The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	1053322	1065282	3794983		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004246075.1|1053322_1054522_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|1055130_1056099_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|1056124_1058251_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1058279_1058684_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1058695_1058920_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1059201_1059675_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1059872_1060082_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|1060266_1060407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1061150_1061525_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1061540_1062506_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1062606_1063251_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1063608_1063872_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1064070_1065282_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	1771526	1781518	3794983		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|1771526_1773584_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004242886.1|1773595_1775296_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1775631_1776318_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1776317_1776779_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1776831_1777443_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|1777582_1778443_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|1778444_1779062_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1779073_1781518_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 3
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	2308472	2316233	3794983	holin,lysis	Enterobacteria_phage(33.33%)	9	NA	NA
WP_017628009.1|2308472_2310776_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2310858_2311317_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2311376_2311829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2311839_2313327_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|2313335_2313848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|2313884_2314334_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2314330_2314735_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2314737_2315037_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2315417_2316233_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 4
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	2787906	2805226	3794983	integrase	Morganella_phage(53.85%)	22	2783083:2783102	2803953:2803972
2783083:2783102	attL	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_053828371.1|2787906_2791140_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	40.5	6.9e-101
WP_036900256.1|2791156_2791498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072156938.1|2791497_2791671_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_053828372.1|2791851_2792361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053828373.1|2792435_2792888_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	57.4	1.5e-14
WP_053828374.1|2793345_2796066_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	65.4	0.0e+00
WP_036900269.1|2796062_2796407_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	2.8e-45
WP_053828375.1|2796421_2797018_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	1.1e-28
WP_036900272.1|2797017_2797212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837557.1|2797211_2797385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052174189.1|2797381_2797993_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036900274.1|2797989_2798199_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_053828376.1|2798195_2798375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053828377.1|2798371_2798629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843629.1|2798631_2798805_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_081000328.1|2798797_2799802_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.1	1.2e-67
WP_053828378.1|2799822_2800617_-	anti-repressor protein	NA	A0A0R6PJV6	Moraxella_phage	50.9	2.6e-25
WP_053828379.1|2800629_2801049_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.3	1.4e-38
WP_053828380.1|2801048_2801270_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.4	5.7e-07
WP_053828381.1|2801420_2802497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900290.1|2802708_2803920_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_017627899.1|2804353_2805226_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
2803953:2803972	attR	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 5
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	3076428	3085272	3794983		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3076428_3077997_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3078397_3079078_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3079174_3079750_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3079826_3080405_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3080472_3081498_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3081532_3081988_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|3082012_3083149_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3083149_3083734_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3084126_3085272_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 6
NZ_CP012675	Proteus mirabilis strain CYPV1 chromosome, complete genome	3794983	3589033	3637298	3794983	transposase	Escherichia_phage(25.0%)	39	NA	NA
WP_053828396.1|3589033_3589450_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_004249011.1|3590269_3590788_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|3590860_3593032_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017628613.1|3594301_3597346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628612.1|3597345_3598284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3598276_3598546_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|3598737_3599661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|3599750_3600428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249837.1|3600520_3602128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|3602141_3604637_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246670.1|3604659_3605343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3605432_3606056_-	fimbrillin MatB	NA	NA	NA	NA	NA
WP_017628609.1|3607559_3608594_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_001274561.1|3609136_3609982_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_060589331.1|3610066_3610354_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761716.1|3610283_3610772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|3610768_3611146_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|3611192_3611570_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3611732_3611954_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|3612016_3612493_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|3612508_3612982_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|3613323_3614142_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|3614296_3614455_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_053828397.1|3614525_3617372_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|3617744_3618617_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|3618715_3619588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164076301.1|3621002_3622215_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_001387788.1|3623488_3624091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|3624185_3624464_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|3626054_3626624_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|3626789_3627173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|3627169_3627595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3628074_3629688_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|3629718_3630069_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000981822.1|3630065_3630470_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	84.3	1.4e-30
WP_096043063.1|3630432_3631449_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000412211.1|3632568_3633228_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3633428_3633806_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067834.1|3636593_3637298_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
