The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	485694	575622	4556337	transposase,integrase,tail,tRNA,lysis	Cronobacter_phage(12.5%)	94	523320:523350	565041:565071
WP_002209743.1|485694_486903_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|487774_488635_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|489444_490251_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|490348_490735_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|490747_491038_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|491034_492960_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|493021_494068_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|494292_494844_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|495006_496857_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|496973_497990_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|498004_498652_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|498785_499058_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|499128_499542_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|499889_500885_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|501198_502074_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|502146_502896_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|503339_505274_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|505423_506698_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|506805_507924_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|507958_508864_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|509061_509931_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|510195_511398_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|511413_512718_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|513182_514718_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|514935_515655_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|515898_517473_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|517708_518239_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|518655_519012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|520103_520844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|520860_522060_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|522063_523236_+	MFS transporter	NA	NA	NA	NA	NA
523320:523350	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|523540_524749_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_097608205.1|524969_525338_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|525399_526317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|526333_527332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|527331_530535_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|530710_530932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|531106_531727_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|531782_531998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|532140_532692_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|532790_533798_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|533871_534039_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|534162_534594_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|534672_535305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|535565_536276_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|536278_537031_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|537151_537610_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|537914_538256_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|538258_541762_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|541762_542023_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|542070_542382_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|542394_543315_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|543380_543788_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|543784_544369_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|544370_544721_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|544722_544977_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|544973_545456_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|545503_546709_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|546722_547496_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|547617_548730_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|548730_549372_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|549390_550119_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|550118_551093_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|551097_552306_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|552353_552938_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|552941_553391_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|553421_554057_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|554513_555227_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|555772_556231_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|556215_556728_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|556758_556956_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|557201_557477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|557473_557683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|558106_558670_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|558718_558937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|558940_559330_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|559330_559936_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|560009_560456_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|560431_561181_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|561480_561741_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001410461.1|562473_562686_-	hypothetical protein	NA	A0A2L1IVB6	Escherichia_phage	98.0	1.8e-18
WP_002211738.1|563776_565015_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|565041_565488_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
565041:565071	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|565590_566247_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|566317_567403_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|567543_567816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|568536_569223_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|569247_570060_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|570063_570333_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|570569_571691_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002211182.1|571850_573539_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_087768167.1|574073_574181_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|574181_574787_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|574923_575622_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	853841	895141	4556337	transposase,protease,coat	uncultured_virus(16.67%)	33	NA	NA
WP_002209743.1|853841_855050_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|855097_855448_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|855783_856620_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|856711_857473_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|857808_859476_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|859516_860407_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|860399_861320_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|861333_862461_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|862476_863769_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|864066_864777_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|865256_865805_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|866008_867400_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|867614_868466_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|868850_869642_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|869828_870995_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|871321_872689_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|872742_873546_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|873542_874706_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|874702_877315_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|877396_878176_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|878328_878871_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|879528_880410_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|880883_882956_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|882975_883689_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|883784_884282_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|884513_885761_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|885729_888381_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|888859_889414_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|889419_889950_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|889970_890528_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|890558_891311_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|891498_893946_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210858.1|894151_895141_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	962394	1015790	4556337	transposase,tRNA	Escherichia_phage(20.0%)	48	NA	NA
WP_002210913.1|962394_963510_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|963567_964194_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|964254_965625_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|965812_966436_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|966646_967318_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|967323_968778_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|968861_969983_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|970215_971451_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|971780_972617_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002210922.1|973599_974847_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|974846_975551_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|975543_976746_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|977015_980462_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|980700_981240_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|981344_982367_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|982366_983146_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209743.1|983529_984738_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213101.1|984833_985247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215856.1|985254_985824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213097.1|986361_987666_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002213095.1|988040_988583_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002215854.1|988710_989730_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213090.1|989812_990679_-	thiamine kinase	NA	NA	NA	NA	NA
WP_002213089.1|990659_991235_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213088.1|991275_991665_-	YcfL family protein	NA	NA	NA	NA	NA
WP_002213087.1|991699_992053_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002215853.1|992226_993045_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|993487_993946_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213085.1|994135_995569_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213084.1|995874_996684_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213083.1|996698_997721_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213082.1|997720_998359_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002217396.1|998348_999374_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213080.1|999662_1000469_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002213775.1|1000884_1001343_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213079.1|1001542_1002784_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002220787.1|1002878_1003115_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|1003268_1004003_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002210934.1|1004016_1004946_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210933.1|1004983_1005934_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210932.1|1005940_1006975_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210931.1|1007008_1007176_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210930.1|1007188_1007713_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210928.1|1007854_1008451_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002213759.1|1008605_1009064_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210927.1|1009283_1010246_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002354074.1|1010829_1014486_+	ribonuclease E	NA	NA	NA	NA	NA
WP_002209743.1|1014581_1015790_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 4
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	1096027	1208371	4556337	transposase,protease,plate,tRNA,lysis	Escherichia_phage(20.0%)	89	NA	NA
WP_002211870.1|1096027_1098055_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|1098218_1098677_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|1098787_1099810_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1099809_1100589_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228565.1|1100853_1101516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|1102213_1103290_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|1103307_1104561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|1104893_1106075_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|1106316_1106724_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|1106720_1107416_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|1107741_1108626_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|1108981_1110679_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|1110959_1111697_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|1112141_1113152_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|1113172_1114693_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002215885.1|1114922_1115930_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|1116677_1117844_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|1117898_1118561_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|1118744_1119896_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|1120031_1120901_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|1121174_1122314_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|1122334_1123177_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|1123433_1123646_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|1123729_1126090_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|1126091_1127354_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|1127355_1128024_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|1128033_1129344_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|1129878_1131153_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|1131154_1131925_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|1132060_1133269_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|1133312_1133966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|1134193_1135789_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|1136471_1137095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|1137306_1138674_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|1138698_1139151_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|1139150_1139732_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|1139706_1140792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|1140755_1142519_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211939.1|1142739_1143195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211938.1|1143209_1144268_-	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211937.1|1144285_1145887_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211936.1|1145930_1149353_-	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211935.1|1149349_1150582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214564.1|1152746_1153217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211932.1|1153389_1155573_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211931.1|1155588_1155849_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211930.1|1156002_1156776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211929.1|1156772_1159073_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211928.1|1159088_1161437_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211927.1|1161439_1164082_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002210014.1|1164469_1164961_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002214568.1|1164964_1166701_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|1166700_1167387_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002213011.1|1167383_1168736_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|1168747_1170298_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|1170340_1170841_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|1171829_1172678_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|1172776_1173025_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|1173062_1173503_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|1173589_1174378_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|1174380_1175133_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213026.1|1175134_1175854_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|1175846_1177085_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|1177100_1177838_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|1177839_1179123_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|1179112_1179637_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|1179900_1180119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|1180849_1181596_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|1181749_1184167_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|1187812_1188142_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|1188193_1188472_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|1188565_1189756_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|1189816_1190134_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|1190242_1190659_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|1190974_1191655_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|1191833_1192298_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213061.1|1192358_1194344_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213062.1|1194537_1194984_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|1195013_1197152_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|1197253_1197889_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|1198117_1198624_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|1198981_1200043_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|1200232_1200691_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|1200859_1201315_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|1201525_1203277_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|1203345_1203864_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|1204129_1204318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|1204951_1205974_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213775.1|1207912_1208371_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	1406586	1463086	4556337	transposase,protease,tail,coat,plate	Pseudomonas_phage(22.73%)	50	NA	NA
WP_002213775.1|1406586_1407045_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|1407245_1408250_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|1408427_1408655_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|1408682_1410479_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|1410709_1411093_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|1411449_1412598_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|1412610_1413099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|1413798_1414161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|1414286_1415723_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|1416013_1416754_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|1417051_1417831_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|1417927_1418275_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|1418271_1418532_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|1418528_1419665_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|1419668_1420124_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|1420120_1420717_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|1420732_1421788_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|1421784_1423191_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|1423457_1424951_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|1425071_1425371_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|1425372_1425741_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208856.1|1425762_1427271_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|1427267_1427462_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208858.1|1427466_1428084_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|1428129_1428420_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|1429033_1429828_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|1429803_1430616_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208862.1|1431306_1432611_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|1432821_1433301_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|1433574_1434297_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|1434502_1434745_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|1434916_1435852_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208868.1|1436273_1438061_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208869.1|1438134_1439163_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208870.1|1439539_1441066_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228026.1|1441340_1442507_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002213759.1|1443296_1443755_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|1444007_1444466_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210826.1|1444667_1445783_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|1446885_1448040_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|1448063_1450016_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|1450183_1450756_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002210824.1|1450758_1451412_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002228028.1|1451479_1454353_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|1454540_1457216_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|1457477_1458206_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|1458699_1460988_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|1461150_1462281_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|1462284_1462542_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|1462576_1463086_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	1503632	1549037	4556337	transposase,protease,holin,tRNA	Planktothrix_phage(20.0%)	43	NA	NA
WP_002228612.1|1503632_1504571_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|1504870_1505800_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|1506214_1506673_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|1507601_1508465_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|1508810_1509659_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|1509696_1510590_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002430091.1|1510821_1512843_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.3	6.0e-18
WP_002218278.1|1513207_1513804_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|1513861_1515334_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|1515356_1517060_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|1517288_1517747_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210775.1|1517981_1518692_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002210774.1|1518834_1519287_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210773.1|1519289_1519535_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210772.1|1519531_1520011_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210771.1|1520111_1521092_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210769.1|1521623_1522547_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210768.1|1522677_1522923_-	DNA-binding protein VF530	NA	NA	NA	NA	NA
WP_002210767.1|1523214_1525230_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210766.1|1526319_1527030_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002216554.1|1527181_1527904_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210764.1|1527896_1528700_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002210763.1|1528683_1529835_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210762.1|1529834_1530872_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210761.1|1530970_1532239_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210760.1|1532423_1533428_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210759.1|1533718_1534540_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210758.1|1534595_1535675_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210757.1|1535668_1536364_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210756.1|1536363_1537143_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002217291.1|1537377_1537530_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210754.1|1537846_1538638_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002210753.1|1538747_1540238_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|1540454_1541273_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210750.1|1541632_1542649_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210749.1|1542658_1543711_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210748.1|1543707_1544859_+	galactokinase	NA	NA	NA	NA	NA
WP_002216814.1|1544852_1545005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216812.1|1545025_1545922_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002210747.1|1546214_1546550_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002210746.1|1546896_1547649_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210745.1|1547830_1547956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|1548014_1549037_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 7
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	1737769	1813595	4556337	plate,protease,transposase,tRNA	Escherichia_phage(22.22%)	54	NA	NA
WP_002215902.1|1737769_1738420_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|1738870_1739266_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211662.1|1741541_1742042_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|1742084_1743629_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|1743640_1744993_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|1744989_1745676_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|1745675_1747412_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|1747415_1747907_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|1748324_1750973_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210012.1|1750969_1753318_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|1753332_1755555_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016590715.1|1755698_1756046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|1756209_1756404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|1757628_1758264_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|1758279_1760577_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|1760563_1761331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|1761426_1762123_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|1762731_1763367_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|1764695_1766858_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|1767413_1768373_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|1768418_1769918_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|1769950_1770934_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|1771016_1773050_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|1773153_1774254_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|1774553_1775630_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209994.1|1775812_1776085_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|1776262_1777378_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|1777715_1778435_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|1778434_1778761_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|1778871_1779798_+	glutaminase B	NA	NA	NA	NA	NA
WP_002224905.1|1781141_1790474_+	phage minor structural protein	NA	NA	NA	NA	NA
WP_002209987.1|1790663_1791794_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|1791786_1792380_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|1792479_1792770_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|1792766_1793321_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|1793608_1794430_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|1794562_1795261_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|1795280_1796405_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|1796513_1797629_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|1797632_1798517_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|1798696_1799119_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|1799118_1799682_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|1799797_1800757_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|1800782_1801514_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|1801765_1802473_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228059.1|1802570_1803083_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|1803275_1804430_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|1805636_1807616_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|1807775_1808096_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|1808129_1808240_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|1808385_1809138_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|1809628_1811623_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|1811930_1812389_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|1812572_1813595_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 8
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	2213116	2289087	4556337	transposase,plate	Escherichia_phage(33.33%)	57	NA	NA
WP_000255944.1|2213116_2214139_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2214138_2214918_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|2215179_2215566_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|2215860_2218575_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|2218652_2219186_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|2219214_2219739_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|2219905_2220826_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|2220925_2222077_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|2222149_2223406_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|2223432_2224260_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|2224261_2225182_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|2225174_2226650_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|2226787_2227858_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|2227854_2229057_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|2229056_2230373_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|2230375_2231458_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|2231451_2232828_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|2232824_2234312_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|2234298_2236062_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|2236127_2236445_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|2236441_2237404_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|2237406_2237865_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|2238419_2238509_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|2238966_2239407_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|2239537_2240548_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|2241052_2241511_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|2241709_2242234_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|2242206_2243934_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|2244393_2246199_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|2246730_2247687_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|2248364_2248580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|2249008_2249467_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|2249613_2251176_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|2251178_2252270_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|2252271_2253702_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|2253716_2254319_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|2254559_2254811_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|2254898_2255921_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2255920_2256700_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210461.1|2258363_2260025_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|2260964_2261957_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|2261932_2263540_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|2263526_2264237_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|2264305_2265073_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|2265268_2267638_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|2268098_2271005_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|2271260_2271614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214734.1|2271635_2275076_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002210469.1|2275137_2276748_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|2276744_2278100_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|2278219_2278711_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|2278703_2279069_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|2279074_2279692_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|2279684_2280788_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|2283045_2285394_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|2285497_2288086_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|2288103_2289087_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	3477530	3509530	4556337	plate,protease,transposase	Escherichia_phage(18.18%)	37	NA	NA
WP_002212105.1|3477530_3478877_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002212104.1|3478879_3479425_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212103.1|3479424_3480741_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002213885.1|3480866_3481955_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002228704.1|3481918_3482662_-	type VI secretion protein ImpG	NA	NA	NA	NA	NA
WP_001297096.1|3482985_3483765_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3483764_3484787_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210109.1|3485127_3485514_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|3485651_3486116_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|3486127_3487063_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|3487400_3487673_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|3487669_3488524_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|3488829_3489312_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|3489740_3491174_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|3491235_3491961_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|3491967_3492513_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|3492496_3493060_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|3493056_3493620_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|3493868_3494855_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|3494965_3495940_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|3496204_3497023_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|3497240_3498023_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|3498027_3498585_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|3498597_3499221_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|3499256_3499559_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|3499705_3499960_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|3500113_3501376_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|3501556_3502645_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213759.1|3502870_3503329_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|3503445_3504819_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|3505089_3505494_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|3505717_3506845_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|3507158_3507587_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|3507601_3507994_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|3507990_3508188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|3508367_3509009_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|3509014_3509530_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 10
NZ_CP009973	Yersinia pestis CO92 chromosome, complete genome	4556337	4137788	4206720	4556337	transposase,tRNA,plate	Escherichia_phage(38.46%)	60	NA	NA
WP_002213759.1|4137788_4138247_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|4138389_4138899_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|4138947_4140675_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|4140723_4140981_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|4141479_4142448_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|4142604_4143339_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|4143587_4144574_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|4144664_4146677_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|4146696_4146912_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|4147012_4147360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|4147491_4148097_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|4148810_4149269_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|4149461_4150877_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|4152110_4153295_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|4153729_4154959_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|4155051_4155366_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|4155635_4156625_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|4156760_4157639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|4157741_4158218_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|4158398_4159370_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|4159447_4160695_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|4160960_4162196_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|4162440_4162965_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|4163059_4163491_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|4164080_4164752_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|4164778_4165135_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|4165131_4165788_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|4166033_4166603_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|4166599_4167196_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|4167677_4168454_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|4168455_4169073_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|4169084_4171511_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|4172341_4173190_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|4173419_4173899_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|4174365_4174890_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|4174962_4176012_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|4176008_4177595_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|4177650_4178670_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|4178998_4180093_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|4181347_4181950_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|4182307_4182790_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|4182786_4184469_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002211587.1|4184469_4185153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|4185149_4186487_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|4186526_4187558_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|4187564_4188746_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|4188844_4189870_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|4189869_4191750_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|4192532_4195208_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|4195408_4195954_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|4196110_4196872_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|4196999_4198550_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|4198571_4199780_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|4199804_4200995_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|4200979_4201588_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|4201692_4202217_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|4202240_4203743_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|4204068_4204554_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|4204827_4205367_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|4205370_4206720_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP009972	Yersinia pestis CO92 plasmid unnamed, complete sequence	70305	0	18986	70305	transposase	Escherichia_phage(33.33%)	18	NA	NA
WP_154020274.1|503_740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|1605_1848_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|1840_2140_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|2279_2939_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|3132_3525_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_001297096.1|4649_5429_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|5428_6451_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213267.1|8239_8665_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|8812_9912_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|10011_10341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|10479_10944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|10962_11514_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|11677_13993_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|16604_16874_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|16942_17401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213244.1|17572_17890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213294.1|17913_18321_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002233137.1|18737_18986_+	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
>prophage 2
NZ_CP009972	Yersinia pestis CO92 plasmid unnamed, complete sequence	70305	68520	69687	70305		Yersinia_phage(100.0%)	1	NA	NA
WP_002220902.1|68520_69687_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
>prophage 1
NZ_CP009971	Yersinia pestis CO92 plasmid unnamed, complete sequence	96210	0	90918	96210	tail,transposase,integrase,terminase	Salmonella_phage(77.78%)	93	1734:1749	53578:53593
1734:1749	attL	AAACAATTTGTTTTCT	NA	NA	NA	NA
WP_002228800.1|1823_2036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|2298_2685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|2679_3783_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|4542_5055_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|5135_7637_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|7661_8438_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|8765_9671_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002209743.1|10019_11228_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|11696_12719_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|14794_16558_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|16635_17124_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|17863_18139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|18161_19103_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|19168_19789_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|19988_20315_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|20314_20542_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|20843_22049_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|22045_23017_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|23395_24793_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|24954_25155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|25655_26333_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|26332_26554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|26564_26984_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|27037_27817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|28215_28722_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|29434_29665_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|29737_31747_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|31870_32893_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|32892_33672_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_050551281.1|33732_34227_+	DNA polymerase III	NA	J9Q7Z2	Salmonella_phage	99.4	3.2e-90
WP_002425587.1|34241_34667_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002213141.1|34696_35260_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002215095.1|35332_35584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213135.1|35804_36236_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002213132.1|36355_37384_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002225551.1|37444_38389_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_000920226.1|38388_38655_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_161597819.1|38702_39734_+	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_002213439.1|39824_40025_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_002222866.1|40028_40859_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002222868.1|41012_41384_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222869.1|41367_41778_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002228797.1|41845_42121_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002228796.1|42161_42341_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002227818.1|42337_42673_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002222711.1|42672_42885_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002214164.1|43453_44518_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002214160.1|45262_45907_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002213298.1|46266_47289_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213300.1|47704_48790_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_038918515.1|50576_50936_+	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213303.1|50925_51672_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214145.1|51684_52254_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213759.1|52462_52921_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|53120_53402_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002211801.1|53607_54090_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
53578:53593	attR	AGAAAACAAATTGTTT	NA	NA	NA	NA
WP_002214137.1|54728_54956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|55040_55691_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|56012_56540_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|56544_56967_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|57026_57305_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211794.1|57307_58867_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002228791.1|58931_59630_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211792.1|59629_60298_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|60294_60933_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|60925_61180_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|61185_62076_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|62085_62352_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|62547_63189_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|63191_64448_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211786.1|64481_66056_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211785.1|66078_66912_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211784.1|66938_67814_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211783.1|67888_68551_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|68594_69029_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|69028_69862_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|69959_70304_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|70294_70768_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|70769_71153_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|71227_71974_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_000163862.1|72033_72351_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|72476_72701_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_002211776.1|72708_77286_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000440566.1|77327_77663_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211775.1|77752_78451_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_002211774.1|78443_79241_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|79228_79816_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002214118.1|79837_84469_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211771.1|84525_85104_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002211770.1|85184_88073_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|88374_88983_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_001297096.1|89116_89896_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|89895_90918_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NZ_CP009971	Yersinia pestis CO92 plasmid unnamed, complete sequence	96210	94225	95461	96210		Salmonella_phage(100.0%)	1	NA	NA
WP_002211767.1|94225_95461_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
