococcus_phage(100.0%)	1	NA	NA
WP_060715187.1|6553_7504_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.8	2.5e-06
>prophage 3
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	15628	16600	242173		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_060715051.1|15628_16600_-	hypothetical protein	NA	A0A291AUV6	Sinorhizobium_phage	34.0	1.2e-32
>prophage 4
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	20262	128692	242173	integrase,transposase	Mycobacterium_phage(42.86%)	97	25976:26035	103471:104840
WP_060715053.1|20262_21030_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145981682.1|22407_23052_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_082375941.1|25405_26080_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
25976:26035	attL	TGAAGCGCCCCGGGTCTGGTGGAGGCACTGAAGCCACGGGAAGGTGGTCTTCGTGCCGGC	NA	NA	NA	NA
WP_145981710.1|26057_27324_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	47.7	5.5e-70
WP_060710764.1|27520_28945_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.2e-89
WP_145981683.1|29282_33713_-	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	24.6	2.1e-23
WP_060715060.1|34033_35131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715061.1|35339_36083_-	ATP-binding protein	NA	A0A0N7ACA6	Bacillus_phage	26.1	6.2e-05
WP_082375942.1|36082_37675_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.9	4.6e-13
WP_060715064.1|38057_38666_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.8	5.9e-38
WP_060715065.1|38951_39749_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_060715066.1|39828_40677_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082375943.1|40735_41530_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_060715188.1|42648_44103_+	amidase	NA	NA	NA	NA	NA
WP_060715069.1|44207_44798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715070.1|45069_45639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715071.1|45728_46832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715072.1|46967_48155_-	DNA cytosine methyltransferase	NA	A0A1B3AZA3	Gordonia_phage	40.2	4.1e-67
WP_060711311.1|48344_49754_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.3	2.4e-119
WP_082375944.1|49888_50479_-	DNA cytosine methyltransferase	NA	A0A0F6YQ48	Mycobacterium_phage	53.9	2.5e-41
WP_145981684.1|50628_51300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169619.1|51774_51942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715075.1|52031_53231_-	bifunctional DNA primase/polymerase	NA	A0A068F3J2	Mycobacterium_phage	29.6	1.4e-11
WP_060715076.1|53370_53787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715077.1|54123_54372_-	WhiB family transcriptional regulator	NA	A0A222ZM33	Mycobacterium_phage	44.9	3.9e-12
WP_145981685.1|54505_55222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715079.1|55290_55608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169620.1|55746_55893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060711648.1|56091_57516_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.1	1.6e-89
WP_060715080.1|58094_58895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715081.1|58861_62746_-	hypothetical protein	NA	I3PUW5	Vibrio_phage	33.8	2.2e-178
WP_060715084.1|63926_64334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715085.1|64977_65202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715086.1|65332_65617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715087.1|65595_65964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139319111.1|66030_66228_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_060715089.1|66224_66608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169622.1|66629_66806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715090.1|66870_67143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060714314.1|67723_68479_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.0	4.9e-50
WP_145981219.1|68571_69831_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060715092.1|71082_71442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710806.1|71592_72744_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	6.8e-35
WP_060715189.1|73322_74096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060715093.1|74096_74969_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.2	2.7e-28
WP_060710840.1|74965_75256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060715094.1|75957_76380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715095.1|76493_76817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169623.1|76786_77164_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_145981687.1|77586_77949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169617.1|78944_79313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715101.1|79341_81693_+	DEAD/DEAH box helicase	NA	A0A0P0YML3	Yellowstone_lake_phycodnavirus	29.3	2.3e-29
WP_082375975.1|81810_82914_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_060715102.1|83275_83623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715191.1|83619_84702_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_060713947.1|86145_86973_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060713948.1|86991_87585_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.5	6.0e-19
WP_060715103.1|88670_89234_-	hypothetical protein	NA	A6N224	Microbacterium_phage	43.7	2.0e-19
WP_060715104.1|89247_89559_-	ParB N-terminal domain-containing protein	NA	A0A142KA42	Gordonia_phage	40.6	9.8e-05
WP_145981689.1|89723_90206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981690.1|90262_90703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715107.1|90699_92280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145981349.1|93566_94863_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.5e-49
WP_060715108.1|96573_96867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715192.1|97232_97886_+	ParA family protein	NA	NA	NA	NA	NA
WP_082375949.1|97882_98815_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_145981691.1|99934_101548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715111.1|101818_102124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068797468.1|102399_102630_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_060715193.1|102792_103095_+	hypothetical protein	NA	A0A2P1JZW8	Mycobacterium_phage	44.8	9.5e-05
WP_060715112.1|103091_103415_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_145981710.1|103552_104819_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	47.7	5.5e-70
WP_060715113.1|105077_105896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
103471:104840	attR	TGAAGCGCCCCGGGTCTGGTGGAGGCACTGAAGCCACGGGAAGGTGGTCTTCGTGCCGGCACCGAGGAAGTTCAGCGACGAGATGCGTGAGCGGGCCAAGCGCATGGTCCGGGAAGCACGCCAGCAGGAGCCCGGCTTGTCGGTCAACGCCGCGTGTAAGCGGATCGGACCGCAGCTGGGGATCCTTCCCGACACGCTGCGGGGCTGGTGCAAGCAGGCCGATATCGACGACGGTCTGACACCCGGGGTCACGACCGAGGACCGCGACGAGTTGACCCGGCTGCGGCGGGAGAACGCCGAGCTGCGGCGGGCGAATGAGATCCTCAAGACTGCCTCGGCGTTTTTCGCCTCGGCGGAGCTCGACCGCCGACTGCGGTGATCGTCGACTACATCGACGCCCACAAGGGCCGGTTCGGGGTCGAGCCGATCTGTGCTGTGCTGACCCAGCACGGCGCCACGATCGCCCCGAGCGGCTACTACGCAGCCAAGACCCGCCCGCCGTCGCGGCGAGCGCGCTCCGACACCGGGCTGGCCGAGACGATCGAGGCCACGTTCTGGGACCGAGCCAAGGGCCGCGGGGTCTACGGAGCCCGCAAGATGTGGCACCAGCTGCGCCGAGACGGCGTCCCGGGCGCCGACGGCGCTCCGGTCGCCCGCTGCACCGTCGAGCGGCTGATGCGCTACCTGGGCCTACGCGGCGCCCGCCGCGGAGCGCCAGTGCTGACCACCCGACCCGACCGACAGGCCACCCGGGCGCCGGATCTGGTCGATCGGGACTTCACCGCCGCCGCACCCAACCGGCTCTGGGTAGTGGATCTGACCTACGTGCCGACCTGGTCGGGGATGGTGTTCACCGCGTTCGTCTCCGACGTGTTCTCCCGACGCATCGTCGGATGGCGTTGCGCTTCCTCGATGCCAACCGAGCTCCCGCTCGACGCTCTGGAAATGGCGTTGTGGACCCGTGACAGCGCAGGTCAGACGACCGACGGGCGCCTGGACGGGTTGATCCATCACAGCGATGCAGGCAGCCAGTACTGCGCTATCCGATACGGCAACCGCCTCGCCGAGGCCGGCGCGATCGCCTCGATCGGCTCGGTCGGTGACAGCTACGACAACGCCCTGGCCGAGTCGGTGATCGGGCTCTACAAGACCGAGTGCATCCGCCGTGACGGACCGATCCGTGCGGTCGAGGATCTCGAGCTGGCCACCGCGAGCTGGGTGCATTGGTTCAACACCCAGCGGCTGCACTCCATGATCGGCAACATGCCGCCGATCGAGTACGAACAGAACTACTACGCTCACCAACCAGCCCGAGACACTCCGATCTCGGGAGAACTCAGCCTCCACTGAACCCGGGGCGCTTCACGTCG	NA	NA	NA	NA
WP_060715114.1|106040_106595_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_060715115.1|106662_108243_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_060715116.1|108256_109132_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_082375976.1|109204_110029_+	adenylyltransferase/cytidyltransferase family protein	NA	NA	NA	NA	NA
WP_082375977.1|110412_111363_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060711070.1|112116_113412_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.1	6.9e-36
WP_145981692.1|113458_114559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715119.1|114707_115160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715120.1|115166_116717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060715121.1|116932_117217_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060715194.1|117266_117665_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_060715122.1|117719_118202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981693.1|118595_118802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060715124.1|118798_119176_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	46.3	4.7e-17
WP_145981694.1|119231_119414_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_064485717.1|119471_120797_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	21.0	8.7e-10
WP_068800947.1|121013_121244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145981695.1|121581_122676_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_060711311.1|122856_124266_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.3	2.4e-119
WP_193394056.1|124531_125335_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_082375979.1|125774_126686_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145981319.1|126574_127871_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	1.9e-49
WP_168169624.1|127841_128300_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060715129.1|128359_128692_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	131975	133988	242173		Burkholderia_virus(100.0%)	1	NA	NA
WP_060715131.1|131975_133988_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.9	2.3e-09
>prophage 7
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	219225	220516	242173		Mycobacterium_phage(50.0%)	2	NA	NA
WP_060713948.1|219225_219819_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.5	6.0e-19
WP_168169629.1|219715_220516_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	30.6	4.9e-08
>prophage 8
NZ_CP011869	Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence	242173	230365	233775	242173		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_145981715.1|230365_231214_+	glycoside hydrolase family 16 protein	NA	M1HKY4	Acanthocystis_turfacea_Chlorella_virus	28.9	1.2e-07
WP_168169631.1|232560_233775_+	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	59.3	3.8e-20
