The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	0	7255	5080321	protease	Morganella_phage(100.0%)	8	NA	NA
WP_003034964.1|1963_2845_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_048216186.1|2892_4266_-	MFS transporter	NA	NA	NA	NA	NA
WP_003833778.1|4440_5232_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_060682074.1|5346_5586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034977.1|5750_5894_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_003833774.1|5968_6253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034983.1|6889_7033_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|7045_7255_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 2
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	14753	16313	5080321		Moraxella_phage(100.0%)	1	NA	NA
WP_008785026.1|14753_16313_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 3
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	20181	27531	5080321	tRNA	Pandoravirus(25.0%)	7	NA	NA
WP_032943759.1|20181_21543_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.0	2.3e-42
WP_003020986.1|21626_21806_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|21812_22157_-	RidA family protein	NA	NA	NA	NA	NA
WP_060682078.1|22298_24209_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.5	3.1e-93
WP_060682079.1|24267_24963_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020975.1|25056_25641_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_123969683.1|25845_27531_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.6e-35
>prophage 4
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	54995	55757	5080321		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060682088.1|54995_55757_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.1	4.4e-14
>prophage 5
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	74185	74917	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_008784993.1|74185_74917_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	2.4e-54
>prophage 6
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	91483	92404	5080321		Moraxella_phage(100.0%)	1	NA	NA
WP_060682106.1|91483_92404_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	26.4	9.9e-29
>prophage 7
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	100039	105756	5080321		Klosneuvirus(33.33%)	4	NA	NA
WP_008784983.1|100039_101425_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.3e-27
WP_164091694.1|101431_102904_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_008784981.1|103001_104684_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.7	8.2e-21
WP_001518537.1|104808_105756_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 8
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	109006	113013	5080321		Pseudomonas_phage(50.0%)	5	NA	NA
WP_003020786.1|109006_110089_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
WP_057066746.1|110088_110922_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_032943708.1|110918_111311_+	SirB family protein	NA	NA	NA	NA	NA
WP_003020775.1|111313_112123_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020772.1|112158_113013_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 9
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	121657	122458	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_060682117.1|121657_122458_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.1e-30
>prophage 10
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	138933	149230	5080321		Escherichia_phage(25.0%)	10	NA	NA
WP_003833388.1|138933_140472_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
WP_008784959.1|140468_141179_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003833386.1|141178_141856_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_060682119.1|142858_143701_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	2.2e-14
WP_008784957.1|143756_144212_-	YchJ family protein	NA	NA	NA	NA	NA
WP_008784956.1|144323_145235_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_032943688.1|145325_146339_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020727.1|146543_147452_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020723.1|147588_148002_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_008784954.1|148612_149230_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	1.1e-52
>prophage 11
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	157769	160666	5080321		Planktothrix_phage(33.33%)	3	NA	NA
WP_060682120.1|157769_158783_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
WP_008784949.1|158779_159784_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_008784948.1|159829_160666_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
>prophage 12
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	169838	176311	5080321		Acinetobacter_phage(66.67%)	5	NA	NA
WP_060682123.1|169838_171311_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	4.8e-17
WP_008784942.1|171343_172150_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003020645.1|172149_173343_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_060683720.1|173353_174712_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.7e-37
WP_057067328.1|174715_176311_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 13
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	182411	186817	5080321	transposase,integrase	Mycobacterium_phage(25.0%)	5	179708:179723	194128:194143
179708:179723	attL	TCGACGCCTGTGAAGG	NA	NA	NA	NA
WP_060682128.1|182411_182885_+	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	38.5	1.1e-23
WP_160311308.1|183067_183244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682129.1|183249_183828_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	27.4	4.5e-11
WP_049014264.1|184575_185268_+	hypothetical protein	NA	A0A1B1IR97	uncultured_Mediterranean_phage	41.2	6.8e-14
WP_085950818.1|185696_186817_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
194128:194143	attR	TCGACGCCTGTGAAGG	NA	NA	NA	NA
>prophage 14
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	192101	201095	5080321	protease	Escherichia_phage(33.33%)	7	NA	NA
WP_049015510.1|192101_193952_+	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	28.1	2.1e-49
WP_003020625.1|194163_195039_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003833333.1|195122_195713_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_008784935.1|195709_196471_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	4.0e-07
WP_032934465.1|196692_197739_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_003020616.1|197847_198099_-	YciN family protein	NA	NA	NA	NA	NA
WP_003833325.1|198497_201095_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.0	1.3e-86
>prophage 15
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	205936	206527	5080321		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|205936_206527_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 16
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	214431	216366	5080321		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_060682134.1|214431_216366_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.3	7.7e-07
>prophage 17
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	219777	221578	5080321		Bacillus_virus(50.0%)	2	NA	NA
WP_003020558.1|219777_220584_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
WP_003020556.1|220585_221578_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 18
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	242471	243242	5080321		Escherichia_phage(100.0%)	1	NA	NA
WP_060682142.1|242471_243242_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	5.1e-18
>prophage 19
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	249653	254112	5080321		Autographa_californica_nuclear_polyhedrosis_virus(33.33%)	5	NA	NA
WP_060682146.1|249653_250469_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	72.7	5.0e-117
WP_003020397.1|250615_251368_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_008784895.1|251562_252078_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
WP_060682147.1|252303_252867_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_060682148.1|252879_254112_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	1.2e-16
>prophage 20
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	258074	263549	5080321	tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	6	NA	NA
WP_008784890.1|258074_259448_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.3e-52
WP_032943567.1|259526_260462_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
WP_032943565.1|261094_261337_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003833207.1|261523_261958_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_003833205.1|262039_262252_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_060682149.1|262397_263549_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	9.6e-114
>prophage 21
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	268525	269515	5080321		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003833196.1|268525_269515_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	2.5e-70
>prophage 22
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	274459	278362	5080321		Klosneuvirus(100.0%)	1	NA	NA
WP_060682154.1|274459_278362_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
>prophage 23
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	283163	286647	5080321		Escherichia_phage(33.33%)	4	NA	NA
WP_008784870.1|283163_283694_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.0	4.5e-18
WP_060682159.1|283769_284696_-	DMT family transporter	NA	NA	NA	NA	NA
WP_060682160.1|284956_285376_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	1.4e-33
WP_060682161.1|285378_286647_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.6	4.5e-197
>prophage 24
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	289685	292662	5080321		Synechococcus_phage(50.0%)	2	NA	NA
WP_008784862.1|289685_290804_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
WP_032943540.1|290973_292662_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	2.1e-16
>prophage 25
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	307905	309867	5080321		Phage_TP(100.0%)	1	NA	NA
WP_060682171.1|307905_309867_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.1	4.1e-24
>prophage 26
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	316038	317055	5080321		Mycoplasma_phage(100.0%)	1	NA	NA
WP_048235324.1|316038_317055_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 27
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	334405	336526	5080321		Salmonella_phage(100.0%)	1	NA	NA
WP_060682181.1|334405_336526_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	2.5e-139
>prophage 28
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	339969	341511	5080321		Salmonella_phage(100.0%)	1	NA	NA
WP_048235339.1|339969_341511_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.3	4.8e-36
>prophage 29
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	347867	348641	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_008784819.1|347867_348641_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	6.0e-19
>prophage 30
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	355688	357665	5080321		Tetraselmis_virus(100.0%)	1	NA	NA
WP_008784811.1|355688_357665_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	2.1e-161
>prophage 31
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	361877	363422	5080321		Escherichia_phage(100.0%)	1	NA	NA
WP_008784807.1|361877_363422_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 32
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	371561	372644	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_008784801.1|371561_372644_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	73.0	6.0e-150
>prophage 33
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	378997	382138	5080321		Escherichia_phage(50.0%)	4	NA	NA
WP_060682194.1|378997_379600_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
WP_003833018.1|379639_379924_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	48.9	4.4e-20
WP_060683726.1|379923_380202_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	59.8	4.0e-26
WP_060682195.1|380422_382138_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.3	3.7e-37
>prophage 34
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	391969	393884	5080321		Planktothrix_phage(100.0%)	2	NA	NA
WP_060682197.1|391969_392905_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
WP_060682198.1|392897_393884_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	1.6e-16
>prophage 35
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	399773	401717	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060682201.1|399773_401717_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.9	6.6e-06
>prophage 36
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	407174	408914	5080321		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060682205.1|407174_408914_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 37
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	422076	423102	5080321		Ralstonia_phage(100.0%)	1	NA	NA
WP_001536106.1|422076_423102_-	phage zona occludens toxin	NA	A0A097ZIG6	Ralstonia_phage	27.5	7.2e-12
>prophage 38
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	445066	446644	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060682220.1|445066_446644_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	22.8	3.8e-12
>prophage 39
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	451952	456447	5080321		Streptococcus_phage(33.33%)	6	NA	NA
WP_003032424.1|451952_452336_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
WP_008784747.1|452366_452585_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_032943417.1|452615_453515_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_060682224.1|453713_454901_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_060682225.1|454941_455640_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.4e-13
WP_060682226.1|455649_456447_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	27.0	1.2e-11
>prophage 40
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	467402	487356	5080321	transposase,integrase	Escherichia_phage(45.45%)	20	NA	NA
WP_003032393.1|467402_467606_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_060682229.1|467680_469147_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.9	1.9e-45
WP_051642672.1|469307_470642_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003832907.1|470702_471917_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	7.4e-48
WP_008784733.1|472024_472351_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.9	9.9e-24
WP_008784732.1|472504_472846_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_008784731.1|472881_473442_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_008784730.1|473448_474195_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_008784729.1|474261_474570_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_081003596.1|474718_476188_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	7.2e-122
WP_060682230.1|476845_477835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682231.1|477899_478391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682233.1|478703_479405_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	42.1	3.4e-13
WP_103255452.1|480397_481566_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	3.6e-177
WP_123969691.1|481534_482077_-	HNH endonuclease	NA	A0A1I9SEA5	Escherichia_phage	42.2	8.4e-28
WP_164091697.1|482530_484123_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081003597.1|484105_485215_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.6	3.4e-84
WP_008784727.1|485225_485843_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	8.6e-77
WP_048235411.1|485844_486699_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_060682236.1|486741_487356_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	2.0e-25
>prophage 41
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	494015	496225	5080321		Bacillus_phage(100.0%)	2	NA	NA
WP_060682238.1|494015_495506_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	2.4e-24
WP_008784719.1|495502_496225_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.5e-35
>prophage 42
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	503403	505714	5080321		Salmonella_phage(50.0%)	2	NA	NA
WP_060682242.1|503403_504600_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.8	1.4e-22
WP_032943372.1|504862_505714_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.0	3.4e-47
>prophage 43
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	518123	519425	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_060682245.1|518123_519425_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.6	1.8e-15
>prophage 44
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	545353	546628	5080321	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_020996426.1|545353_546628_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	2.2e-87
>prophage 45
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	553545	554070	5080321		Salmonella_phage(100.0%)	1	NA	NA
WP_060682257.1|553545_554070_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.6	2.7e-47
>prophage 46
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	559173	570212	5080321		Orpheovirus(33.33%)	11	NA	NA
WP_008784666.1|559173_560004_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
WP_003029205.1|560131_560713_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_008784665.1|560752_561922_-	MFS transporter	NA	NA	NA	NA	NA
WP_003029209.1|562097_562187_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003832757.1|562484_563510_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	4.8e-32
WP_003029215.1|563506_564439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032943314.1|564551_565757_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_008784662.1|566047_567196_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2I2L5L3	Orpheovirus	44.8	3.3e-82
WP_003832752.1|567237_567885_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_060682260.1|568102_569476_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_057067234.1|569513_570212_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.1e-08
>prophage 47
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	579922	581707	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_060682265.1|579922_581707_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	6.2e-19
>prophage 48
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	597054	597537	5080321		Turkeypox_virus(100.0%)	1	NA	NA
WP_060682273.1|597054_597537_+	glutathione peroxidase	NA	A0A0M5HSM9	Turkeypox_virus	41.8	1.4e-18
>prophage 49
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	613333	617880	5080321		Indivirus(33.33%)	6	NA	NA
WP_060682279.1|613333_614152_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	6.1e-14
WP_057067614.1|614151_614937_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060682280.1|614926_615604_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060682281.1|615613_616426_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	33.3	8.8e-05
WP_048235471.1|616429_617215_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_020996435.1|617211_617880_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	41.0	1.7e-25
>prophage 50
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	624768	632214	5080321		Escherichia_phage(66.67%)	6	NA	NA
WP_095533099.1|624768_625521_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.7e-23
WP_001016644.1|625521_626544_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_060682284.1|626536_629602_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.4	5.5e-07
WP_003029358.1|629696_630509_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048214308.1|630530_631199_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060682285.1|631191_632214_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	3.8e-13
>prophage 51
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	636375	641466	5080321		environmental_halophage(33.33%)	5	NA	NA
WP_008784609.1|636375_637596_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.4	5.1e-97
WP_060682287.1|637592_638864_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003832649.1|638838_639585_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	7.8e-08
WP_020996440.1|639601_641089_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003832645.1|641097_641466_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	9.5e-15
>prophage 52
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	661962	668381	5080321		Staphylococcus_phage(33.33%)	4	NA	NA
WP_060682297.1|661962_663600_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	1.1e-30
WP_003832604.1|663667_666046_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	8.8e-170
WP_003832602.1|666374_667208_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_003030555.1|667334_668381_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 53
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	673678	688013	5080321	tRNA	Brazilian_cedratvirus(22.22%)	14	NA	NA
WP_060682301.1|673678_674458_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.0e-10
WP_060682302.1|674454_675897_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	1.3e-51
WP_003832591.1|677767_678232_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_060682303.1|678309_679059_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003832585.1|679058_679610_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|679670_680651_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|680772_681072_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032943162.1|681076_683464_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|683479_684463_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|684662_684707_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|684832_685189_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|685244_685442_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|685538_686081_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|686084_688013_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 54
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	692463	699035	5080321		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
WP_032943160.1|692463_693132_+	hexitol phosphatase HxpB	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.7	1.2e-07
WP_032943158.1|693285_694047_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
WP_008784570.1|694130_694730_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	3.5e-06
WP_006684833.1|694865_696257_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_081003599.1|696320_696575_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_060682306.1|696776_699035_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.2	2.8e-141
>prophage 55
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	705194	706025	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_008784562.1|705194_706025_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.6e-73
>prophage 56
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	713571	714792	5080321		Klosneuvirus(100.0%)	1	NA	NA
WP_048214345.1|713571_714792_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	1.1e-27
>prophage 57
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	720339	720972	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_060682314.1|720339_720972_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.3	6.9e-13
>prophage 58
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	726051	727998	5080321		Streptococcus_phage(100.0%)	1	NA	NA
WP_060682317.1|726051_727998_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 59
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	735007	739066	5080321		Tupanvirus(50.0%)	3	NA	NA
WP_164091698.1|735007_735652_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	6.7e-16
WP_032943120.1|737187_737946_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_060682321.1|738082_739066_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	26.0	3.3e-06
>prophage 60
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	744728	745982	5080321		Tupanvirus(100.0%)	1	NA	NA
WP_060682324.1|744728_745982_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.5	4.1e-25
>prophage 61
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	755235	759039	5080321		Bacillus_phage(100.0%)	3	NA	NA
WP_008784519.1|755235_756519_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	27.0	8.5e-10
WP_008784518.1|756613_757384_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_008784517.1|757548_759039_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.4	6.2e-12
>prophage 62
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	763974	765000	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_060682330.1|763974_765000_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	4.7e-11
>prophage 63
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	783020	784271	5080321		Phage_21(100.0%)	1	NA	NA
WP_003841892.1|783020_784271_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
>prophage 64
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	788381	789752	5080321		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_060682339.1|788381_789752_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	7.9e-107
>prophage 65
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	794874	802839	5080321		Mycoplasma_phage(50.0%)	9	NA	NA
WP_003832287.1|794874_796011_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
WP_008784439.1|795994_796852_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_006684943.1|796848_797628_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_003030797.1|797655_798702_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_060682341.1|798839_799034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003832281.1|799055_799877_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.9e-23
WP_060682342.1|799892_800804_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_060682343.1|800893_802138_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003832278.1|802137_802839_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.4e-35
>prophage 66
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	810123	810381	5080321		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|810123_810381_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 67
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	829991	831062	5080321		Synechococcus_phage(100.0%)	1	NA	NA
WP_060682358.1|829991_831062_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	38.1	1.6e-09
>prophage 68
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	851269	852121	5080321		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060682367.1|851269_852121_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.4	1.8e-48
>prophage 69
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	855125	855377	5080321		Erwinia_phage(100.0%)	1	NA	NA
WP_060682370.1|855125_855377_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	55.8	5.8e-08
>prophage 70
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	866110	867835	5080321		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_060682378.1|866110_867067_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	6.9e-17
WP_060682379.1|867067_867835_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	3.2e-12
>prophage 71
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	873767	879902	5080321		Acinetobacter_phage(33.33%)	5	NA	NA
WP_060682381.1|873767_875546_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.4	2.6e-81
WP_003836725.1|875601_877035_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_060682382.1|877451_878249_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_060682383.1|878259_879264_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.0	6.8e-07
WP_060682384.1|879260_879902_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 72
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	883188	884314	5080321		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|883188_883425_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_003036255.1|883579_884314_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 73
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	898928	899879	5080321		Brevibacillus_phage(100.0%)	1	NA	NA
WP_016152632.1|898928_899879_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 74
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	915156	915402	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|915156_915402_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 75
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	920120	923813	5080321		Morganella_phage(50.0%)	3	NA	NA
WP_003036136.1|920120_921041_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
WP_032942948.1|921196_922417_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_060683737.1|922481_923813_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	1.0e-18
>prophage 76
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	932117	932660	5080321		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003832103.1|932117_932660_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.9	4.2e-27
>prophage 77
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	936848	942156	5080321		Pelagibacter_phage(33.33%)	6	NA	NA
WP_008784335.1|936848_937682_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.9e-40
WP_032934412.1|937728_938211_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003832084.1|938312_938867_-	molecular chaperone	NA	NA	NA	NA	NA
WP_008784332.1|938890_939628_-	phosphatase	NA	NA	NA	NA	NA
WP_060682393.1|939836_940775_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.0	9.9e-08
WP_100247251.1|941241_942156_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	70.8	3.1e-91
>prophage 78
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	954191	954365	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|954191_954365_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 79
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	963738	964659	5080321		Klosneuvirus(100.0%)	1	NA	NA
WP_003832035.1|963738_964659_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	4.6e-10
>prophage 80
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	983511	984246	5080321		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032667108.1|983511_984246_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	45.7	1.7e-26
>prophage 81
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	987833	1034866	5080321	plate,tail,integrase,terminase,protease	Escherichia_phage(41.03%)	54	989394:989453	1032077:1032137
WP_016243656.1|987833_988046_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	40.6	5.8e-09
989394:989453	attL	TTGGCGGAAGCGTAGAGATTCGAACTCTAGAACCCTTTCGGGTCGCCGGTTTTCAAGACC	NA	NA	NA	NA
WP_016152556.1|989643_989907_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	81.2	2.0e-30
WP_060682416.1|989903_990470_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	90.7	6.2e-90
WP_060682417.1|990545_990956_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	41.2	2.5e-08
WP_060682419.1|992087_992882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682420.1|992919_993624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682421.1|993625_995044_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	2.1e-54
WP_003833581.1|995040_995373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682422.1|995369_996086_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	31.2	1.4e-22
WP_060682423.1|996082_997123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682424.1|997122_997398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682425.1|997394_998105_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.4	3.7e-31
WP_060682426.1|998104_999931_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	1.9e-18
WP_060682427.1|1000054_1000666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013027.1|1000668_1001106_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.2e-24
WP_060682428.1|1001107_1002502_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.5	3.1e-66
WP_057064605.1|1002506_1003448_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	36.4	3.2e-51
WP_060682429.1|1003431_1003866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682430.1|1003862_1004291_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.9	2.1e-21
WP_060682431.1|1004287_1004770_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	36.1	3.2e-10
WP_016152537.1|1004838_1005870_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	2.1e-75
WP_060682432.1|1005886_1006747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682433.1|1008420_1009242_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	40.8	1.3e-51
WP_060682434.1|1009238_1010660_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.1	1.7e-88
WP_060682435.1|1010671_1011943_-	hypothetical protein	NA	H9YPE5	environmental_Halophage	29.6	2.1e-13
WP_060682436.1|1011932_1012904_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	32.8	1.7e-23
WP_164091691.1|1012965_1013364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682437.1|1014141_1014672_-	DUF2514 domain-containing protein	NA	A0A193GYI0	Enterobacter_phage	37.3	2.9e-17
WP_060682438.1|1014668_1015208_-	lysozyme	NA	H6WRZ4	Salmonella_phage	92.1	8.0e-95
WP_016152527.1|1015210_1015525_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	99.0	2.4e-51
WP_060682439.1|1016048_1016627_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	2.6e-43
WP_057064592.1|1016623_1016917_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	64.2	3.6e-33
WP_045441382.1|1016913_1017510_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	74.7	1.7e-82
WP_060682440.1|1017958_1018297_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	3.2e-49
WP_060682441.1|1018296_1019724_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	45.7	2.9e-152
WP_060682443.1|1020471_1021074_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	86.2	1.2e-94
WP_060682444.1|1021066_1021315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682445.1|1021318_1021999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682446.1|1022037_1023426_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-108
WP_060682447.1|1023422_1024475_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	38.9	9.9e-33
WP_060682448.1|1024480_1024705_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	6.2e-09
WP_016152513.1|1024727_1025174_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
WP_000364674.1|1025238_1025472_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_045449542.1|1025580_1026036_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	3.5e-35
WP_123969706.1|1026179_1026392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682449.1|1026893_1027217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045441368.1|1027224_1027470_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	2.4e-14
WP_060682450.1|1027500_1029774_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	9.1e-108
WP_060682451.1|1029773_1030328_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	4.7e-50
WP_016152506.1|1030330_1030513_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
WP_001648801.1|1030725_1030950_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_060682452.1|1030950_1031970_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.8	3.7e-93
WP_060682453.1|1032307_1033936_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1032077:1032137	attR	TTGGCGGAAGCGTAGAGATTCGAACTCTAGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_060682454.1|1034206_1034866_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.4	5.8e-47
>prophage 82
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1039122	1041177	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_060682457.1|1039122_1041177_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	4.5e-21
>prophage 83
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1053723	1055631	5080321		Tupanvirus(100.0%)	1	NA	NA
WP_008784281.1|1053723_1055631_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	6.0e-52
>prophage 84
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1064398	1070911	5080321	tRNA	Bacillus_virus(33.33%)	4	NA	NA
WP_060682462.1|1064398_1065166_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.4e-30
WP_060682463.1|1065262_1067875_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.4e-19
WP_060682464.1|1068141_1069344_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020996514.1|1069510_1070911_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
>prophage 85
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1074687	1075236	5080321		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003831948.1|1074687_1075236_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 86
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1090693	1095234	5080321		Bacillus_phage(100.0%)	3	NA	NA
WP_060682470.1|1090693_1092442_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.1	4.9e-61
WP_060682471.1|1092478_1094743_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|1094949_1095234_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 87
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1099388	1100477	5080321		Streptococcus_phage(100.0%)	1	NA	NA
WP_032942886.1|1099388_1100477_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	3.5e-81
>prophage 88
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1104600	1107934	5080321		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035753.1|1104600_1106883_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_003035751.1|1107193_1107934_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 89
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1113640	1130221	5080321	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_003831905.1|1113640_1114258_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.2e-75
WP_060682477.1|1114268_1116713_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	3.9e-221
WP_003831902.1|1116949_1118242_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	4.3e-94
WP_003836910.1|1118334_1119678_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
WP_003831898.1|1119688_1120300_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_060682478.1|1120411_1124473_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|1124607_1125102_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_060682479.1|1125649_1126618_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	2.5e-62
WP_060682480.1|1126732_1128499_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.3	3.5e-22
WP_060682481.1|1128499_1130221_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-15
>prophage 90
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1134514	1143815	5080321		Streptococcus_phage(25.0%)	11	NA	NA
WP_060682483.1|1134514_1135642_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	7.1e-29
WP_003035378.1|1135683_1136172_-	YbjO family protein	NA	NA	NA	NA	NA
WP_008784246.1|1136231_1137077_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003831667.1|1137073_1138027_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_008784245.1|1138036_1139170_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_003831664.1|1139308_1140421_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003831662.1|1140854_1141331_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003831660.1|1141421_1142324_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	4.4e-37
WP_008784243.1|1142383_1143106_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_008784242.1|1143089_1143380_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_003035358.1|1143551_1143815_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
>prophage 91
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1152718	1154725	5080321		Escherichia_phage(50.0%)	2	NA	NA
WP_060682488.1|1152718_1153477_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.3	2.0e-14
WP_032944358.1|1153522_1154725_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.2e-97
>prophage 92
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1158447	1160898	5080321		Dickeya_phage(100.0%)	1	NA	NA
WP_060682492.1|1158447_1160898_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	74.6	1.3e-22
>prophage 93
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1166214	1168086	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_032941808.1|1166214_1168086_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	2.8e-14
>prophage 94
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1172262	1180567	5080321		Synechococcus_phage(33.33%)	6	NA	NA
WP_003836983.1|1172262_1172925_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.2e-22
WP_008784219.1|1173057_1173957_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_048235769.1|1173962_1176395_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_060682497.1|1176665_1177481_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_060682498.1|1177633_1178896_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_060682499.1|1178974_1180567_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
>prophage 95
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1185705	1190955	5080321		Enterobacteria_phage(33.33%)	6	NA	NA
WP_048214619.1|1185705_1186221_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	2.4e-16
WP_060682502.1|1186632_1187520_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035253.1|1187823_1188327_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
WP_003035251.1|1188692_1189439_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035248.1|1189576_1190236_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003035246.1|1190232_1190955_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 96
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1197324	1208462	5080321		Synechococcus_phage(20.0%)	10	NA	NA
WP_032942776.1|1197324_1198002_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	1.3e-17
WP_032942775.1|1198077_1198344_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	52.3	2.1e-16
WP_003831561.1|1198644_1198905_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_060682504.1|1199002_1200088_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_048226020.1|1200250_1201219_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_060682505.1|1201248_1203399_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	1.8e-41
WP_060682506.1|1203495_1204842_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
WP_003831550.1|1205063_1205741_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_008784196.1|1205737_1206733_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_060682507.1|1206725_1208462_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	5.1e-18
>prophage 97
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1218256	1222856	5080321		Streptococcus_phage(50.0%)	3	NA	NA
WP_060682511.1|1218256_1219165_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	4.6e-26
WP_008784186.1|1219343_1221365_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_008784184.1|1222133_1222856_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	2.4e-09
>prophage 98
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1226444	1229962	5080321		Klosneuvirus(50.0%)	3	NA	NA
WP_164091715.1|1226444_1227812_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.5e-20
WP_008784178.1|1227869_1228346_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_032942757.1|1228441_1229962_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	2.2e-81
>prophage 99
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1235335	1278195	5080321	plate,capsid,portal,head,tail,integrase	Enterobacteria_phage(43.9%)	63	1234921:1234943	1278264:1278286
1234921:1234943	attL	TCAACTTAGTATAAAAAAGCAGG	NA	NA	NA	NA
WP_060682518.1|1235335_1235755_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	40.3	1.7e-07
WP_060682520.1|1236606_1237200_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_060682521.1|1237196_1238339_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.3	6.2e-12
WP_001279799.1|1238340_1238778_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_060682522.1|1238774_1239359_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	6.3e-05
WP_001515585.1|1239355_1240441_-	hypothetical protein	NA	M1PVV2	Vibrio_phage	31.5	7.6e-44
WP_001139208.1|1240437_1241841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682523.1|1242184_1244044_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	40.9	5.5e-18
WP_000807719.1|1244185_1244464_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896638.1|1244465_1244837_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_060682524.1|1244840_1246343_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.4	7.1e-101
WP_060682525.1|1246339_1246537_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001083242.1|1246540_1247086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537794.1|1247082_1247442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682526.1|1247446_1247857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427679.1|1247828_1248878_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
WP_001472189.1|1248975_1249380_-|head	head decoration protein	head	NA	NA	NA	NA
WP_060682527.1|1249379_1249970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052909.1|1249971_1250838_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_060682528.1|1250834_1252472_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	5.6e-91
WP_000483309.1|1252471_1252735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515591.1|1252743_1254867_-	hypothetical protein	NA	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
WP_000210383.1|1254808_1255378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682529.1|1255668_1256172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682530.1|1256182_1256821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548472.1|1256880_1257174_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.1	1.1e-21
WP_001548471.1|1257204_1257747_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	90.4	1.6e-71
WP_061350480.1|1257746_1258313_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	100.0	1.9e-107
WP_016150496.1|1258290_1258569_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_060683741.1|1258817_1259228_+	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_060682531.1|1259424_1260234_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.6	5.3e-111
WP_001664172.1|1260230_1260371_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.5	1.0e-17
WP_060682532.1|1260367_1260730_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	2.8e-51
WP_060682533.1|1260726_1261017_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.6	1.8e-45
WP_060682534.1|1261179_1261635_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	74.2	2.6e-62
WP_071845202.1|1261834_1262557_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	70.1	5.8e-24
WP_044701701.1|1262553_1262790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682535.1|1262791_1263226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682536.1|1263345_1263606_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	50.6	4.6e-16
WP_060682537.1|1263602_1263902_-	hypothetical protein	NA	E7EKU6	Edwardsiella_phage	40.9	4.4e-10
WP_060682538.1|1263907_1265782_-	AAA family ATPase	NA	A0A0M4R313	Salmonella_phage	79.3	5.4e-308
WP_060682539.1|1265896_1266760_-	replication protein	NA	K7PL20	Enterobacteria_phage	73.5	5.5e-114
WP_123969710.1|1266752_1266899_-	DUF2740 family protein	NA	NA	NA	NA	NA
WP_060682540.1|1266931_1267231_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	65.6	6.7e-27
WP_060682541.1|1267339_1267558_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	84.9	2.4e-26
WP_060682542.1|1267677_1268388_+	helix-turn-helix domain-containing protein	NA	K7P7I4	Enterobacteria_phage	81.6	6.3e-108
WP_060683742.1|1268700_1268928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682543.1|1269735_1269966_+	hypothetical protein	NA	A0A077KC43	Edwardsiella_phage	43.2	1.6e-07
WP_164091700.1|1269986_1270148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682544.1|1270193_1270418_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_060682545.1|1270572_1270773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682546.1|1270772_1270970_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_060682547.1|1271046_1271799_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	67.4	1.6e-24
WP_060682548.1|1271807_1272092_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	89.4	3.4e-44
WP_060682549.1|1272101_1273019_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	94.1	5.2e-163
WP_060682550.1|1273015_1273696_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	93.4	1.6e-124
WP_023216154.1|1274153_1274705_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	1.8e-57
WP_060682551.1|1274802_1275075_+	DUF5405 family protein	NA	K7P7M4	Enterobacteria_phage	62.2	5.5e-20
WP_060682552.1|1275071_1275293_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	3.7e-14
WP_060682553.1|1275292_1276366_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	70.5	1.7e-149
WP_032667235.1|1276564_1276807_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	96.2	2.9e-36
WP_060682554.1|1276928_1277147_+	excisionase	NA	Q77WA4	Escherichia_phage	77.5	4.1e-26
WP_060682555.1|1277124_1278195_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	75.3	1.7e-152
1278264:1278286	attR	TCAACTTAGTATAAAAAAGCAGG	NA	NA	NA	NA
>prophage 100
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1281667	1288217	5080321		Planktothrix_phage(33.33%)	7	NA	NA
WP_048235822.1|1281667_1282726_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.0e-20
WP_008784169.1|1282728_1283418_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003831470.1|1283417_1284191_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020996536.1|1284375_1284525_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_003831465.1|1284654_1285443_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_057066494.1|1285510_1286983_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.9	3.0e-11
WP_003831462.1|1287200_1288217_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	9.8e-78
>prophage 101
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1292552	1296068	5080321		Pandoravirus(33.33%)	4	NA	NA
WP_003831449.1|1292552_1293605_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.3e-80
WP_003022994.1|1293922_1294297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784162.1|1294410_1295352_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.7	4.9e-23
WP_003831446.1|1295348_1296068_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
>prophage 102
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1323771	1326830	5080321		Escherichia_phage(66.67%)	4	NA	NA
WP_008784146.1|1323771_1324416_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.1	1.3e-56
WP_020996541.1|1324425_1325232_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.4	2.4e-47
WP_020996542.1|1325212_1325989_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_060682562.1|1326017_1326830_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	26.6	5.3e-18
>prophage 103
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1342243	1343035	5080321		Kaumoebavirus(100.0%)	1	NA	NA
WP_060682568.1|1342243_1343035_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.9	2.9e-08
>prophage 104
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1348828	1357862	5080321	transposase	Acinetobacter_phage(25.0%)	8	NA	NA
WP_008784127.1|1348828_1350310_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.3	2.3e-43
WP_020996544.1|1350356_1351259_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	3.4e-66
WP_057067721.1|1351420_1352839_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.5	9.5e-63
WP_123969713.1|1352857_1353412_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003022870.1|1353509_1353716_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001670793.1|1354024_1354114_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_060682569.1|1354113_1355793_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_060682570.1|1355813_1357862_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	1.6e-31
>prophage 105
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1361128	1378016	5080321	tRNA	Bacillus_phage(16.67%)	16	NA	NA
WP_048226088.1|1361128_1361806_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	1.2e-26
WP_008784117.1|1361893_1363534_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_048214679.1|1363558_1364101_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_060683746.1|1364295_1365069_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	33.0	6.4e-05
WP_003831362.1|1365197_1365485_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_006685496.1|1365595_1366171_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_100247215.1|1366381_1366468_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_003022836.1|1366460_1366907_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_060682571.1|1367034_1367961_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_060682572.1|1368058_1369462_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.1	1.7e-08
WP_060682573.1|1369448_1370588_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_060682574.1|1370641_1371937_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.7	2.2e-58
WP_008784106.1|1371987_1372320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008784105.1|1372369_1373776_-	chitoporin	NA	NA	NA	NA	NA
WP_048226099.1|1374211_1375879_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.8	0.0e+00
WP_060682575.1|1376066_1378016_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
>prophage 106
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1382768	1384433	5080321		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_008784099.1|1382768_1384433_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	4.7e-85
>prophage 107
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1388161	1389247	5080321		Pseudomonas_phage(100.0%)	1	NA	NA
WP_008784096.1|1388161_1389247_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 108
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1395175	1395901	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_003022754.1|1395175_1395901_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
>prophage 109
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1408524	1410988	5080321		Synechococcus_phage(50.0%)	2	NA	NA
WP_032942683.1|1408524_1409634_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	8.1e-09
WP_003022711.1|1409776_1410988_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
>prophage 110
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1414594	1415240	5080321		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003831281.1|1414594_1414978_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	3.4e-23
WP_000034825.1|1415030_1415240_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 111
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1429075	1437206	5080321		Escherichia_phage(50.0%)	8	NA	NA
WP_048235896.1|1429075_1429906_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
WP_003831264.1|1430181_1430592_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|1430775_1431204_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_060682587.1|1431273_1432041_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_060682588.1|1432040_1432541_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	43.0	1.2e-20
WP_060682589.1|1432595_1434866_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.6	1.5e-46
WP_008784072.1|1434862_1435417_-	dehydrogenase	NA	A0A077SLS7	Escherichia_phage	29.0	7.6e-08
WP_020996553.1|1435640_1437206_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 112
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1440316	1442142	5080321		Streptococcus_phage(50.0%)	2	NA	NA
WP_060682592.1|1440316_1441540_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	5.9e-61
WP_032942666.1|1441524_1442142_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.8	3.9e-53
>prophage 113
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1447487	1451897	5080321		Escherichia_phage(100.0%)	1	NA	NA
WP_060682595.1|1447487_1451897_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	26.5	1.8e-27
>prophage 114
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1459344	1467435	5080321		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_003831192.1|1459344_1460352_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	3.8e-13
WP_008784056.1|1460348_1461341_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_060682601.1|1461337_1462135_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	3.8e-08
WP_060682602.1|1462181_1463315_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_060682603.1|1463544_1467435_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.7	9.0e-63
>prophage 115
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1478780	1480325	5080321		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_008784047.1|1478780_1480325_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	5.2e-14
>prophage 116
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1490124	1491105	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003831159.1|1490124_1491105_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.4e-25
>prophage 117
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1502196	1504321	5080321		Bacillus_phage(50.0%)	2	NA	NA
WP_060682619.1|1502196_1502880_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	1.8e-30
WP_060682620.1|1502869_1504321_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	1.9e-10
>prophage 118
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1510691	1520171	5080321		Morganella_phage(25.0%)	7	NA	NA
WP_003831130.1|1510691_1511120_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	4.3e-27
WP_060682624.1|1511175_1511790_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_060682625.1|1511786_1514327_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	2.1e-73
WP_003831126.1|1514316_1515495_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_020996565.1|1515626_1516319_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	29.3	5.7e-21
WP_032942593.1|1516291_1517323_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_071845205.1|1517405_1520171_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	4.8e-34
>prophage 119
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1530932	1534126	5080321	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_003831112.1|1530932_1531799_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	9.4e-29
WP_003831111.1|1531800_1532013_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_060682627.1|1532138_1532663_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_060682628.1|1532740_1534126_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 120
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1539165	1540182	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_032942581.1|1539165_1540182_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	39.1	2.3e-34
>prophage 121
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1545067	1545754	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_008783992.1|1545067_1545754_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.0e-30
>prophage 122
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1549056	1549734	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_060682634.1|1549056_1549734_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	3.1e-27
>prophage 123
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1561283	1564703	5080321		Pithovirus(50.0%)	2	NA	NA
WP_048235959.1|1561283_1562054_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	6.8e-15
WP_060682640.1|1562201_1564703_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.3	3.8e-115
>prophage 124
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1575805	1584431	5080321		Acanthamoeba_polyphaga_mimivirus(25.0%)	8	NA	NA
WP_060682644.1|1575805_1576765_+	acetyl esterase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	28.3	5.9e-16
WP_003831052.1|1576761_1577724_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003021773.1|1577887_1578532_-	adenylate kinase	NA	NA	NA	NA	NA
WP_060682645.1|1578763_1580638_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	9.2e-114
WP_003831050.1|1580748_1581354_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021764.1|1581353_1581683_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_060682646.1|1581740_1583669_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.9	1.3e-43
WP_003021759.1|1583879_1584431_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
>prophage 125
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1591352	1594502	5080321		Leptospira_phage(100.0%)	1	NA	NA
WP_008783964.1|1591352_1594502_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.8e-53
>prophage 126
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1606692	1610236	5080321		Bacillus_phage(100.0%)	2	NA	NA
WP_060682651.1|1606692_1608471_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	4.9e-40
WP_060682652.1|1608463_1610236_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	7.0e-47
>prophage 127
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1614689	1615385	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_043015404.1|1614689_1615385_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 128
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1618659	1623704	5080321	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_003021629.1|1618659_1618932_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
WP_003831014.1|1619140_1621495_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.2e-224
WP_003831013.1|1621679_1622954_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021624.1|1623080_1623704_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 129
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1646431	1656041	5080321	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021575.1|1646431_1646902_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
WP_008783929.1|1646992_1648096_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.9e-52
WP_003021571.1|1648099_1648549_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_020996578.1|1648702_1649242_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021561.1|1649540_1650404_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_057067578.1|1650449_1651142_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	5.9e-18
WP_008783926.1|1651165_1651531_-	VOC family protein	NA	NA	NA	NA	NA
WP_003021550.1|1651701_1652673_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_003021547.1|1652683_1654531_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021544.1|1654558_1654891_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003021535.1|1654913_1656041_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 130
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1668359	1674928	5080321		Bacillus_phage(75.0%)	4	NA	NA
WP_003830971.1|1668359_1669655_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	1.1e-28
WP_003830970.1|1669705_1670395_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	1.1e-37
WP_060682667.1|1670585_1671788_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	27.5	1.1e-08
WP_060682668.1|1671784_1674928_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
>prophage 131
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1682706	1683618	5080321		Salmonella_phage(100.0%)	1	NA	NA
WP_003021479.1|1682706_1683618_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 132
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1687454	1688570	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_123969718.1|1687454_1688570_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 133
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1705312	1706080	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_060682679.1|1705312_1706080_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	7.3e-25
>prophage 134
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1714130	1717655	5080321		Bacillus_virus(50.0%)	2	NA	NA
WP_000192349.1|1714130_1715177_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_060682682.1|1715786_1717655_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	27.7	2.6e-23
>prophage 135
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1722234	1725877	5080321		Micromonas_sp._RCC1109_virus(66.67%)	4	NA	NA
WP_060682685.1|1722234_1723248_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	5.4e-44
WP_060682686.1|1723244_1724195_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	6.9e-33
WP_060682687.1|1724191_1725001_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_060682688.1|1725010_1725877_-	alpha/beta fold hydrolase	NA	A0A2K9KZN8	Tupanvirus	24.8	2.4e-08
>prophage 136
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1735428	1743002	5080321		Enterobacteria_phage(33.33%)	4	NA	NA
WP_020996590.1|1735428_1736511_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	81.5	7.8e-158
WP_060682690.1|1736632_1739716_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.4	0.0e+00
WP_048226366.1|1739767_1741021_+	MFS transporter	NA	NA	NA	NA	NA
WP_060682691.1|1741115_1743002_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	1.8e-53
>prophage 137
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1756733	1757639	5080321		Burkholderia_virus(100.0%)	1	NA	NA
WP_048236016.1|1756733_1757639_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.4	4.7e-15
>prophage 138
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1761118	1769890	5080321	integrase,capsid	Cronobacter_phage(40.0%)	10	1759438:1759497	1773608:1774376
1759438:1759497	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000783295.1|1761118_1761391_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_060682698.1|1761673_1764361_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	34.9	3.8e-113
WP_001063902.1|1764357_1764768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839712.1|1764760_1764997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111087.1|1764993_1765584_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	2.6e-22
WP_060682699.1|1765672_1766677_-|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	47.7	3.6e-80
WP_060682700.1|1766699_1767572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000507057.1|1767608_1767809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682701.1|1767916_1768705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682702.1|1768708_1769890_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	8.9e-123
1773608:1774376	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCTATTGTTTCATCGACTCTAAACTTATTGCTACATTTTCCATAGCGAGTGACAGTATAGGTTCAATATATAATCAGTGCATATTGGTTCAGCCCCCCTAATGATCAAGATTTAAGCAACCCTGACCAACGGGTAGGTATTTCTGCAACGCTACGATAAATTTCCGGTTTTTTGTTTTCAACTCACTACTATGCCAGGTTTCCCCCGGTAACACATAACGCATGGTGGCTTCATCATCAGTTGAGTGACACCCCTGGTGTACGATAATTTTGAAAAAAGTATTCCCTGTGTTTTTCAACGTCCCGTTTATCTCATCAATGGTGTAGGCCAGGTTCATTTTCCTCGGACGAACGACCAATATGGTATCCATAGCGATAACCGGGAGAGCTTGTCCGCCTTTCCCTTGATTACGCTCGGTAAACAGCGTTATCGGCATTTCACGAAACAGTATTCGGTAATAGCGTTCTTTATCATCCTGCGGGCCACGATAGAAAATCTTAAAAAACTCACTTGCCTGCGGTGCCAGTGAAAAACGGAGCGGAGTAAACAAAAGTTCGCCTTCGGCAATAGCACTTCTGTTTTCACCTCCCGGTCCCGGTTTATCTATTTTAACTGCGCTAATACTGTACACGTTCTGTTTCTGGCTATCGTTATAGATTCGTTTACTGATAAATGATTTATCCGATGGCATCTCATAAATAGTCGACTCCA	NA	NA	NA	NA
>prophage 139
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1781536	1785247	5080321		Streptococcus_phage(66.67%)	3	NA	NA
WP_048236044.1|1781536_1782787_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.6e-98
WP_003031373.1|1782798_1783902_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_060682710.1|1784191_1785247_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	7.2e-116
>prophage 140
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1792462	1793044	5080321		Caulobacter_phage(100.0%)	1	NA	NA
WP_003031390.1|1792462_1793044_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
>prophage 141
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1809358	1813557	5080321		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_100247263.1|1809358_1810087_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	5.2e-41
WP_003838896.1|1810151_1810619_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_048214878.1|1810615_1811338_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_057068753.1|1811371_1812127_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032942416.1|1812198_1813557_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	9.9e-09
>prophage 142
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1817601	1818405	5080321		Indivirus(100.0%)	1	NA	NA
WP_060682717.1|1817601_1818405_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	3.0e-37
>prophage 143
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1824870	1825902	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_003829140.1|1824870_1825902_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 144
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1837904	1842008	5080321		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_008786271.1|1837904_1841387_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
WP_008786270.1|1841411_1842008_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.8	1.8e-26
>prophage 145
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1850815	1851574	5080321		Flavobacterium_phage(100.0%)	1	NA	NA
WP_060682722.1|1850815_1851574_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	5.5e-25
>prophage 146
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1863325	1864759	5080321	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003829191.1|1863325_1864759_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 147
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1868761	1869106	5080321		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_008786260.1|1868761_1869106_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	2.0e-27
>prophage 148
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1875115	1875913	5080321		Planktothrix_phage(100.0%)	1	NA	NA
WP_060682729.1|1875115_1875913_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	2.7e-14
>prophage 149
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1886393	1893216	5080321	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
WP_060682735.1|1886393_1888823_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	29.2	2.6e-36
WP_060682736.1|1888896_1889427_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_008786246.1|1889442_1890147_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003829221.1|1890324_1890780_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_060682737.1|1890850_1891747_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071845213.1|1891797_1893216_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
>prophage 150
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1906253	1908558	5080321		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_003829469.1|1906253_1907180_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	4.1e-22
WP_003018654.1|1907288_1907951_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003018658.1|1908021_1908558_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
>prophage 151
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1911829	1914745	5080321		Mamastrovirus(50.0%)	3	NA	NA
WP_060682741.1|1911829_1913446_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	3.3e-19
WP_032941691.1|1913599_1913947_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_008786221.1|1913977_1914745_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.3	5.7e-30
>prophage 152
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1924872	1926297	5080321		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003829486.1|1924872_1926297_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 153
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1937365	1937929	5080321		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_008786207.1|1937365_1937929_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.7e-13
>prophage 154
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1942235	1943279	5080321		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003829510.1|1942235_1943279_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 155
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1969466	1971191	5080321		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_020996230.1|1969466_1971191_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	1.7e-34
>prophage 156
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1987527	1988226	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_032942352.1|1987527_1988226_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-22
>prophage 157
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	1995411	2000847	5080321		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_060682764.1|1995411_1997763_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.4	6.5e-16
WP_048236149.1|1997940_2000847_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	2.2e-21
>prophage 158
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2008706	2010125	5080321		Salmonella_phage(50.0%)	2	NA	NA
WP_003829612.1|2008706_2009555_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	28.8	8.3e-06
WP_003018873.1|2009645_2010125_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 159
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2018454	2024105	5080321		Vibrio_phage(50.0%)	4	NA	NA
WP_003829695.1|2018454_2019972_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.4	2.5e-08
WP_060682768.1|2020006_2021149_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003018901.1|2021272_2022490_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_060682769.1|2022551_2024105_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	6.8e-30
>prophage 160
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2029588	2030737	5080321		Halovirus(100.0%)	1	NA	NA
WP_060682770.1|2029588_2030737_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 161
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2036912	2039729	5080321	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003829724.1|2036912_2039729_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.6	1.0e-76
>prophage 162
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2046196	2050711	5080321		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_008786152.1|2046196_2047363_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.2	5.7e-90
WP_003829737.1|2047569_2048703_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	5.5e-29
WP_003829739.1|2048788_2050711_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.1	5.5e-146
>prophage 163
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2054594	2055548	5080321		Synechococcus_phage(100.0%)	1	NA	NA
WP_003829752.1|2054594_2055548_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	9.7e-11
>prophage 164
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2066744	2068169	5080321		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_048214983.1|2066744_2068169_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.0	1.0e-08
>prophage 165
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2072170	2077412	5080321		Bacillus_phage(33.33%)	3	NA	NA
WP_057067007.1|2072170_2074108_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
WP_003829940.1|2074315_2075983_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
WP_032942319.1|2076182_2077412_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	9.1e-86
>prophage 166
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2084094	2085417	5080321		Geobacillus_virus(100.0%)	1	NA	NA
WP_003845626.1|2084094_2085417_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	3.4e-78
>prophage 167
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2091160	2093965	5080321		Salmonella_phage(50.0%)	3	NA	NA
WP_003019081.1|2091160_2091322_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
WP_048214994.1|2091449_2092067_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_060682784.1|2092375_2093965_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	9.1e-30
>prophage 168
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2097670	2098747	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_003829994.1|2097670_2098747_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 169
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2105089	2106369	5080321		Salmonella_phage(50.0%)	2	NA	NA
WP_060682790.1|2105089_2105629_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_003019133.1|2105631_2106369_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
>prophage 170
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2109558	2112040	5080321		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_048236184.1|2109558_2111004_-	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.0	1.9e-18
WP_060682791.1|2111017_2112040_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.0e-10
>prophage 171
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2115438	2117100	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_008786110.1|2115438_2117100_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 172
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2125478	2126441	5080321	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_060682795.1|2125478_2126441_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	5.4e-70
>prophage 173
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2139476	2143943	5080321		Enterobacteria_phage(50.0%)	4	NA	NA
WP_060682803.1|2139476_2140484_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	3.1e-84
WP_003830087.1|2140677_2140887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786090.1|2141518_2142292_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_060682804.1|2142467_2143943_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.1	9.0e-48
>prophage 174
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2159417	2180212	5080321	integrase,tRNA	Enterobacteria_phage(40.0%)	17	2152161:2152176	2184390:2184405
2152161:2152176	attL	TTGTAGGCCGGATAAG	NA	NA	NA	NA
WP_060682812.1|2159417_2161751_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
WP_001472077.1|2161765_2162086_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216599.1|2162082_2162310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058678336.1|2162306_2162858_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	2.2e-31
WP_000468231.1|2164405_2164645_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_060682813.1|2164660_2165227_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.4	7.9e-61
WP_060682814.1|2165878_2167156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682815.1|2167158_2167542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123969808.1|2167551_2168202_-	site-specific DNA-methyltransferase	NA	H9ABR1	Halogeometricum_pleomorphic_virus	28.4	4.3e-18
WP_060682817.1|2168345_2169632_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.1	1.9e-73
WP_060682818.1|2170100_2171120_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	7.1e-44
WP_060683757.1|2171267_2172770_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.8e-83
WP_008786067.1|2172835_2173918_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032942200.1|2173917_2175018_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025870.1|2175284_2176796_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_003830256.1|2176913_2177357_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_008786064.1|2177356_2180212_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	4.2e-142
2184390:2184405	attR	CTTATCCGGCCTACAA	NA	NA	NA	NA
>prophage 175
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2185283	2186219	5080321		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003025818.1|2185283_2186219_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 176
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2192077	2196123	5080321		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_164091716.1|2192077_2194774_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.7	1.3e-44
WP_060682825.1|2195175_2196123_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.7	3.9e-12
>prophage 177
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2199809	2202533	5080321		Vibrio_phage(100.0%)	2	NA	NA
WP_060682827.1|2199809_2201948_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	3.4e-266
WP_048227187.1|2202068_2202533_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	57.1	9.4e-52
>prophage 178
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2214483	2222198	5080321		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003830390.1|2214483_2215482_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
WP_081003607.1|2215558_2216671_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.8	5.1e-11
WP_048215066.1|2216774_2217776_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_003830397.1|2217762_2218785_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048212855.1|2218798_2220301_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	3.6e-12
WP_003025728.1|2220404_2221361_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_003025726.1|2221670_2222198_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
>prophage 179
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2226209	2228219	5080321		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060682839.1|2226209_2228219_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.7	8.6e-09
>prophage 180
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2243996	2245568	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060682843.1|2243996_2245568_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.4	3.6e-10
>prophage 181
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2265045	2269487	5080321		Lactococcus_phage(50.0%)	3	NA	NA
WP_008786007.1|2265045_2267508_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	1.0e-64
WP_003830485.1|2267546_2267972_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003025606.1|2268188_2269487_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
>prophage 182
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2275010	2278220	5080321		Wolbachia_phage(50.0%)	2	NA	NA
WP_060682849.1|2275010_2276885_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	2.6e-60
WP_060682850.1|2276894_2278220_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
>prophage 183
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2282361	2282907	5080321		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_020996267.1|2282361_2282907_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	1.7e-28
>prophage 184
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2290356	2291334	5080321		Tupanvirus(100.0%)	1	NA	NA
WP_003830517.1|2290356_2291334_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 185
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2297235	2297769	5080321		Morganella_phage(100.0%)	1	NA	NA
WP_001221666.1|2297235_2297769_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 186
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2302793	2304774	5080321		Vibrio_phage(50.0%)	2	NA	NA
WP_003830576.1|2302793_2304437_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
WP_000027827.1|2304480_2304774_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 187
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2313484	2315146	5080321		Hepacivirus(100.0%)	1	NA	NA
WP_060682858.1|2313484_2315146_+	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	23.7	1.1e-30
>prophage 188
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2327653	2329125	5080321	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_003828283.1|2327653_2328163_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_008786286.1|2328177_2329125_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	2.2e-07
>prophage 189
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2349022	2354594	5080321		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003031109.1|2349022_2350207_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003023659.1|2350276_2352391_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003023657.1|2352487_2352958_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023654.1|2353053_2353428_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_008786292.1|2353553_2353841_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	3.1e-05
WP_003827771.1|2353848_2354208_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_008786293.1|2354207_2354594_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	3.9e-19
>prophage 190
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2360271	2365500	5080321		Tupanvirus(25.0%)	4	NA	NA
WP_003827754.1|2360271_2362173_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
WP_060682864.1|2362225_2363716_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	9.8e-143
WP_008786297.1|2363730_2364591_-	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	41.3	1.9e-50
WP_060682865.1|2364780_2365500_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	28.4	6.6e-20
>prophage 191
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2369235	2373280	5080321		environmental_Halophage(33.33%)	3	NA	NA
WP_008786302.1|2369235_2371323_+	membrane protein	NA	H9YQA8	environmental_Halophage	87.7	2.1e-66
WP_008786303.1|2371413_2372631_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.7	6.1e-34
WP_048236932.1|2372716_2373280_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	2.7e-61
>prophage 192
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2390751	2391588	5080321		Vibrio_phage(100.0%)	1	NA	NA
WP_003827684.1|2390751_2391588_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	6.4e-67
>prophage 193
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2408537	2412309	5080321		Bacillus_phage(66.67%)	3	NA	NA
WP_003023529.1|2408537_2410160_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	8.1e-143
WP_060682876.1|2410234_2411587_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	2.5e-12
WP_135953044.1|2411583_2412309_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 194
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2425466	2427860	5080321		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_060682879.1|2425466_2427860_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	2.1e-14
>prophage 195
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2435061	2437509	5080321		Dickeya_phage(100.0%)	1	NA	NA
WP_048215392.1|2435061_2437509_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 196
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2461490	2463301	5080321		Enterococcus_phage(50.0%)	2	NA	NA
WP_060682891.1|2461490_2462234_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	2.2e-10
WP_008786359.1|2462230_2463301_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.6e-20
>prophage 197
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2467089	2468588	5080321		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_003827581.1|2467089_2467803_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	1.9e-11
WP_003023438.1|2467820_2468588_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
>prophage 198
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2474382	2477227	5080321		Salicola_phage(50.0%)	3	NA	NA
WP_003023425.1|2474382_2475237_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
WP_003837835.1|2475507_2476566_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023420.1|2476558_2477227_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
>prophage 199
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2482569	2486647	5080321		Dickeya_phage(50.0%)	4	NA	NA
WP_003827558.1|2482569_2483196_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
WP_060682898.1|2483270_2485469_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.7	1.2e-117
WP_003827551.1|2485567_2485813_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_003827549.1|2485981_2486647_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	2.5e-58
>prophage 200
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2508966	2516243	5080321		Bacillus_phage(66.67%)	5	NA	NA
WP_060682908.1|2508966_2511714_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
WP_060682909.1|2511710_2512778_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000723069.1|2513513_2513948_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_060682910.1|2514165_2515566_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	1.6e-17
WP_044704621.1|2515562_2516243_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	1.1e-29
>prophage 201
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2521337	2524794	5080321		Listeria_phage(50.0%)	3	NA	NA
WP_000287501.1|2521337_2522075_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|2522108_2522306_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001353604.1|2522346_2524794_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
>prophage 202
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2531967	2535296	5080321		Bacillus_phage(66.67%)	4	NA	NA
WP_000697968.1|2531967_2532648_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|2532640_2534122_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|2534366_2534798_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|2534945_2535296_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
>prophage 203
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2555163	2557206	5080321		Indivirus(100.0%)	1	NA	NA
WP_060682916.1|2555163_2557206_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.0	1.5e-45
>prophage 204
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2588070	2590055	5080321		Bacillus_virus(50.0%)	2	NA	NA
WP_003827418.1|2588070_2589075_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-17
WP_048236981.1|2589071_2590055_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	2.5e-14
>prophage 205
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2599954	2602288	5080321		Escherichia_phage(100.0%)	1	NA	NA
WP_060682931.1|2599954_2602288_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.2	2.8e-72
>prophage 206
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2610083	2610296	5080321		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2610083_2610296_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 207
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2614703	2615699	5080321		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_008786435.1|2614703_2615699_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.9	4.5e-11
>prophage 208
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2636970	2638815	5080321		Tupanvirus(100.0%)	1	NA	NA
WP_060682942.1|2636970_2638815_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	6.9e-13
>prophage 209
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2656241	2666640	5080321		Rhizobium_phage(16.67%)	10	NA	NA
WP_003024152.1|2656241_2656493_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_003024148.1|2656545_2656977_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003827325.1|2657226_2658771_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_060682946.1|2658780_2660064_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_060682947.1|2660067_2661003_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_060682948.1|2661003_2662038_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.4	1.7e-08
WP_008786466.1|2662522_2663209_+	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_003024132.1|2663261_2664287_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_060682949.1|2664296_2665493_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.9	2.1e-34
WP_060682950.1|2665707_2666640_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	7.7e-37
>prophage 210
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2677112	2681733	5080321		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_003024099.1|2677112_2677592_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
WP_060682956.1|2677630_2678440_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	7.7e-25
WP_003024094.1|2678538_2678706_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|2678726_2678963_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_048227329.1|2679239_2679905_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_123969814.1|2680076_2681297_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.4e-43
WP_003827259.1|2681274_2681733_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
>prophage 211
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2685114	2693641	5080321	integrase	Morganella_phage(71.43%)	11	2680749:2680763	2691494:2691508
2680749:2680763	attL	GCAAAGCGCGGGGCA	NA	NA	NA	NA
WP_060683763.1|2685114_2686383_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.4	1.5e-192
WP_060682958.1|2686474_2687371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047026876.1|2687471_2687690_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_060682959.1|2687689_2688124_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	2.7e-29
WP_060682960.1|2688137_2688725_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	64.9	5.5e-57
WP_081003611.1|2688724_2689504_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_060682961.1|2689500_2689698_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	44.6	5.4e-09
WP_060682962.1|2689694_2689934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682963.1|2689911_2690538_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.0	1.5e-23
WP_060682964.1|2690547_2690889_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	64.2	9.0e-36
WP_060682965.1|2690881_2693641_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.7	1.3e-297
2691494:2691508	attR	GCAAAGCGCGGGGCA	NA	NA	NA	NA
>prophage 212
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2700162	2703249	5080321		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_003024042.1|2700162_2700786_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_000135058.1|2700840_2701116_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024038.1|2701134_2703249_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 213
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2707503	2708895	5080321		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|2707503_2708895_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 214
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2721523	2737035	5080321	integrase	Enterobacteria_phage(88.89%)	17	2721342:2721363	2731893:2731914
2721342:2721363	attL	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_060682975.1|2721523_2722687_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	2.5e-210
WP_060682976.1|2722701_2724705_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003827213.1|2725235_2725802_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
WP_003827212.1|2725818_2726064_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
WP_060682977.1|2726060_2726798_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.9	2.6e-80
WP_003827209.1|2727338_2727605_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_003827209.1|2727891_2728158_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_024228213.1|2728154_2728706_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.2	7.0e-30
WP_003827205.1|2728702_2728930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021563885.1|2728926_2729247_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_060682979.1|2729261_2731595_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_060682980.1|2732020_2732587_+	hypothetical protein	NA	NA	NA	NA	NA
2731893:2731914	attR	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_008786495.1|2732595_2732790_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_060682981.1|2732926_2733217_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_008786497.1|2733555_2733816_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_071845242.1|2733819_2734122_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_060682982.1|2734230_2737035_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	47.8	7.8e-101
>prophage 215
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2743775	2748468	5080321	transposase	Mollivirus(33.33%)	5	NA	NA
WP_060682986.1|2743775_2744552_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.2	6.4e-13
WP_060683765.1|2744698_2745643_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.9	2.6e-16
WP_003827166.1|2745668_2746571_+	DMT family transporter	NA	NA	NA	NA	NA
WP_008786507.1|2746599_2747418_-	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_060682987.1|2747541_2748468_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	6.4e-68
>prophage 216
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2752489	2753872	5080321		Pandoravirus(100.0%)	1	NA	NA
WP_060682988.1|2752489_2753872_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	1.1e-39
>prophage 217
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2769116	2773956	5080321		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_060682992.1|2769116_2770805_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	1.3e-58
WP_003827118.1|2770912_2771011_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_003023909.1|2771533_2771623_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_020996046.1|2771746_2772580_+	EamA family transporter	NA	NA	NA	NA	NA
WP_032934162.1|2772771_2773956_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.5	3.3e-16
>prophage 218
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2782086	2783021	5080321		Synechococcus_phage(100.0%)	2	NA	NA
WP_060682995.1|2782086_2782515_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	7.1e-14
WP_003023882.1|2782607_2783021_-	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 219
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2790574	2798083	5080321		Bacillus_virus(33.33%)	7	NA	NA
WP_008786542.1|2790574_2792989_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	4.1e-114
WP_008786543.1|2793017_2794091_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003023863.1|2794229_2795330_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_003827078.1|2795334_2796738_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023858.1|2797344_2797485_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003844432.1|2797502_2797862_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023846.1|2797825_2798083_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 220
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2805060	2815705	5080321		Moraxella_phage(20.0%)	9	NA	NA
WP_003827042.1|2805060_2806398_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	38.0	1.6e-64
WP_003827040.1|2806565_2807231_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003023824.1|2807352_2808078_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003023821.1|2808092_2808866_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003827037.1|2808912_2809803_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_008786549.1|2809802_2810762_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003827033.1|2810905_2811946_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.7e-46
WP_060683001.1|2812280_2814110_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	8.9e-122
WP_008786550.1|2814334_2815705_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	2.5e-36
>prophage 221
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2828015	2829008	5080321		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_060683003.1|2828015_2829008_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.8e-50
>prophage 222
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2832282	2836276	5080321		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_003827003.1|2832282_2834151_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	3.2e-66
WP_003827001.1|2834343_2834763_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003023764.1|2834770_2836276_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	1.7e-17
>prophage 223
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2851636	2853283	5080321		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_060683007.1|2851636_2853283_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.3e-65
>prophage 224
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2864406	2870668	5080321		Vibrio_phage(25.0%)	5	NA	NA
WP_060683009.1|2864406_2865135_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	2.7e-21
WP_060683010.1|2865239_2867261_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
WP_003829016.1|2867308_2868790_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003829013.1|2868926_2870195_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_060683011.1|2870338_2870668_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	3.2e-14
>prophage 225
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2874721	2878920	5080321		Catovirus(33.33%)	4	NA	NA
WP_048237107.1|2874721_2875852_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.0	8.8e-27
WP_008787073.1|2875848_2877111_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.5	4.5e-24
WP_060683012.1|2877107_2877785_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_060683013.1|2877789_2878920_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
>prophage 226
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2895346	2899216	5080321		Bacillus_phage(100.0%)	3	NA	NA
WP_032945700.1|2895346_2896249_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.9	8.5e-25
WP_032945701.1|2896248_2896965_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_003828957.1|2897053_2899216_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.5e-117
>prophage 227
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2903234	2906671	5080321	transposase	Catovirus(50.0%)	3	NA	NA
WP_060683020.1|2903234_2905064_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	7.4e-84
WP_060683021.1|2905127_2905748_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_060683022.1|2905786_2906671_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	9.8e-66
>prophage 228
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2918680	2922000	5080321		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_003828916.1|2918680_2920321_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
WP_003017888.1|2920399_2920654_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_048227528.1|2920657_2921206_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003828911.1|2921208_2922000_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	3.0e-26
>prophage 229
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2932985	2933600	5080321		Streptococcus_phage(100.0%)	1	NA	NA
WP_060683029.1|2932985_2933600_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	7.3e-20
>prophage 230
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2946001	2948788	5080321		Enterococcus_phage(100.0%)	1	NA	NA
WP_060683031.1|2946001_2948788_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	2.5e-46
>prophage 231
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2952699	2955169	5080321		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003825317.1|2952699_2954109_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
WP_008786986.1|2954119_2955169_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
>prophage 232
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2967874	2970671	5080321		Staphylococcus_phage(50.0%)	3	NA	NA
WP_060683038.1|2967874_2968771_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	6.0e-63
WP_060683039.1|2968937_2969834_+	sugar kinase	NA	NA	NA	NA	NA
WP_060683040.1|2969867_2970671_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	1.4e-23
>prophage 233
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2974519	2975449	5080321		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_060683043.1|2974519_2975449_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.4	2.1e-26
>prophage 234
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2978784	2981835	5080321		Escherichia_phage(100.0%)	1	NA	NA
WP_123969740.1|2978784_2981835_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	6.5e-08
>prophage 235
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	2994692	2995313	5080321		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003825239.1|2994692_2995313_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 236
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3001604	3003673	5080321		Bacillus_phage(50.0%)	2	NA	NA
WP_003028758.1|3001604_3002978_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
WP_003028763.1|3002974_3003673_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
>prophage 237
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3017279	3021927	5080321		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_008787032.1|3017279_3018125_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	4.0e-16
WP_088732415.1|3018553_3018799_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_008787034.1|3019020_3019506_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_003825185.1|3019598_3020528_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003028803.1|3020595_3021927_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
>prophage 238
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3041577	3048879	5080321		Synechococcus_phage(33.33%)	5	NA	NA
WP_060683064.1|3041577_3042240_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	32.7	3.2e-29
WP_048227754.1|3042255_3044757_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.8	4.6e-12
WP_003825153.1|3045065_3046145_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003825151.1|3046159_3046480_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_048237074.1|3046581_3048879_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.3e-05
>prophage 239
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3065892	3067749	5080321		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032945649.1|3065892_3067749_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.5	1.5e-07
>prophage 240
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3076578	3097108	5080321		uncultured_Mediterranean_phage(14.29%)	17	NA	NA
WP_003031107.1|3076578_3077529_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_003031109.1|3078475_3079660_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003033128.1|3079890_3080274_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003033125.1|3080275_3080821_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033122.1|3080975_3081404_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003033119.1|3081407_3082115_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|3082533_3083031_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033114.1|3083097_3083463_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003033111.1|3083783_3087812_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003826919.1|3087888_3092112_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.3e-67
WP_008787121.1|3092214_3092532_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003033102.1|3092536_3092842_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033098.1|3093934_3094147_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_060683068.1|3094266_3095400_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_164079429.1|3095396_3096260_-	thiazole synthase	NA	NA	NA	NA	NA
WP_016155307.1|3096168_3096369_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003826902.1|3096349_3097108_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.7	2.0e-11
>prophage 241
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3102373	3104137	5080321		Klosneuvirus(50.0%)	3	NA	NA
WP_060683070.1|3102373_3103054_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.6	5.6e-21
WP_003842015.1|3103087_3103678_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|3103864_3104137_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 242
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3109627	3111217	5080321		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_008787105.1|3109627_3111217_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.2e-67
>prophage 243
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3124822	3132677	5080321		Brucella_phage(50.0%)	6	NA	NA
WP_057068603.1|3124822_3128506_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
WP_003826514.1|3128726_3130358_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_060683075.1|3130473_3131163_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_032942057.1|3131273_3131552_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.8	1.3e-11
WP_060683076.1|3131544_3131862_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	57.3	3.0e-25
WP_060683077.1|3132125_3132677_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	55.8	9.2e-22
>prophage 244
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3145388	3146174	5080321		Pseudomonas_phage(100.0%)	1	NA	NA
WP_060683086.1|3145388_3146174_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.0	2.8e-48
>prophage 245
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3161084	3162194	5080321		Mycoplasma_phage(100.0%)	1	NA	NA
WP_008786916.1|3161084_3162194_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 246
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3169375	3169984	5080321		Lactococcus_phage(100.0%)	1	NA	NA
WP_003826596.1|3169375_3169984_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 247
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3175662	3184651	5080321		Escherichia_phage(25.0%)	6	NA	NA
WP_003826610.1|3175662_3177078_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_008786925.1|3177094_3178174_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	5.2e-29
WP_060683094.1|3178302_3179496_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_003826615.1|3179680_3180394_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_060683095.1|3181052_3183875_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	0.0e+00
WP_003826621.1|3184126_3184651_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
>prophage 248
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3188617	3189967	5080321		Moraxella_phage(100.0%)	1	NA	NA
WP_003826632.1|3188617_3189967_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	70.9	2.6e-158
>prophage 249
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3196894	3198853	5080321		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003826645.1|3196894_3198853_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 250
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3216247	3225915	5080321		Escherichia_phage(40.0%)	11	NA	NA
WP_060683103.1|3216247_3217771_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	3.6e-07
WP_060683104.1|3217885_3220150_+	response regulator	NA	NA	NA	NA	NA
WP_003031807.1|3220219_3220549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032942116.1|3220704_3221007_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	75.0	3.1e-40
WP_008786950.1|3221027_3221369_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	81.8	1.8e-44
WP_060683105.1|3221421_3222180_-	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_008786952.1|3222188_3222623_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_008786953.1|3222609_3223164_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_060683106.1|3223166_3224303_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003826708.1|3224299_3224986_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-08
WP_060683107.1|3225156_3225915_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.7	4.7e-16
>prophage 251
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3231561	3232350	5080321		Pithovirus(100.0%)	1	NA	NA
WP_060683109.1|3231561_3232350_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	3.8e-13
>prophage 252
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3238923	3240426	5080321		Burkholderia_virus(100.0%)	1	NA	NA
WP_003826737.1|3238923_3240426_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-56
>prophage 253
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3266136	3270292	5080321		Bacillus_virus(50.0%)	4	NA	NA
WP_003025300.1|3266136_3266895_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_020996364.1|3266902_3268006_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008785977.1|3268015_3269197_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008785976.1|3269266_3270292_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 254
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3276893	3277778	5080321		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_008785971.1|3276893_3277778_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.2	2.8e-28
>prophage 255
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3290435	3291479	5080321		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3290435_3291479_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 256
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3309183	3310551	5080321	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_060683125.1|3309183_3310551_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.5e-20
>prophage 257
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3314453	3314957	5080321	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_003025130.1|3314453_3314957_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 258
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3318793	3320284	5080321		Burkholderia_virus(100.0%)	1	NA	NA
WP_048215451.1|3318793_3320284_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.1e-08
>prophage 259
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3331120	3345200	5080321		Staphylococcus_phage(22.22%)	16	NA	NA
WP_122973815.1|3331120_3332050_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.2e-16
WP_020996355.1|3332251_3334588_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	9.9e-41
WP_003828774.1|3334817_3335471_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_060683130.1|3335467_3336187_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003828770.1|3336253_3336526_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025085.1|3336522_3337377_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025083.1|3337422_3337914_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|3337997_3338285_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_008785934.1|3338307_3339741_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003828761.1|3339787_3340513_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_032945118.1|3340519_3341068_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_008785932.1|3341036_3341612_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_032945113.1|3341608_3342175_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.6	1.6e-53
WP_020996354.1|3342195_3343182_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_060683131.1|3343195_3344173_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.8	6.2e-05
WP_003828749.1|3344387_3345200_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.7e-20
>prophage 260
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3349292	3350767	5080321		Vibrio_phage(50.0%)	2	NA	NA
WP_003025035.1|3349292_3349577_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
WP_003839953.1|3349795_3350767_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 261
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3357454	3360336	5080321	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003025013.1|3357454_3359389_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
WP_048225717.1|3359487_3360336_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.9	3.0e-19
>prophage 262
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3366153	3372798	5080321		Dickeya_phage(50.0%)	4	NA	NA
WP_005131837.1|3366153_3367497_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
WP_003024996.1|3368114_3368567_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024992.1|3368595_3370083_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_032945099.1|3370107_3372798_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	6.7e-25
>prophage 263
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3378391	3380320	5080321		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_057067629.1|3378391_3380320_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 264
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3386108	3392178	5080321		Invertebrate_iridovirus(33.33%)	8	NA	NA
WP_048236838.1|3386108_3386399_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	51.9	7.0e-13
WP_032945092.1|3386451_3386880_+	YhbP family protein	NA	NA	NA	NA	NA
WP_060683139.1|3386916_3387552_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_008785904.1|3387636_3388212_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024948.1|3388221_3388812_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003828625.1|3388846_3389242_-	YraN family protein	NA	NA	NA	NA	NA
WP_060683140.1|3389199_3391251_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_060683141.1|3391314_3392178_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 265
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3404030	3405137	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_060683146.1|3404030_3405137_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	29.6	7.0e-13
>prophage 266
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3413704	3414850	5080321		Streptococcus_phage(100.0%)	1	NA	NA
WP_060683149.1|3413704_3414850_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.2	4.1e-48
>prophage 267
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3418333	3418912	5080321		uncultured_archaeal_virus(100.0%)	1	NA	NA
WP_044701290.1|3418333_3418912_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	8.4e-18
>prophage 268
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3428440	3430735	5080321		Tetraselmis_virus(100.0%)	1	NA	NA
WP_043017750.1|3428440_3430735_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.6	5.3e-156
>prophage 269
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3450851	3451820	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_048216385.1|3450851_3451820_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	31.8	4.5e-32
>prophage 270
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3462764	3571326	5080321	capsid,portal,head,tail,transposase,integrase,terminase,tRNA	Cronobacter_phage(53.49%)	85	3488390:3488437	3520219:3520266
WP_060683159.1|3462764_3465857_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.1e-156
WP_032945068.1|3466064_3467048_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_060683160.1|3467257_3467590_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_122973809.1|3467667_3469158_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.7e-33
WP_060683161.1|3469477_3470998_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.5	4.2e-32
WP_164091703.1|3471050_3471734_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060683162.1|3471969_3472743_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003828520.1|3472743_3473592_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048225647.1|3473659_3474814_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	2.1e-84
WP_060683163.1|3474952_3476611_-	glycerone kinase	NA	NA	NA	NA	NA
WP_003024745.1|3477171_3478269_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_060683164.1|3478360_3480286_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_060683165.1|3480263_3480794_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_060683166.1|3480794_3481148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003024734.1|3481164_3482328_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003828504.1|3482350_3482779_-	heme-binding protein	NA	NA	NA	NA	NA
WP_060683167.1|3483170_3484838_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_008785852.1|3484849_3485434_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_060683168.1|3485436_3485865_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_060683169.1|3485875_3487690_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_001573898.1|3487799_3488123_+	DUF1889 family protein	NA	NA	NA	NA	NA
3488390:3488437	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_060683170.1|3488552_3489035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683171.1|3489031_3490060_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	59.5	2.9e-114
WP_123969822.1|3490059_3490593_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	41.8	3.0e-30
WP_060683173.1|3490782_3491004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683771.1|3491034_3491538_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	5.9e-60
WP_060683174.1|3491547_3491775_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_060683175.1|3491764_3492193_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	52.5	5.3e-25
WP_060683176.1|3492192_3492594_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	67.7	1.3e-49
WP_060683177.1|3492661_3492895_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060683178.1|3492885_3493215_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	46.8	8.8e-12
WP_060683179.1|3493204_3494074_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	81.3	2.9e-131
WP_060683180.1|3494070_3494283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683181.1|3494284_3496300_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.7	1.9e-298
WP_000364823.1|3496419_3496626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012602735.1|3496599_3496923_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_021293724.1|3496919_3497924_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	80.5	1.4e-161
WP_060683182.1|3497976_3499752_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.8	1.5e-291
WP_021293725.1|3499913_3500717_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	2.8e-80
WP_003838043.1|3500778_3501801_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
WP_021293727.1|3502565_3503054_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_021293728.1|3503050_3503557_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_060683183.1|3503553_3504261_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	6.3e-100
WP_000044253.1|3505380_3505836_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_001738730.1|3505846_3506149_+	Holin from bacteriophage origin	NA	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_060683184.1|3506475_3506856_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.1	1.4e-29
WP_032950205.1|3506960_3507218_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	2.9e-18
WP_060683185.1|3507405_3509466_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.3	3.1e-272
WP_060683186.1|3509462_3509792_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	7.1e-38
WP_060683187.1|3509788_3510973_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.4	3.2e-181
WP_060683188.1|3510965_3511553_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	1.4e-92
WP_164091692.1|3511563_3511869_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	81.0	6.4e-41
WP_071845263.1|3513896_3514475_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	50.0	6.2e-37
WP_060683189.1|3514464_3515190_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.8	4.7e-66
WP_060683190.1|3515161_3515707_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.9	2.5e-64
WP_060683772.1|3515709_3517410_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.0	1.7e-223
WP_060683191.1|3517575_3517830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164091704.1|3518371_3518542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683192.1|3518534_3519161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683193.1|3519216_3519474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683194.1|3519518_3520016_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_060683773.1|3521869_3522424_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
3520219:3520266	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_089591852.1|3522420_3522567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031518882.1|3522720_3523509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031518881.1|3523721_3523958_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_031518878.1|3524090_3525503_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_031518877.1|3525732_3526356_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_103255452.1|3526553_3527721_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	3.6e-177
WP_048291768.1|3528332_3529424_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_023343022.1|3529427_3530135_-	OmpA family protein	NA	NA	NA	NA	NA
WP_017694609.1|3530141_3531794_-	membrane protein	NA	NA	NA	NA	NA
WP_123969749.1|3535459_3536143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683196.1|3536142_3542469_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.3	1.1e-33
WP_060683197.1|3542692_3545551_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	28.3	1.6e-29
WP_060683198.1|3545553_3550476_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.5	2.8e-29
WP_060683199.1|3550475_3556817_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	1.4e-57
WP_060683200.1|3556813_3558937_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.8	2.4e-09
WP_060683201.1|3559117_3560500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650302.1|3562386_3565041_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000627495.1|3565194_3566217_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_001531258.1|3566213_3566996_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_164091705.1|3567519_3567675_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_123969751.1|3567806_3568954_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	1.2e-145
WP_060683204.1|3569549_3570413_+	GTPase family protein	NA	NA	NA	NA	NA
WP_060683205.1|3570504_3571326_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
>prophage 271
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3575271	3576018	5080321		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_031523094.1|3575271_3576018_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	3.1e-20
>prophage 272
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3581192	3589441	5080321	tRNA	Pseudomonas_phage(25.0%)	10	NA	NA
WP_060683211.1|3581192_3581645_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.4	1.1e-12
WP_047355118.1|3581660_3582137_+	RadC family protein	NA	NA	NA	NA	NA
WP_001548171.1|3582145_3582367_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_006812013.1|3582386_3582704_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_006812012.1|3582724_3583066_+	toxin	NA	NA	NA	NA	NA
WP_008785849.1|3583428_3583935_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_003024699.1|3583980_3585828_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003828467.1|3585992_3587738_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_001144069.1|3587975_3588191_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024694.1|3588427_3589441_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
>prophage 273
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3600897	3602133	5080321		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_032945041.1|3600897_3602133_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	48.3	3.4e-93
>prophage 274
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3607385	3610765	5080321		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_060683217.1|3607385_3608819_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	7.4e-39
WP_008785836.1|3609186_3609393_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_008785835.1|3609426_3609783_-	ubiquinone biosynthesis accessory factor UbiK	NA	NA	NA	NA	NA
WP_003828424.1|3610111_3610765_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 275
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3616463	3624538	5080321		Ralstonia_phage(25.0%)	8	NA	NA
WP_060683220.1|3616463_3617624_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	1.3e-86
WP_003024591.1|3617629_3618307_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_100247260.1|3618454_3619933_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_032945031.1|3620132_3620765_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.2	7.6e-20
WP_060683221.1|3620761_3621184_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_008785825.1|3621208_3622036_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003024575.1|3622035_3622617_+	esterase YqiA	NA	NA	NA	NA	NA
WP_003024571.1|3622645_3624538_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 276
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3636269	3636668	5080321		Stx_converting_phage(100.0%)	1	NA	NA
WP_003024544.1|3636269_3636668_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 277
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3640344	3642603	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_060683226.1|3640344_3642603_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	1.7e-85
>prophage 278
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3646711	3651957	5080321		Pseudomonas_phage(33.33%)	4	NA	NA
WP_060683228.1|3646711_3648883_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
WP_008785817.1|3648986_3649442_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	5.4e-20
WP_060683229.1|3649486_3650941_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_032945014.1|3651129_3651957_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	1.9e-63
>prophage 279
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3661771	3663412	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_008785806.1|3661771_3663412_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 280
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3682983	3684069	5080321		Geobacillus_virus(100.0%)	1	NA	NA
WP_008785777.1|3682983_3684069_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 281
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3702084	3705016	5080321	terminase,transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_071845346.1|3702084_3703737_+|terminase	terminase	terminase	A0A2H4J898	uncultured_Caudovirales_phage	26.0	2.0e-32
WP_085950818.1|3703895_3705016_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 282
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3711920	3716797	5080321		Enterobacteria_phage(33.33%)	9	NA	NA
WP_060683254.1|3711920_3712373_-	glycoside hydrolase family protein	NA	H6X3N0	Enterobacteria_phage	48.2	4.6e-27
WP_060683255.1|3712414_3712846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683256.1|3712842_3713421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683257.1|3713423_3713735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044701684.1|3713731_3714022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683258.1|3714151_3714403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683259.1|3714409_3714862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683260.1|3715171_3716023_-	DUF2806 domain-containing protein	NA	A0A291AUV8	Sinorhizobium_phage	28.4	1.9e-21
WP_060683261.1|3716068_3716797_+	methyltransferase	NA	C4MYW4	Escherichia_phage	53.4	2.3e-73
>prophage 283
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3722067	3725014	5080321		Aichi_virus(50.0%)	2	NA	NA
WP_008785766.1|3722067_3723462_-	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	8.3e-27
WP_020996311.1|3723859_3725014_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	6.2e-129
>prophage 284
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3747440	3748673	5080321		Catovirus(100.0%)	1	NA	NA
WP_003825480.1|3747440_3748673_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	3.1e-102
>prophage 285
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3756643	3761865	5080321		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003825499.1|3756643_3759517_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.8	1.0e-260
WP_060683275.1|3759594_3760338_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060683276.1|3760431_3761865_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.4	1.7e-30
>prophage 286
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3766667	3775979	5080321	transposase,tRNA	Brevibacillus_phage(16.67%)	8	NA	NA
WP_003825519.1|3766667_3767564_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_060683280.1|3767587_3768298_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_048215591.1|3768303_3770037_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	3.2e-60
WP_100194817.1|3770128_3771226_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_005123357.1|3771236_3772754_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.7e-86
WP_032944889.1|3772831_3773386_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_060683777.1|3773552_3774311_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_103255452.1|3774810_3775979_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	3.6e-177
>prophage 287
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3786698	3787304	5080321		Canarypox_virus(100.0%)	1	NA	NA
WP_008785731.1|3786698_3787304_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	7.0e-07
>prophage 288
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3802582	3805078	5080321		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003033923.1|3802582_3803344_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
WP_003033926.1|3803659_3805078_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	5.1e-24
>prophage 289
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3808720	3809731	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_008785715.1|3808720_3809731_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.6	2.5e-33
>prophage 290
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3816326	3823152	5080321		Moraxella_phage(33.33%)	6	NA	NA
WP_003033961.1|3816326_3817040_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
WP_003033965.1|3817115_3817811_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_003825602.1|3818495_3819026_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003825604.1|3819038_3821285_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003825606.1|3821475_3822351_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_060683296.1|3822357_3823152_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.4e-116
>prophage 291
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3828632	3844127	5080321	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_032944851.1|3828632_3831521_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	9.0e-68
WP_060683301.1|3831513_3835059_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.4	3.1e-09
WP_060683302.1|3835055_3836885_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	40.8	3.8e-03
WP_003034012.1|3836981_3838313_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_048215635.1|3838547_3839801_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_008785702.1|3840386_3841484_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003825630.1|3841591_3842398_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	5.0e-16
WP_060683303.1|3842475_3842922_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_032944843.1|3842921_3844127_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.3	9.5e-72
>prophage 292
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3855673	3856429	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_003825659.1|3855673_3856429_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	2.0e-06
>prophage 293
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3861347	3862196	5080321		Vibrio_phage(100.0%)	1	NA	NA
WP_003825665.1|3861347_3862196_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.6e-41
>prophage 294
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3866721	3875024	5080321		Oenococcus_phage(25.0%)	5	NA	NA
WP_048215648.1|3866721_3868062_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	2.7e-06
WP_008785687.1|3868082_3869423_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_060683310.1|3869505_3870648_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.7	4.8e-49
WP_060683311.1|3870911_3873668_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.4	1.7e-52
WP_008785684.1|3873725_3875024_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	2.6e-35
>prophage 295
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3878630	3881654	5080321		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_003034127.1|3878630_3880268_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
WP_003034129.1|3880355_3881654_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 296
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3885016	3885688	5080321		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|3885016_3885688_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 297
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3893163	3895196	5080321		Hokovirus(50.0%)	2	NA	NA
WP_008785677.1|3893163_3894591_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.6	5.1e-32
WP_060683317.1|3894590_3895196_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	4.7e-27
>prophage 298
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3898368	3902072	5080321		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_032944818.1|3898368_3899130_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	1.1e-57
WP_003034172.1|3899123_3899750_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_032944817.1|3899889_3901017_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_000081498.1|3901079_3902072_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 299
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3905139	3907707	5080321		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_060683322.1|3905139_3907707_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	3.2e-32
>prophage 300
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3911673	3913878	5080321		Bacillus_phage(100.0%)	1	NA	NA
WP_032944792.1|3911673_3913878_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	26.7	1.0e-31
>prophage 301
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3930897	3947301	5080321		Bacillus_phage(40.0%)	11	NA	NA
WP_032944783.1|3930897_3933090_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	9.1e-12
WP_008785653.1|3933700_3935911_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032944781.1|3935956_3938047_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	1.3e-12
WP_032944778.1|3938043_3939111_+	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_032944776.1|3939107_3940520_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_032944774.1|3940531_3942664_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	37.1	4.4e-11
WP_008785648.1|3942686_3943046_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032944772.1|3943063_3944740_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	2.5e-17
WP_032944769.1|3944751_3945276_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_003825861.1|3945259_3945619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032944766.1|3945678_3947301_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	24.8	3.2e-06
>prophage 302
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3950766	3951582	5080321		Pithovirus(100.0%)	1	NA	NA
WP_060683326.1|3950766_3951582_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.6	3.0e-13
>prophage 303
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3979907	3980873	5080321		Tetraselmis_virus(100.0%)	1	NA	NA
WP_060683332.1|3979907_3980873_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	2.0e-35
>prophage 304
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	3986364	3991786	5080321	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_048225249.1|3986364_3986862_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
WP_003037330.1|3986954_3988019_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_008785618.1|3988105_3988606_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003825959.1|3988734_3991362_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_000906486.1|3991600_3991786_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 305
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4005937	4011234	5080321		Bacillus_virus(20.0%)	5	NA	NA
WP_003825980.1|4005937_4007140_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
WP_060683337.1|4007494_4008454_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.0e-132
WP_060683338.1|4008464_4010609_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	2.9e-196
WP_003825987.1|4010581_4010992_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	1.1e-16
WP_048236625.1|4010988_4011234_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
>prophage 306
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4016871	4020897	5080321		Clostridioides_phage(50.0%)	4	NA	NA
WP_003037241.1|4016871_4017321_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
WP_032944692.1|4017333_4018020_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_032944690.1|4018065_4019466_-	GABA permease	NA	NA	NA	NA	NA
WP_060683343.1|4019613_4020897_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.6e-29
>prophage 307
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4041195	4046417	5080321		Tetraselmis_virus(50.0%)	5	NA	NA
WP_060683351.1|4041195_4042407_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.2	2.2e-12
WP_060683352.1|4042408_4043521_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_060683353.1|4043523_4043931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045899692.1|4043962_4045354_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_060683354.1|4045400_4046417_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.1	8.0e-80
>prophage 308
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4064687	4070512	5080321		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_060683359.1|4064687_4066613_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	9.7e-26
WP_060683360.1|4066956_4067943_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003839787.1|4067981_4068911_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003839789.1|4068964_4070512_+	sugar ABC transporter ATP-binding protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	22.1	7.3e-08
>prophage 309
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4083819	4084905	5080321		Thermus_virus(100.0%)	1	NA	NA
WP_060683366.1|4083819_4084905_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	32.3	3.4e-36
>prophage 310
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4090510	4096459	5080321		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_060683369.1|4090510_4096459_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.7	2.6e-05
>prophage 311
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4101109	4101937	5080321		Yersinia_phage(100.0%)	1	NA	NA
WP_060683379.1|4101109_4101937_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.1	1.0e-40
>prophage 312
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4108553	4109156	5080321	integrase	Clostridioides_phage(100.0%)	1	4108488:4108508	4112434:4112454
4108488:4108508	attL	AATGTCCGCTCTTCGCTCATA	NA	NA	NA	NA
WP_001324664.1|4108553_4109156_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	1.1e-07
WP_001324664.1|4108553_4109156_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	1.1e-07
4112434:4112454	attR	AATGTCCGCTCTTCGCTCATA	NA	NA	NA	NA
>prophage 313
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4127904	4134460	5080321	integrase	uncultured_Caudovirales_phage(33.33%)	5	4120177:4120194	4150646:4150663
4120177:4120194	attL	GAACTTGAACAGCGTATT	NA	NA	NA	NA
WP_071845278.1|4127904_4128120_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.9	7.2e-07
WP_123969768.1|4128243_4129182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683397.1|4129221_4130463_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	1.3e-103
WP_085951585.1|4131102_4132266_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_060683398.1|4132273_4134460_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.4	9.3e-17
4150646:4150663	attR	AATACGCTGTTCAAGTTC	NA	NA	NA	NA
>prophage 314
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4147993	4148476	5080321		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003031211.1|4147993_4148476_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 315
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4161617	4165176	5080321		Pseudomonas_phage(50.0%)	4	NA	NA
WP_003826449.1|4161617_4162844_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	3.8e-07
WP_003826451.1|4162836_4163355_-	YfiR family protein	NA	NA	NA	NA	NA
WP_008785516.1|4163513_4163888_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003031241.1|4164105_4165176_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
>prophage 316
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4171131	4173705	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_020996274.1|4171131_4173705_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
>prophage 317
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4186342	4192486	5080321	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_008785506.1|4186342_4186762_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	6.3e-15
WP_048234691.1|4186969_4188049_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_060683405.1|4188082_4188772_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	3.9e-54
WP_003037563.1|4189090_4189474_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_060683406.1|4189553_4190141_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_100247265.1|4190243_4191140_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003835340.1|4191157_4192486_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
>prophage 318
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4198330	4205311	5080321		Streptococcus_phage(33.33%)	8	NA	NA
WP_003037577.1|4198330_4200130_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
WP_003835329.1|4200145_4201120_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003037579.1|4201389_4202070_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_032937937.1|4202066_4202972_+	GTPase Era	NA	NA	NA	NA	NA
WP_008785495.1|4203105_4203816_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_048215762.1|4203831_4204563_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003037588.1|4204562_4204943_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003037590.1|4205050_4205311_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 319
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4211652	4222990	5080321		Bacillus_phage(50.0%)	7	NA	NA
WP_060683408.1|4211652_4215540_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.7	1.2e-128
WP_122984240.1|4216188_4217619_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.7	3.1e-13
WP_060683410.1|4217641_4218385_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003835302.1|4218381_4219719_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_002914032.1|4219779_4220118_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_060683411.1|4220219_4221410_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003835277.1|4221736_4222990_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 320
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4241273	4242782	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_008785466.1|4241273_4242782_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.5e-15
>prophage 321
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4248499	4254854	5080321		Faustovirus(20.0%)	8	NA	NA
WP_060683420.1|4248499_4249714_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	2.1e-34
WP_002913991.1|4249739_4250126_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003835203.1|4250146_4250470_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_003835201.1|4250578_4251094_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_060683421.1|4251109_4252960_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.9e-103
WP_003037690.1|4252961_4253297_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003037694.1|4253308_4253509_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_008785461.1|4253570_4254854_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.7	1.3e-34
>prophage 322
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4264192	4264624	5080321		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|4264192_4264624_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 323
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4273566	4322211	5080321	terminase,holin,integrase,tail	Salmonella_phage(54.35%)	53	4261526:4261542	4283308:4283324
4261526:4261542	attL	CAGATATCCAGCACGTT	NA	NA	NA	NA
WP_048225012.1|4273566_4275108_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	1.4e-160
WP_057068024.1|4275171_4276254_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003835160.1|4276306_4276522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057068022.1|4276518_4277892_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	5.8e-41
WP_003037756.1|4278052_4279519_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_008785448.1|4279582_4281160_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_060683424.1|4281352_4282606_+|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	95.9	1.3e-228
WP_060683425.1|4282602_4282782_-	hypothetical protein	NA	T1SA82	Salmonella_phage	94.9	1.3e-22
WP_060683426.1|4282778_4283426_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	91.6	3.3e-119
4283308:4283324	attR	CAGATATCCAGCACGTT	NA	NA	NA	NA
WP_000041116.1|4283593_4283893_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	98.0	1.2e-47
WP_000816432.1|4284002_4284251_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_060683427.1|4284297_4285239_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	91.4	1.1e-163
WP_060683428.1|4285235_4286057_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	97.1	2.4e-159
WP_053388660.1|4286053_4286356_-	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	8.5e-46
WP_060683429.1|4286363_4287356_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	77.1	6.0e-56
WP_003037802.1|4287352_4287502_-	hypothetical protein	NA	T1SA20	Salmonella_phage	72.3	8.5e-15
WP_060683430.1|4287727_4288324_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.5	1.7e-106
WP_003037808.1|4288479_4288713_+	hypothetical protein	NA	Q858D6	Salmonella_phage	100.0	5.4e-40
WP_060683431.1|4288858_4289062_+	hypothetical protein	NA	Q858D5	Salmonella_phage	98.5	1.3e-29
WP_060683432.1|4290110_4290926_+	hypothetical protein	NA	T1SA92	Salmonella_phage	91.5	6.5e-141
WP_060683433.1|4291046_4291391_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	95.6	6.9e-60
WP_060683434.1|4291452_4291935_+	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	58.3	2.3e-13
WP_044701701.1|4291936_4292173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683435.1|4292169_4293033_+	DUF551 domain-containing protein	NA	A0A2L1IV16	Escherichia_phage	41.0	5.5e-13
WP_060683436.1|4293222_4293561_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	89.3	2.0e-51
WP_060683787.1|4293682_4294282_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.4	1.3e-90
WP_060683437.1|4294278_4295754_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	89.0	5.1e-269
WP_000334867.1|4297357_4297564_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_060683438.1|4297578_4299249_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	97.3	2.2e-308
WP_060683439.1|4299245_4299542_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	81.6	9.9e-39
WP_060683440.1|4299544_4300267_+	peptidase	NA	T1SAP9	Salmonella_phage	84.2	1.5e-67
WP_060683441.1|4300281_4301268_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	86.0	8.7e-164
WP_060683442.1|4301319_4301760_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	7.7e-64
WP_003037866.1|4301770_4302151_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	4.0e-24
WP_003037867.1|4302202_4302526_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_057515128.1|4302525_4303131_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.0e-110
WP_060683443.1|4303130_4305617_+	hypothetical protein	NA	Q858G3	Salmonella_phage	97.7	0.0e+00
WP_060683444.1|4305616_4306081_+	hypothetical protein	NA	T1SA73	Salmonella_phage	96.8	4.9e-85
WP_060683445.1|4306080_4306623_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	69.3	1.6e-55
WP_060683446.1|4306635_4309146_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	83.5	0.0e+00
WP_060683447.1|4309142_4310945_+	hypothetical protein	NA	T1SAQ5	Salmonella_phage	86.7	9.3e-273
WP_060683448.1|4310949_4313424_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	96.8	0.0e+00
WP_003838321.1|4313853_4314330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164091709.1|4314314_4314467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683449.1|4314580_4315276_-	Bro-N domain-containing protein	NA	A0A193GYJ9	Enterobacter_phage	67.7	2.3e-86
WP_003847193.1|4315591_4315852_-	hypothetical protein	NA	T1SA06	Salmonella_phage	100.0	7.6e-43
WP_060683450.1|4316049_4318518_+	hypothetical protein	NA	A0A172JGE0	Citrobacter_phage	40.4	4.8e-110
WP_001275998.1|4318711_4319116_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_060683451.1|4319102_4319411_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	1.3e-49
WP_060683452.1|4319400_4320027_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	90.3	3.6e-107
WP_060683453.1|4320023_4320506_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.1	1.1e-68
WP_048234740.1|4320764_4321643_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_008785446.1|4322007_4322211_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	82.9	5.4e-12
>prophage 324
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4328640	4334238	5080321		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_008785442.1|4328640_4329282_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.5e-28
WP_020996702.1|4329278_4330316_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	8.2e-72
WP_060683454.1|4330611_4332042_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003835110.1|4332225_4332852_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003835107.1|4332948_4334238_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.4	2.3e-63
>prophage 325
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4344108	4344822	5080321		Cyanophage(100.0%)	1	NA	NA
WP_003835086.1|4344108_4344822_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.0e-37
>prophage 326
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4380663	4390148	5080321		Paenibacillus_phage(20.0%)	11	NA	NA
WP_003038046.1|4380663_4381533_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
WP_003038048.1|4381745_4382171_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_008785415.1|4382157_4382607_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_048215807.1|4382666_4383242_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_048215808.1|4383335_4384235_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.0	7.2e-24
WP_003835020.1|4384407_4385199_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	1.2e-17
WP_003835019.1|4385356_4386373_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_003038061.1|4386373_4387207_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038064.1|4387206_4388082_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_060683459.1|4388071_4389169_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
WP_060683460.1|4389236_4390148_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.5	1.0e-57
>prophage 327
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4394143	4404016	5080321		Hokovirus(25.0%)	9	NA	NA
WP_008785405.1|4394143_4395871_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_002913505.1|4395916_4396174_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038091.1|4396557_4397529_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_057066948.1|4397692_4398454_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_060683463.1|4398684_4399698_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_060683464.1|4399769_4401785_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.1	2.1e-148
WP_003038102.1|4401786_4402005_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_060683465.1|4402001_4403000_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_032944140.1|4403089_4404016_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	1.3e-07
>prophage 328
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4423166	4423901	5080321		Clostridioides_phage(100.0%)	1	NA	NA
WP_003834866.1|4423166_4423901_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.2e-13
>prophage 329
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4428376	4429297	5080321		Morganella_phage(100.0%)	1	NA	NA
WP_020996694.1|4428376_4429297_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.2e-74
>prophage 330
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4437356	4439255	5080321		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020996691.1|4437356_4439255_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.5	1.9e-13
>prophage 331
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4442454	4443396	5080321		Enterobacteria_phage(100.0%)	1	NA	NA
WP_060683482.1|4442454_4443396_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	1.3e-148
>prophage 332
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4452529	4453615	5080321		Pandoravirus(100.0%)	1	NA	NA
WP_003834825.1|4452529_4453615_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	9.1e-90
>prophage 333
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4460691	4460949	5080321		Ralstonia_phage(100.0%)	1	NA	NA
WP_060683488.1|4460691_4460949_-	DNA-binding protein	NA	A0A0M4UV99	Ralstonia_phage	56.9	3.3e-14
>prophage 334
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4463955	4465092	5080321		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_060683489.1|4463955_4465092_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	1.0e-19
>prophage 335
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4471588	4473106	5080321		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|4471588_4473106_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 336
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4477461	4478235	5080321		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003839331.1|4477461_4478235_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 337
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4492033	4492633	5080321		Salmonella_phage(100.0%)	1	NA	NA
WP_003028083.1|4492033_4492633_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 338
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4511618	4512623	5080321		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_032944079.1|4511618_4512623_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.0	1.1e-28
>prophage 339
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4525307	4533248	5080321	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_060683507.1|4525307_4527290_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	2.8e-20
WP_008785329.1|4527286_4528270_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.2	1.7e-34
WP_060683508.1|4528272_4529412_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.8	3.5e-31
WP_008785327.1|4529695_4530121_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_008785326.1|4530437_4530980_+	membrane protein	NA	NA	NA	NA	NA
WP_060683509.1|4531059_4532256_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_060683510.1|4532294_4533248_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.9	4.0e-65
>prophage 340
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4539128	4553184	5080321		Pseudomonas_phage(33.33%)	9	NA	NA
WP_008785318.1|4539128_4540196_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
WP_057066394.1|4540257_4541136_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048234859.1|4541296_4542487_+	MFS transporter	NA	NA	NA	NA	NA
WP_003027609.1|4542490_4542745_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_060683511.1|4542744_4543875_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	2.8e-174
WP_003834667.1|4543985_4546271_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	7.1e-286
WP_060683512.1|4546689_4547418_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_057066395.1|4547576_4550216_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	8.2e-92
WP_060683513.1|4550337_4553184_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.2e-41
>prophage 341
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4557373	4565915	5080321		Enterobacteria_phage(20.0%)	7	NA	NA
WP_020996678.1|4557373_4558483_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	2.2e-115
WP_008785309.1|4558597_4559650_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_008785307.1|4559729_4560794_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	2.4e-18
WP_008785306.1|4560793_4561444_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_060683515.1|4561519_4563163_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	3.7e-10
WP_060683516.1|4563268_4564705_+	magnesium transporter	NA	NA	NA	NA	NA
WP_060683791.1|4564667_4565915_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	3.1e-81
>prophage 342
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4574716	4575337	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_008785298.1|4574716_4575337_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.0	2.8e-11
>prophage 343
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4584301	4591934	5080321		Vibrio_phage(50.0%)	7	NA	NA
WP_003027504.1|4584301_4585309_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_003027502.1|4585428_4585713_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_060683793.1|4585837_4587598_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	7.1e-100
WP_008785291.1|4587749_4588457_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_060683521.1|4588472_4589663_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.1	2.4e-19
WP_085951589.1|4589996_4590341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683522.1|4590344_4591934_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	2.1e-18
>prophage 344
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4597697	4602000	5080321		Bacillus_phage(50.0%)	4	NA	NA
WP_003834567.1|4597697_4598267_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
WP_060683524.1|4598680_4599394_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003834563.1|4599427_4600414_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_008785284.1|4600533_4602000_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	9.0e-40
>prophage 345
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4619856	4620714	5080321		Catovirus(100.0%)	1	NA	NA
WP_032944004.1|4619856_4620714_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.3	3.4e-23
>prophage 346
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4624762	4626748	5080321		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060683533.1|4624762_4626748_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 347
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4631939	4632608	5080321		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003027410.1|4631939_4632608_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 348
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4636313	4637834	5080321		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|4636313_4637834_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 349
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4649580	4650315	5080321		Streptococcus_phage(100.0%)	1	NA	NA
WP_008785256.1|4649580_4650315_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.0	3.9e-52
>prophage 350
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4661150	4669570	5080321	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_060683543.1|4661150_4662098_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	7.6e-08
WP_060683544.1|4662081_4662813_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|4662793_4662901_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|4662953_4663685_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_060683545.1|4663910_4665596_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.3e-279
WP_003840155.1|4665592_4666312_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|4666358_4666829_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_060683546.1|4666872_4667331_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	9.2e-52
WP_060683547.1|4667536_4669570_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
>prophage 351
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4681344	4685848	5080321		Serratia_phage(50.0%)	4	NA	NA
WP_060683555.1|4681344_4682349_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	1.9e-12
WP_008785233.1|4682345_4683623_-	MFS transporter	NA	NA	NA	NA	NA
WP_060683556.1|4683875_4684928_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_060683557.1|4684948_4685848_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.2	3.1e-11
>prophage 352
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4689111	4691313	5080321		Planktothrix_phage(50.0%)	3	NA	NA
WP_003027295.1|4689111_4689840_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
WP_003834409.1|4690064_4690580_-	lipoprotein	NA	NA	NA	NA	NA
WP_020996661.1|4691100_4691313_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	75.7	5.4e-23
>prophage 353
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4696676	4698395	5080321		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_032943955.1|4696676_4698395_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.2e-30
>prophage 354
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4709749	4723831	5080321	protease,tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_048215946.1|4709749_4711696_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
WP_003036813.1|4711770_4711995_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|4712318_4712639_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|4712669_4714946_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_032943948.1|4715230_4716592_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.2	1.1e-204
WP_008785215.1|4716751_4717084_-	YegP family protein	NA	NA	NA	NA	NA
WP_032943946.1|4717219_4717942_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003834277.1|4717938_4719342_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
WP_060683564.1|4719341_4720754_-	MFS transporter	NA	NA	NA	NA	NA
WP_060683565.1|4720750_4723831_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.6	9.9e-65
>prophage 355
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4734609	4745247	5080321		Catovirus(20.0%)	9	NA	NA
WP_003036776.1|4734609_4735251_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
WP_003834269.1|4735342_4735924_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	4.2e-33
WP_060683569.1|4735950_4737804_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_032941964.1|4737848_4739432_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.2e-37
WP_003834266.1|4740087_4741227_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_008785204.1|4741232_4741682_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_060683570.1|4741678_4743841_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.7e-18
WP_008785202.1|4743913_4744756_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_008785201.1|4744758_4745247_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	9.3e-10
>prophage 356
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4748993	4755730	5080321		Synechococcus_phage(25.0%)	6	NA	NA
WP_048235024.1|4748993_4750115_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	6.9e-133
WP_060683573.1|4750117_4751083_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.3	1.3e-87
WP_048215960.1|4751085_4751565_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_060683574.1|4751561_4752788_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_008785192.1|4752787_4754224_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.9	4.1e-53
WP_060683575.1|4754359_4755730_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.3	5.4e-31
>prophage 357
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4761191	4779364	5080321		Enterobacteria_phage(33.33%)	15	NA	NA
WP_060683580.1|4761191_4762586_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	5.5e-23
WP_060683581.1|4762751_4763645_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.4	1.6e-44
WP_060683582.1|4764015_4765101_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	2.8e-99
WP_060683583.1|4765100_4766000_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.9	8.8e-30
WP_060683584.1|4766051_4766930_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	3.3e-106
WP_060683585.1|4766931_4767477_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	2.3e-49
WP_060683586.1|4767507_4768782_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	27.2	4.9e-26
WP_060683587.1|4768810_4769833_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A1V0SKV4	Klosneuvirus	46.1	2.1e-72
WP_081003619.1|4771134_4772739_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	30.2	4.4e-32
WP_164091711.1|4772665_4772977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683591.1|4772973_4773723_+	DUF616 domain-containing protein	NA	A0A1V0SE58	Indivirus	29.2	7.1e-17
WP_060683592.1|4773724_4774591_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060683594.1|4775631_4776417_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060683595.1|4776555_4777962_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.1e-37
WP_032943916.1|4778197_4779364_+	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.0	2.8e-113
>prophage 358
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4787957	4788857	5080321		Cellulophaga_phage(100.0%)	1	NA	NA
WP_060683602.1|4787957_4788857_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 359
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4796819	4799474	5080321		Escherichia_phage(50.0%)	3	NA	NA
WP_003834185.1|4796819_4797398_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	1.6e-21
WP_060683606.1|4797394_4798162_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_060683607.1|4798301_4799474_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.4	3.2e-197
>prophage 360
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4819131	4819941	5080321		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|4819131_4819941_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 361
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4833435	4834251	5080321		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|4833435_4834251_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 362
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4839220	4839904	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_032669186.1|4839220_4839904_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.1e-27
>prophage 363
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4853792	4854683	5080321		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_164091717.1|4853792_4854683_-	transketolase	NA	A0A0P0YNE1	Yellowstone_lake_phycodnavirus	35.6	2.5e-16
>prophage 364
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4859798	4874518	5080321	integrase	uncultured_Caudovirales_phage(33.33%)	15	4857698:4857710	4864323:4864335
4857698:4857710	attL	ACCATCAGGTGAG	NA	NA	NA	NA
WP_060683631.1|4859798_4861061_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	2.1e-74
WP_032943883.1|4861434_4862199_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_060683632.1|4863778_4866250_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.1	3.4e-108
4864323:4864335	attR	ACCATCAGGTGAG	NA	NA	NA	NA
WP_060683800.1|4866391_4866718_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_060683633.1|4866775_4866991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832307.1|4867209_4867590_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_003832309.1|4867695_4867908_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_060683634.1|4867911_4868466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123969783.1|4868514_4869630_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.1	1.8e-48
WP_122984015.1|4869541_4870087_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.2e-67
WP_060683635.1|4870210_4870564_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_000855179.1|4870611_4870974_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_060683636.1|4870991_4872743_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_060683637.1|4872790_4874080_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	3.0e-172
WP_038641366.1|4874092_4874518_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
>prophage 365
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4877680	4892439	5080321	tail	Enterobacteria_phage(30.77%)	16	NA	NA
WP_060683639.1|4877680_4877914_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	1.3e-30
WP_071845308.1|4877959_4878205_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.5	2.6e-21
WP_060683640.1|4878333_4878534_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	58.5	2.3e-15
WP_060683641.1|4878536_4878896_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_060683642.1|4879947_4880553_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.1	5.6e-81
WP_060683643.1|4880864_4881239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683644.1|4881383_4881572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016150496.1|4882003_4882282_+	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_060683645.1|4882253_4882802_+	lysozyme	NA	K7PM52	Enterobacteria_phage	95.1	2.4e-99
WP_060683646.1|4882798_4883314_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_060683802.1|4883898_4884180_+	hypothetical protein	NA	K7PHM8	Enterobacterial_phage	45.3	1.2e-12
WP_081003626.1|4885033_4885459_+|tail	tail fiber domain-containing protein	tail	W6ASK4	Escherichia_phage	50.0	2.1e-29
WP_060683647.1|4888193_4889351_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.4	8.8e-107
WP_060683648.1|4889791_4890484_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	1.6e-07
WP_060683649.1|4890560_4891961_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	1.4e-103
WP_003839067.1|4891971_4892439_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	8.9e-34
>prophage 366
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4907602	4915960	5080321	integrase	uncultured_Caudovirales_phage(37.5%)	10	4906262:4906276	4917802:4917816
4906262:4906276	attL	CGTTACCGTTGCCGA	NA	NA	NA	NA
WP_060683655.1|4907602_4908898_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	69.1	1.3e-180
WP_060683656.1|4908943_4909189_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	69.2	5.5e-27
WP_123969787.1|4909230_4910640_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	50.4	1.2e-113
WP_060683657.1|4910651_4911092_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	78.1	2.9e-58
WP_060683658.1|4911095_4911521_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	9.5e-35
WP_001117695.1|4911532_4911709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081003627.1|4911701_4913657_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	45.1	5.0e-155
WP_060683660.1|4913656_4914235_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.4	1.7e-63
WP_060683661.1|4914231_4914543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683662.1|4915603_4915960_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	48.7	1.3e-24
4917802:4917816	attR	TCGGCAACGGTAACG	NA	NA	NA	NA
>prophage 367
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4919580	4920812	5080321	tail	Salmonella_phage(50.0%)	2	NA	NA
WP_060683665.1|4919580_4920399_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	61.5	5.2e-29
WP_060683666.1|4920401_4920812_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	41.2	1.9e-08
>prophage 368
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4933188	4933941	5080321		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|4933188_4933941_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 369
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4940084	4941322	5080321	integrase	Enterobacterial_phage(100.0%)	2	4934035:4934094	4946854:4947621
4934035:4934094	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_060683670.1|4940084_4941095_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	87.2	3.6e-173
WP_071845312.1|4941094_4941322_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	85.3	3.9e-35
4946854:4947621	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 370
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4946092	4947880	5080321		Shigella_phage(100.0%)	2	NA	NA
WP_123969789.1|4946092_4946776_-	acyltransferase	NA	Q716G0	Shigella_phage	49.3	3.9e-46
WP_081003629.1|4947616_4947880_-	acyltransferase	NA	Q716G0	Shigella_phage	64.0	8.0e-24
>prophage 371
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4961649	4963164	5080321		Cedratvirus(100.0%)	1	NA	NA
WP_060683804.1|4961649_4963164_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.6e-12
>prophage 372
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4974945	4980591	5080321		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_003833879.1|4974945_4976601_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.6e-08
WP_048224218.1|4976644_4978246_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	1.1e-11
WP_060683686.1|4978265_4979138_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003833872.1|4979134_4980184_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034656.1|4980201_4980591_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 373
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4988604	4995264	5080321	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_003833857.1|4988604_4990338_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	9.8e-86
WP_003833855.1|4990576_4991143_+	VOC family protein	NA	NA	NA	NA	NA
WP_048235198.1|4991145_4991892_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003833851.1|4992126_4993095_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|4993091_4993835_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003833847.1|4993875_4994271_-	membrane protein	NA	NA	NA	NA	NA
WP_060683689.1|4994445_4995264_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 374
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	4999115	5005322	5080321		Bacillus_virus(50.0%)	7	NA	NA
WP_003034867.1|4999115_4999637_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|4999717_5000329_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|5000337_5001348_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|5001426_5002212_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003833829.1|5002208_5002964_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	8.5e-18
WP_003844151.1|5003042_5003987_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003833825.1|5004002_5005322_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
>prophage 375
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	5009255	5010731	5080321		Cyanophage(100.0%)	1	NA	NA
WP_003833817.1|5009255_5010731_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	1.9e-77
>prophage 376
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	5016411	5020160	5080321		Organic_Lake_phycodnavirus(33.33%)	4	NA	NA
WP_060683692.1|5016411_5018490_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.3e-31
WP_003833802.1|5018480_5019143_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_008785043.1|5019166_5019823_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|5019929_5020160_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
>prophage 377
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	5023508	5025343	5080321		uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_003844141.1|5023508_5024087_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	36.5	3.2e-17
WP_003844140.1|5024440_5025343_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
>prophage 378
NZ_CP012554	Citrobacter portucalensis strain P10159 chromosome, complete genome	5080321	5029499	5072597	5080321	plate,capsid,head,tail,portal,integrase	Enterobacteria_phage(45.95%)	58	5029398:5029428	5071777:5071807
5029398:5029428	attL	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_060683695.1|5029499_5030585_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.7	2.8e-147
WP_071845316.1|5030553_5030826_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	62.2	1.6e-27
WP_003841647.1|5030890_5031133_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	1.3e-33
WP_060683696.1|5031119_5031323_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
WP_060683697.1|5031315_5031660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683698.1|5031694_5032807_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	92.4	2.2e-192
WP_060683699.1|5032818_5035581_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	64.8	0.0e+00
WP_053389201.1|5035721_5035883_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.5	7.7e-22
WP_016156718.1|5035894_5036101_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
WP_123969791.1|5036564_5036975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060683701.1|5036980_5037571_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071845318.1|5037965_5038391_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	2.9e-47
WP_060683703.1|5038463_5038682_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.0	2.9e-19
WP_060683704.1|5038693_5039233_+	regulator	NA	K7PJT7	Enterobacteria_phage	83.8	1.7e-76
WP_016156235.1|5039400_5040348_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.7	3.8e-23
WP_060683705.1|5040350_5041100_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	87.6	5.6e-123
WP_060683706.1|5041118_5041430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683707.1|5041426_5041903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683708.1|5041904_5042135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236996.1|5043699_5043933_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	98.7	6.6e-38
WP_001568777.1|5044050_5044299_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_060683710.1|5044333_5044933_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.0	1.9e-105
WP_060683711.1|5044932_5045139_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	77.3	1.1e-25
WP_060683712.1|5045141_5045750_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	64.0	2.2e-48
WP_001664172.1|5045746_5045887_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.5	1.0e-17
WP_060682531.1|5045883_5046693_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.6	5.3e-111
WP_060683741.1|5046889_5047300_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_016150496.1|5047548_5047827_+	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_061350480.1|5047804_5048371_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	100.0	1.9e-107
WP_001548471.1|5048370_5048913_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	90.4	1.6e-71
WP_001548472.1|5048943_5049237_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.1	1.1e-21
WP_060682530.1|5049296_5049935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682529.1|5049945_5050449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210383.1|5050739_5051309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515591.1|5051250_5053374_+	hypothetical protein	NA	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
WP_000483309.1|5053382_5053646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682528.1|5053645_5055283_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	5.6e-91
WP_001052909.1|5055279_5056146_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_060682527.1|5056147_5056738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472189.1|5056737_5057142_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000427679.1|5057239_5058289_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
WP_060682526.1|5058260_5058671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537794.1|5058675_5059035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083242.1|5059031_5059577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682525.1|5059580_5059778_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_060682524.1|5059774_5061277_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.4	7.1e-101
WP_000896638.1|5061280_5061652_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000807719.1|5061653_5061932_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_060682523.1|5062073_5063933_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	40.9	5.5e-18
WP_001139208.1|5064276_5065680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515585.1|5065676_5066762_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	31.5	7.6e-44
WP_060682522.1|5066758_5067343_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	6.3e-05
WP_001279799.1|5067339_5067777_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_060682521.1|5067778_5068921_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.3	6.2e-12
WP_060683713.1|5070363_5070645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081003630.1|5070653_5070773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060683714.1|5070802_5071471_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	5.3e-80
WP_057066820.1|5071955_5072597_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	50.2	1.3e-56
5071777:5071807	attR	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
