The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	607576	685739	5207023	protease,integrase,tail,capsid,portal,terminase,tRNA,holin,head	Klebsiella_phage(32.65%)	96	610233:610252	667128:667147
WP_033647143.1|607576_608395_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060706284.1|608579_609134_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_060445736.1|609229_610717_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.4	3.8e-14
610233:610252	attL	GGTTCGTCGAGGATCAGCAG	NA	NA	NA	NA
WP_060387397.1|610807_611599_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_060387398.1|611787_613950_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_060443852.1|613921_614944_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033647137.1|614945_615701_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033647136.1|615702_616728_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_060420269.1|616724_617513_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.3	3.7e-08
WP_004939813.1|617658_617808_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_033647133.1|617966_618740_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019454005.1|618736_619426_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033647131.1|619426_620494_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.1	3.0e-21
WP_048322045.1|620525_621344_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_071883775.1|621472_621724_-	pyocin activator PrtN family protein	NA	A0A1D9C9N7	Salinivibrio_phage	48.7	1.3e-15
WP_071883776.1|621782_622121_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	49.1	4.6e-24
WP_060706285.1|622113_622512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706286.1|622521_622776_-	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	45.7	3.6e-13
WP_060706288.1|623330_623684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047025459.1|623673_623859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706289.1|623886_624642_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	78.9	5.1e-124
WP_060706290.1|624638_625160_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.1	6.6e-70
WP_060706291.1|625159_626086_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_060706292.1|626082_626616_-	hypothetical protein	NA	J9Q748	Salmonella_phage	64.0	3.3e-61
WP_060706293.1|626612_627002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706294.1|626998_627784_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	50.6	6.0e-59
WP_157783371.1|628861_629074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173585566.1|629276_629939_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	70.8	5.4e-85
WP_049202636.1|630031_630229_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.7	1.9e-17
WP_033646514.1|630256_630790_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	30.1	3.6e-15
WP_071883778.1|630988_631906_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	59.0	3.5e-34
WP_158500240.1|631886_632624_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	44.5	9.3e-54
WP_129993347.1|632965_633193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706296.1|633189_633735_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.7	3.4e-61
WP_060706297.1|633731_634115_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	63.3	6.3e-38
WP_060706298.1|634099_635095_+	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	47.3	1.9e-86
WP_060429333.1|635147_635576_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	73.3	7.6e-48
WP_049202652.1|635799_636177_+|holin	phage holin family protein	holin	F1C592	Cronobacter_phage	50.8	7.9e-25
WP_049202679.1|636190_636499_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	40.9	4.8e-12
WP_060706299.1|636495_637107_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	62.3	8.5e-69
WP_071883780.1|637103_637493_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_060706301.1|637645_637843_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	70.5	2.4e-17
WP_071883782.1|637961_638183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060443171.1|638182_638473_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	89.6	7.1e-50
WP_060429326.1|638485_638695_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	79.7	2.0e-22
WP_060429325.1|638812_639247_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	90.3	1.5e-67
WP_060706302.1|639256_640789_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	97.3	5.1e-288
WP_060706303.1|640790_642068_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	96.7	8.1e-239
WP_077267552.1|642073_642754_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	93.8	1.8e-115
WP_049202662.1|642765_643929_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	93.5	1.4e-200
WP_144423248.1|643968_644205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883783.1|644170_644503_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	62.7	8.2e-34
WP_060706304.1|644563_644773_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	58.0	8.6e-05
WP_060706305.1|644775_645108_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	73.6	2.4e-41
WP_060706306.1|645100_645583_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	64.4	3.3e-52
WP_060706307.1|645582_645948_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	80.2	8.7e-53
WP_060706308.1|646007_646505_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	81.0	5.1e-72
WP_060429318.1|646562_646943_+|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	80.2	3.2e-50
WP_071883868.1|647257_647617_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_060706309.1|647674_650239_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	47.2	1.3e-179
WP_071883785.1|650238_650709_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.3	4.2e-60
WP_071883786.1|650705_651188_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	68.1	1.1e-58
WP_060706310.1|651198_651579_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	72.2	3.4e-52
WP_144423277.1|651638_654653_+	kinase	NA	A0A286S259	Klebsiella_phage	49.5	7.0e-273
WP_144423249.1|654708_657018_+	hypothetical protein	NA	A0A127KNR5	Pseudomonas_phage	34.6	3.6e-11
WP_060706314.1|657018_657924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060443470.1|657926_658121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706315.1|658145_658385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706316.1|658384_659476_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	62.3	1.2e-134
WP_060706317.1|659790_660786_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_060443467.1|660853_661336_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_016928691.1|661492_661894_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_060706318.1|661898_663173_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	4.0e-20
WP_033653544.1|663261_664299_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_060706319.1|664298_665450_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_033637500.1|665433_666201_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_060443463.1|666193_666868_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_060428818.1|666895_667618_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
667128:667147	attR	GGTTCGTCGAGGATCAGCAG	NA	NA	NA	NA
WP_130042688.1|667762_667942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033647115.1|668726_670739_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_004939783.1|670839_671106_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_033637504.1|671112_672030_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	26.8	2.0e-21
WP_060706320.1|672619_673606_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_033637505.1|673630_674146_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_033637506.1|674149_674629_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_019453985.1|674625_674871_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_060387399.1|674873_675341_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_033637508.1|675471_676182_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_033637509.1|676257_677364_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033637510.1|677375_678530_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060706321.1|678526_680263_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	2.8e-24
WP_033647110.1|680271_681258_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_033653501.1|681276_681975_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_033637514.1|682272_683649_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	7.3e-52
WP_060706322.1|683762_684722_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.0	1.2e-16
WP_060706323.1|684806_685739_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	1029785	1111865	5207023	protease,integrase,tail,capsid,portal,terminase,holin,plate,head	Cronobacter_phage(55.56%)	91	1031909:1031925	1069636:1069652
WP_049197154.1|1029785_1030298_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_080377020.1|1030353_1031244_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144423250.1|1031317_1032487_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
1031909:1031925	attL	CCGGTGGTGTGGGTGGG	NA	NA	NA	NA
WP_060706379.1|1032483_1033485_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_060706380.1|1033517_1034210_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_140926889.1|1034396_1034747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060438902.1|1035126_1036602_+	phospholipase	NA	NA	NA	NA	NA
WP_060419791.1|1036598_1037342_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060422226.1|1037393_1038167_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_049213126.1|1038216_1039113_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_060706381.1|1039114_1039555_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060706382.1|1039786_1040821_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	5.1e-114
WP_060706383.1|1040847_1041462_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.2e-33
WP_060706384.1|1041597_1041819_+	regulator	NA	NA	NA	NA	NA
WP_060706385.1|1041851_1042361_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	53.2	2.9e-38
WP_060706386.1|1042370_1042574_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_158500241.1|1042576_1042957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706388.1|1042964_1043369_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	46.8	3.1e-27
WP_046897806.1|1043444_1043672_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_158500242.1|1043668_1043827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706389.1|1043836_1044736_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.5	3.5e-71
WP_060706390.1|1044732_1044963_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	43.4	5.0e-06
WP_060706391.1|1044959_1045586_+	HNH endonuclease	NA	A0A2I7RAW6	Vibrio_phage	60.6	2.3e-05
WP_060706392.1|1045582_1045975_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_060706393.1|1045974_1048026_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	64.7	4.5e-247
WP_060706394.1|1048102_1048321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072628566.1|1048288_1048564_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	68.6	3.5e-30
WP_060706395.1|1048614_1049664_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.9	7.9e-139
WP_060706396.1|1049660_1051451_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	4.1e-244
WP_060706397.1|1051627_1052437_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	41.6	8.7e-45
WP_060431885.1|1052480_1053509_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	77.6	7.0e-148
WP_060706398.1|1053515_1054220_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	61.5	5.7e-77
WP_046897797.1|1054319_1054772_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.0	4.9e-37
WP_060706399.1|1054768_1055269_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	1.8e-32
WP_060706400.1|1055265_1055976_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	63.0	3.6e-79
WP_060435826.1|1055972_1057097_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	65.1	4.9e-139
WP_046897793.1|1057093_1057549_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.6	1.2e-54
WP_060706401.1|1057558_1057861_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	51.1	4.9e-17
WP_060706402.1|1057847_1058189_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	3.7e-45
WP_060706403.1|1058188_1058560_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	56.8	1.3e-24
WP_046897788.1|1058680_1058956_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	59.8	3.6e-19
WP_060706404.1|1059143_1061543_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.3	3.6e-155
WP_060431894.1|1061542_1061890_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	74.7	1.6e-35
WP_060706405.1|1061867_1063052_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	67.3	2.3e-150
WP_060706406.1|1063044_1063644_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	69.0	6.2e-72
WP_080377021.1|1063648_1066513_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	64.8	2.9e-103
WP_060706407.1|1066515_1066944_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.8	4.6e-13
WP_060706408.1|1066933_1067656_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	37.5	3.5e-37
WP_060706409.1|1067630_1068197_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	57.6	9.4e-46
WP_060706410.1|1068183_1069836_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.0	1.0e-169
1069636:1069652	attR	CCGGTGGTGTGGGTGGG	NA	NA	NA	NA
WP_060706411.1|1070523_1071138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004938680.1|1071465_1073154_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_033637808.1|1073448_1073838_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004938676.1|1073883_1074147_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_033646672.1|1074377_1074680_+	YbjC family protein	NA	NA	NA	NA	NA
WP_033637810.1|1074734_1075637_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	37.0	1.6e-39
WP_004938666.1|1075772_1076252_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_033637811.1|1076658_1077768_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_033637812.1|1077891_1079025_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	33.5	2.1e-28
WP_033646669.1|1079049_1080012_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_016928360.1|1080008_1080854_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_049197168.1|1080958_1081438_+	YbjO family protein	NA	NA	NA	NA	NA
WP_043147092.1|1081507_1082635_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	2.1e-28
WP_033654647.1|1082631_1082916_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	58.5	3.0e-24
WP_004928423.1|1082905_1083157_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_043147094.1|1083258_1083993_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033637817.1|1084190_1084859_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_033637818.1|1084858_1085575_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_033637819.1|1085584_1086316_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038884338.1|1086348_1087077_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	3.9e-28
WP_033637821.1|1087341_1087884_-	lipoprotein	NA	NA	NA	NA	NA
WP_004928400.1|1088043_1088367_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	43.3	2.9e-15
WP_060706412.1|1088486_1089323_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.7	2.9e-11
WP_033646660.1|1089323_1090334_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060706413.1|1090492_1091932_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033654657.1|1092082_1092430_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_060706414.1|1092430_1093258_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060706415.1|1093425_1094982_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.3	2.3e-09
WP_060706416.1|1094978_1095674_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_049232911.1|1095704_1096721_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_033646648.1|1096797_1098519_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_060706417.1|1098718_1099720_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_043147128.1|1099776_1101426_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004928363.1|1101606_1102503_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_033637834.1|1102690_1104349_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_043147130.1|1104366_1105320_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_033637836.1|1105514_1106630_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_043147132.1|1106629_1108573_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.3	6.1e-36
WP_004928349.1|1108660_1108882_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_004928347.1|1109237_1109558_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_025302261.1|1109585_1111865_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	8.7e-167
>prophage 3
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	1499797	1531020	5207023	coat,protease	Moraxella_phage(33.33%)	27	NA	NA
WP_049234232.1|1499797_1500733_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_173585568.1|1500753_1503174_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_048321500.1|1503241_1504006_-	molecular chaperone	NA	NA	NA	NA	NA
WP_086557004.1|1504030_1504579_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071883799.1|1504584_1505088_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|1505090_1505630_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_049212638.1|1505904_1507341_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033647432.1|1507442_1510073_-	PqiB family protein	NA	NA	NA	NA	NA
WP_033638760.1|1510041_1511289_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033638286.1|1511544_1512042_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1512138_1512849_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|1512868_1514917_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638291.1|1515226_1516105_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_060706466.1|1516342_1517050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706467.1|1517150_1518545_-	MFS transporter	NA	NA	NA	NA	NA
WP_033646330.1|1518776_1519568_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_048321504.1|1519614_1520418_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060706468.1|1520420_1521284_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_094859797.1|1521285_1522422_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_060706469.1|1522418_1523429_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033653907.1|1523604_1524324_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_041034837.1|1524479_1525583_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_033653909.1|1525592_1526402_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_033638304.1|1526465_1527857_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_033638305.1|1528038_1528587_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_033638306.1|1529010_1529676_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033646324.1|1529739_1531020_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	1548032	1610052	5207023	integrase,tail,coat,terminase,lysis,tRNA,head	Salmonella_phage(22.41%)	79	1542722:1542739	1611505:1611522
1542722:1542739	attL	GCTGGCGGTGCCGGTGAT	NA	NA	NA	NA
WP_060706471.1|1548032_1549226_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	60.1	4.2e-136
WP_071532844.1|1549189_1549438_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.0	1.6e-13
WP_060706472.1|1549620_1550268_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	74.4	5.1e-88
WP_158500243.1|1550264_1550459_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144423252.1|1550684_1550903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706473.1|1550880_1551474_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	50.6	2.7e-11
WP_158500244.1|1551470_1551638_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_060706474.1|1551639_1552344_-	FAD-dependent oxidoreductase	NA	R9W086	Serratia_phage	50.4	1.3e-44
WP_144423279.1|1552340_1552610_-	hypothetical protein	NA	A0A2C9CX56	Yersinia_phage	70.2	3.5e-27
WP_060706476.1|1552603_1552804_-	hypothetical protein	NA	R9VYJ0	Serratia_phage	95.5	3.0e-31
WP_060706477.1|1552796_1553222_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	73.1	1.8e-54
WP_060706478.1|1553205_1553628_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	55.8	2.7e-29
WP_060706481.1|1554398_1555238_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	59.3	3.3e-79
WP_154582428.1|1555241_1555385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110653867.1|1555378_1555591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706483.1|1556145_1556358_-	hypothetical protein	NA	A0A060DBB4	Salmonella_phage	74.3	1.6e-22
WP_071883803.1|1556375_1556534_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	50.0	6.5e-05
WP_071883875.1|1557040_1557634_-	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	59.2	1.2e-14
WP_060706484.1|1557744_1557957_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	73.9	5.4e-23
WP_060706485.1|1557982_1558273_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	39.4	2.8e-06
WP_060706486.1|1558388_1558712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060707001.1|1558906_1559551_+	phage antirepressor KilAC domain-containing protein	NA	A0A2I7RHG4	Vibrio_phage	48.4	1.8e-45
WP_071883804.1|1559553_1559730_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_060706488.1|1560808_1561783_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	37.0	1.2e-59
WP_060707002.1|1561779_1562136_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.2	2.2e-40
WP_060706489.1|1562132_1562531_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	56.1	2.2e-33
WP_140367551.1|1562779_1563118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060387656.1|1563268_1563448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883805.1|1563427_1563691_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_060706490.1|1563838_1564135_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	68.4	2.4e-29
WP_060706491.1|1564136_1564667_+	lysozyme	NA	H9C184	Pectobacterium_phage	82.9	4.5e-82
WP_060706492.1|1564767_1565244_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	57.8	3.4e-41
WP_080377047.1|1565297_1566041_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_060425678.1|1567417_1567672_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.3	4.5e-24
WP_060706493.1|1567711_1568362_+	hypothetical protein	NA	I6S676	Salmonella_phage	73.8	1.3e-88
WP_043147348.1|1568393_1568837_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.4	7.1e-49
WP_049300008.1|1568840_1570331_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	80.7	1.3e-240
WP_060706494.1|1570341_1571769_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	63.2	7.9e-166
WP_144423253.1|1571836_1572724_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	64.6	1.7e-105
WP_060706496.1|1572754_1574140_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	60.4	2.1e-155
WP_060706497.1|1574143_1574581_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.8	3.4e-43
WP_043147354.1|1574591_1575668_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.4	1.0e-154
WP_043147355.1|1575677_1576079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049300002.1|1576081_1576459_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	80.2	7.1e-50
WP_043147357.1|1576553_1576901_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	60.3	3.4e-30
WP_043147358.1|1576902_1577271_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.8	1.8e-45
WP_043147359.1|1577267_1577651_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	64.6	5.4e-45
WP_060451528.1|1577675_1578434_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	73.0	8.3e-82
WP_060706498.1|1578485_1579160_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	56.7	3.9e-67
WP_060706499.1|1579415_1579859_+	SocA family protein	NA	I6R0L8	Salmonella_phage	68.7	2.0e-59
WP_071883807.1|1579869_1580292_+	hypothetical protein	NA	I6S1K6	Salmonella_phage	56.8	1.2e-32
WP_158500245.1|1580408_1580627_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_060706500.1|1580595_1581087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706501.1|1581086_1581374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706502.1|1581434_1584881_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	47.3	9.1e-176
WP_060706503.1|1584937_1585405_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.2	2.5e-52
WP_060706504.1|1585405_1585876_+	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	57.5	2.0e-46
WP_060707003.1|1585895_1586288_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	63.0	4.6e-44
WP_060706505.1|1586247_1588746_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	55.3	2.1e-254
WP_060706506.1|1588746_1591053_+	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	60.9	6.2e-11
WP_060706507.1|1591053_1591959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033637997.1|1592104_1592527_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_060706508.1|1592526_1593795_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	3.9e-177
WP_060706509.1|1593791_1594499_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	55.7	5.2e-70
WP_025159696.1|1594766_1596695_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_048233542.1|1596698_1597250_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|1597348_1597546_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|1597589_1597946_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_151498502.1|1598012_1598108_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931416.1|1598354_1599338_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_060445536.1|1599352_1601740_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.8e-05
WP_004931414.1|1601744_1602041_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_033638328.1|1602590_1603007_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_033653920.1|1603185_1604193_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_060387687.1|1604238_1604790_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	34.4	9.8e-16
WP_033638333.1|1604795_1605551_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.8e-05
WP_033638335.1|1605948_1607103_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.2	1.2e-28
WP_060706510.1|1607089_1608070_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	I1TED8	Salmonella_phage	34.2	1.5e-35
WP_033638761.1|1608069_1610052_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-21
1611505:1611522	attR	GCTGGCGGTGCCGGTGAT	NA	NA	NA	NA
>prophage 5
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	2256474	2292608	5207023	integrase,tail,terminase,holin,head	uncultured_Caudovirales_phage(25.0%)	49	2284200:2284216	2298553:2298569
WP_060706591.1|2256474_2256870_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	49.6	1.0e-22
WP_060706592.1|2256988_2257246_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	57.0	2.1e-16
WP_060706593.1|2257242_2257617_-	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	44.0	3.1e-13
WP_060706594.1|2257601_2258117_-	lysozyme	NA	Q71TF3	Escherichia_phage	55.1	4.1e-48
WP_060706595.1|2258100_2258334_-|holin	class II holin family protein	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_144423256.1|2258365_2260942_-	hypothetical protein	NA	K4NYZ2	Pseudomonas_phage	32.7	2.8e-12
WP_060706597.1|2260955_2262566_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.2	5.6e-229
WP_060706598.1|2262562_2262904_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	45.5	1.0e-18
WP_071883881.1|2262974_2263289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154618216.1|2263331_2263478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706600.1|2263490_2265965_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	75.0	0.0e+00
WP_060706601.1|2265969_2267439_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	49.9	1.2e-100
WP_144423257.1|2267435_2269961_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.2	3.3e-175
WP_060706603.1|2269960_2270485_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	45.7	3.8e-09
WP_060706604.1|2270487_2270937_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	44.3	8.8e-23
WP_060706605.1|2270939_2272928_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	6.0e-180
WP_060426428.1|2272930_2273500_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.8	4.8e-50
WP_060706606.1|2273554_2274466_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.3	3.2e-43
WP_060706607.1|2274676_2275498_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.1	7.5e-44
WP_060706608.1|2275484_2275718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706609.1|2275717_2277340_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.1	1.6e-175
WP_060426441.1|2277343_2277562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706610.1|2277572_2278025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041034508.1|2278053_2278350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144423258.1|2278352_2278640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883815.1|2278627_2278933_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	58.3	2.4e-27
WP_060706611.1|2278941_2279538_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	67.2	1.2e-75
WP_060448303.1|2279953_2280166_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.4	1.1e-26
WP_144423259.1|2280990_2281608_-	hypothetical protein	NA	R9W086	Serratia_phage	42.7	4.0e-18
WP_047025459.1|2281597_2281783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883882.1|2281978_2282164_-	protein ninD	NA	C6ZR56	Salmonella_phage	62.2	4.4e-13
WP_060706615.1|2282211_2282871_-	hypothetical protein	NA	G9L6G6	Escherichia_phage	36.4	1.9e-05
WP_060706616.1|2282881_2283127_-	hypothetical protein	NA	H9C167	Pectobacterium_phage	47.6	2.9e-12
WP_060706617.1|2283130_2283553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706618.1|2283597_2284971_-	hypothetical protein	NA	Q76H51	Enterobacteria_phage	48.4	5.7e-113
2284200:2284216	attL	CGTCGCACAGCGATTCC	NA	NA	NA	NA
WP_071883817.1|2284967_2285687_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	69.0	3.2e-30
WP_060706619.1|2285689_2285908_-	adenylate cyclase	NA	H9C163	Pectobacterium_phage	62.3	4.9e-19
WP_060706620.1|2285932_2286385_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.5	2.9e-29
WP_047568252.1|2286446_2286653_-	regulatory protein	NA	A0A1W6JP24	Morganella_phage	40.7	1.7e-05
WP_047568254.1|2286733_2287120_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	64.2	6.9e-16
WP_144423261.1|2287123_2287576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706621.1|2287614_2287929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047568258.1|2287939_2288218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706622.1|2288268_2290413_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	2.6e-104
WP_060426487.1|2290409_2290910_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	69.3	2.3e-56
WP_168166355.1|2290951_2291128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706623.1|2291178_2291379_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	55.7	2.2e-10
WP_071883818.1|2291344_2291611_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	61.1	1.2e-16
WP_060706624.1|2291552_2292608_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	53.8	5.0e-101
2298553:2298569	attR	CGTCGCACAGCGATTCC	NA	NA	NA	NA
>prophage 6
NZ_CP012685	Serratia marcescens strain SmUNAM836 chromosome, complete genome	5207023	3272696	3366386	5207023	integrase,tail,capsid,portal,terminase,tRNA,holin,plate,head	Salmonella_phage(11.63%)	100	3342789:3342803	3371233:3371247
WP_004941426.1|3272696_3273893_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004941424.1|3274125_3274551_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	37.3	3.5e-13
WP_033648917.1|3274713_3275544_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_033635597.1|3275633_3276929_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.1	1.7e-34
WP_006327336.1|3277229_3277430_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004941417.1|3277462_3277798_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_033648918.1|3277800_3279651_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.1	1.8e-101
WP_033648919.1|3279683_3280205_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004941410.1|3280267_3280591_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	1.2e-21
WP_033635600.1|3280645_3281032_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	81.5	2.2e-54
WP_016929764.1|3281056_3282271_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	33.1	2.5e-35
WP_004941404.1|3282325_3282820_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_060706753.1|3283013_3283748_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_060436588.1|3283867_3284671_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_016929766.1|3284726_3285749_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_033651572.1|3285739_3286375_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_033648923.1|3287822_3288968_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004941389.1|3289124_3290378_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.6	1.0e-100
WP_033648924.1|3290735_3291926_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_060436587.1|3291963_3293148_-	cytochrome c	NA	NA	NA	NA	NA
WP_060436586.1|3293144_3295055_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033648927.1|3295140_3296565_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004941378.1|3296600_3297407_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025303927.1|3297396_3298341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060438242.1|3298342_3299371_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	7.5e-25
WP_033648931.1|3299424_3300579_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043147834.1|3300652_3302116_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039568556.1|3302231_3303155_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004847623.1|3303555_3303894_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_025303930.1|3303905_3305528_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	4.1e-94
WP_033635613.1|3305657_3306998_-	two-component system response regulator GlrR	NA	NA	NA	NA	NA
WP_051917635.1|3306994_3307867_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_033635614.1|3307870_3309307_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	2.6e-15
WP_173585575.1|3310194_3314088_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	1.6e-128
WP_041036366.1|3314362_3315823_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	38.8	4.8e-09
WP_033648933.1|3315823_3316330_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	7.7e-07
WP_033648934.1|3316447_3317512_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_033648935.1|3317547_3318204_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_033648936.1|3318207_3319575_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_033648937.1|3319593_3320487_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_033648938.1|3320654_3321503_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060430489.1|3321801_3322041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706754.1|3322064_3322973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144423265.1|3322973_3325355_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	31.0	3.0e-29
WP_060706756.1|3325452_3325716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883836.1|3325716_3326748_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_071883837.1|3326791_3327433_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	50.3	6.9e-29
WP_060433271.1|3327476_3328151_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_060706758.1|3328147_3329296_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	27.9	6.0e-23
WP_060706759.1|3329299_3329737_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	40.5	3.7e-18
WP_060706760.1|3329733_3330324_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	30.3	1.3e-05
WP_060706761.1|3330320_3331391_-|tail	phage tail protein	tail	Q8HAC0	Salmonella_phage	29.8	6.5e-40
WP_060706762.1|3331387_3332791_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	25.6	4.4e-28
WP_144423266.1|3332839_3333574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706763.1|3333607_3335485_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	45.7	4.8e-22
WP_060706764.1|3335606_3335897_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_060432162.1|3335898_3336267_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_060706765.1|3336276_3337782_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.9	1.9e-101
WP_060420161.1|3337778_3337973_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_060706766.1|3337977_3338520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706767.1|3338516_3338861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706768.1|3338860_3339286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060435587.1|3339287_3340337_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	34.0	7.3e-52
WP_060441815.1|3340438_3340840_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	34.0	4.2e-08
WP_060706769.1|3340839_3341436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060425445.1|3341439_3342300_-	S49 family peptidase	NA	A0A0B4SK12	Proteus_phage	42.6	1.3e-51
WP_080377037.1|3342296_3343940_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.2	2.1e-98
3342789:3342803	attL	CGCGGCGATATTGCG	NA	NA	NA	NA
WP_060420187.1|3343939_3344203_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_060706770.1|3344211_3346191_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.3	2.2e-142
WP_060432173.1|3346162_3346762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706771.1|3346905_3347550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706772.1|3348189_3348609_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_060706773.1|3348605_3349232_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	62.2	4.3e-68
WP_060430641.1|3349234_3349585_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	67.9	1.3e-29
WP_060706774.1|3349659_3350688_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	61.8	1.0e-119
WP_060706775.1|3350988_3351471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706776.1|3351472_3351754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144423267.1|3351823_3352051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060706777.1|3352255_3352927_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.3	7.2e-45
WP_060706778.1|3352923_3353502_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	62.5	5.1e-39
WP_033655077.1|3353485_3354472_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	61.3	7.2e-110
WP_060706779.1|3354468_3355998_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	66.0	5.8e-199
WP_033653818.1|3356183_3356483_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	45.3	1.9e-13
WP_060706780.1|3356517_3357051_-	hypothetical protein	NA	S5FXP0	Shigella_phage	54.2	8.3e-44
WP_071883840.1|3357109_3357340_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	57.6	9.1e-16
WP_033653816.1|3357444_3358110_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	54.2	1.4e-61
WP_071883841.1|3358509_3358668_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	52.3	1.3e-05
WP_060706781.1|3358682_3359126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144423268.1|3359173_3359386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144423269.1|3359603_3359873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049301697.1|3360058_3360421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706782.1|3360463_3361285_+	DUF2303 family protein	NA	A0A0A8IL76	Aurantimonas_phage	29.3	8.0e-22
WP_060706783.1|3361357_3362191_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	56.9	4.4e-84
WP_049269877.1|3362187_3362313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706784.1|3362341_3362560_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.3	2.3e-08
WP_060706785.1|3362591_3363437_+	hypothetical protein	NA	M4MB35	Vibrio_phage	39.8	4.4e-47
WP_060706786.1|3363449_3363965_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_060706787.1|3363966_3364311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706788.1|3364307_3364784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060706789.1|3364988_3366386_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3371233:3371247	attR	CGCAATATCGCCGCG	NA	NA	NA	NA
