The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012677	Arthrobacter alpinus strain R3.8, complete genome	4046453	1123696	1154521	4046453	tail,terminase,portal,transposase,integrase	Gordonia_phage(38.46%)	36	1120714:1120736	1125170:1125192
1120714:1120736	attL	TTGCGGACTGTTTGCGGACTAGG	NA	NA	NA	NA
WP_082357778.1|1123696_1123888_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	42.6	1.4e-06
WP_062006122.1|1124397_1124934_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8SBN2	Clostridium_phage	51.1	1.2e-05
WP_157374905.1|1125201_1125477_+	hypothetical protein	NA	NA	NA	NA	NA
1125170:1125192	attR	TTGCGGACTGTTTGCGGACTAGG	NA	NA	NA	NA
WP_062006127.1|1125720_1126578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082357779.1|1126928_1127555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006131.1|1127565_1127856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006135.1|1128247_1128718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062006136.1|1129125_1129599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006138.1|1129595_1130450_-	hypothetical protein	NA	A0A222Z0I7	Arthrobacter_phage	29.6	1.1e-05
WP_062006140.1|1130458_1131091_-	collagen-like protein	NA	NA	NA	NA	NA
WP_062006142.1|1131077_1131335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006144.1|1131385_1132738_-	hypothetical protein	NA	A0A0U4IVC6	Arthrobacter_phage	32.9	4.0e-18
WP_062006145.1|1132727_1133837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006147.1|1133838_1134906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374906.1|1134917_1135772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006151.1|1135771_1139092_-|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	31.9	4.2e-85
WP_062006153.1|1139134_1139350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062006157.1|1139642_1140299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006160.1|1140401_1140920_-	hypothetical protein	NA	A0A0U4IC83	Arthrobacter_phage	37.0	8.7e-14
WP_062006162.1|1140920_1141133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006166.1|1141573_1141951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374907.1|1142339_1142729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374908.1|1142742_1142976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006174.1|1142980_1143940_-	hypothetical protein	NA	A0A2H5BLW0	Streptomyces_phage	70.8	4.2e-123
WP_062006176.1|1143991_1144594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374909.1|1144671_1145802_-	hypothetical protein	NA	A0A1C9EHV4	Gordonia_phage	37.5	2.6e-39
WP_062006179.1|1145836_1147237_-|portal	phage portal protein	portal	A0A1C9EHZ9	Gordonia_phage	44.1	9.0e-98
WP_062006180.1|1147249_1147882_-|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	57.5	1.9e-63
WP_062006181.1|1147844_1148918_-	hypothetical protein	NA	A0A1C9EHW4	Gordonia_phage	59.7	3.6e-123
WP_062006183.1|1148904_1149450_-	hypothetical protein	NA	A0A1C9EHY3	Gordonia_phage	46.9	9.1e-22
WP_062006185.1|1150193_1150673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062006187.1|1150834_1151605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062006189.1|1151842_1152547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062006191.1|1152681_1153062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374910.1|1153135_1153288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157374911.1|1153319_1154521_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	34.6	1.9e-27
>prophage 2
NZ_CP012677	Arthrobacter alpinus strain R3.8, complete genome	4046453	2773990	2784758	4046453		uncultured_virus(28.57%)	9	NA	NA
WP_062007506.1|2773990_2775505_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.3	3.8e-94
WP_082358186.1|2775703_2777626_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.5	1.6e-65
WP_062007507.1|2778035_2779643_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.8	7.0e-155
WP_038464523.1|2779761_2780058_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	47.4	6.2e-17
WP_062007508.1|2780349_2781240_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	32.6	1.2e-15
WP_062007509.1|2781236_2782049_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062007510.1|2782091_2782850_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.7	5.2e-15
WP_062007511.1|2782846_2783863_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_062009747.1|2783852_2784758_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.1	8.5e-65
