The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	1082644	1090561	5059732		Escherichia_phage(83.33%)	6	NA	NA
WP_001279003.1|1082644_1083283_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590420.1|1083279_1084542_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1084538_1085447_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001272542.1|1085612_1086410_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001555984.1|1087669_1087894_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	5.8e-07
WP_000103864.1|1087999_1090561_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
>prophage 2
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	1166090	1248156	5059732	tail,portal,protease,plate,lysis,head,capsid,tRNA,terminase	Shigella_phage(44.23%)	88	NA	NA
WP_000531794.1|1166090_1167263_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
WP_001331174.1|1167223_1167430_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|1167471_1168338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008234.1|1168446_1168971_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_000081287.1|1169098_1169923_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135691.1|1169988_1170351_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000500990.1|1170819_1171332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1171534_1172209_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|1172299_1172500_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|1172543_1173095_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|1173270_1173450_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104933.1|1173439_1174381_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001332382.1|1174377_1174872_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_001332383.1|1174871_1175525_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_000210172.1|1175521_1175848_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|1175844_1176234_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061411.1|1176253_1177051_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_001350764.1|1177058_1178048_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001047143.1|1178061_1178814_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_000606308.1|1178999_1179335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180490.1|1179779_1180256_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000092331.1|1180252_1180690_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001332386.1|1180760_1181012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135216.1|1181660_1182011_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000929172.1|1182136_1182631_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_072011717.1|1182864_1184361_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605604.1|1184372_1184555_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466267.1|1184554_1185796_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_001193631.1|1185773_1186424_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|1186438_1187644_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601360.1|1187693_1187894_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1187896_1188220_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702385.1|1188216_1188627_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000213503.1|1188601_1189108_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000779291.1|1189104_1189665_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000497751.1|1189673_1189844_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155718.1|1189827_1191324_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000090998.1|1191323_1191680_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661051.1|1191679_1191949_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000807182.1|1192090_1193926_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_001350765.1|1193986_1195315_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000999498.1|1195311_1196391_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_000103707.1|1196390_1196939_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424731.1|1196938_1197364_+	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000785328.1|1197350_1198409_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000539246.1|1198399_1198984_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000554665.1|1198987_1199731_+|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000356380.1|1199730_1200333_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|1200304_1200748_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_001115559.1|1200750_1201242_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_000834402.1|1201495_1203385_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000353910.1|1204436_1205210_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000174562.1|1205420_1205714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183405.1|1205801_1206590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|1207746_1208229_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1208360_1208837_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1208826_1209117_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1209178_1209520_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880938.1|1209668_1211330_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1211415_1212294_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001332400.1|1212416_1213010_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077634785.1|1213064_1214351_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|1214371_1215238_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1215329_1216691_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1216827_1217076_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1217094_1217643_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1217673_1218441_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1218482_1218830_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589793.1|1218906_1219389_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969016.1|1219404_1220631_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1220620_1221139_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|1221287_1221653_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168025.1|1221862_1222933_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225230.1|1222943_1224065_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200106.1|1224107_1225268_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1225366_1225414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1225517_1225859_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1226128_1226866_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079114.1|1227000_1227981_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040118.1|1227977_1228709_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001350770.1|1228838_1231412_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_001298619.1|1239900_1241199_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_000464873.1|1241195_1241540_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1241564_1242920_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082937.1|1243033_1245694_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298618.1|1245725_1246424_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1246492_1246912_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997387.1|1247118_1248156_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	1469437	1511043	5059732	portal,protease,integrase,lysis,head,terminase,holin,coat	Enterobacteria_phage(96.61%)	60	1478671:1478687	1523122:1523138
WP_001163428.1|1469437_1469638_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545737.1|1469695_1469863_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002106.1|1469935_1470220_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000253289.1|1470212_1470497_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000161575.1|1470496_1471069_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000215166.1|1471070_1471370_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000812193.1|1471366_1471885_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_001111304.1|1471979_1472276_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951332.1|1472299_1472683_-	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_000031365.1|1472682_1473288_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_001243355.1|1473544_1473697_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1473681_1473813_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000392426.1|1474996_1475419_-	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000213976.1|1475477_1475678_-	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000219338.1|1475756_1476056_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_011478232.1|1476067_1476457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856967.1|1476577_1477228_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1477308_1477494_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1477602_1477896_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1477918_1478191_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_001350936.1|1478193_1479141_+	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
1478671:1478687	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_001248381.1|1479137_1480514_+	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_000736904.1|1480788_1481229_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001254255.1|1481225_1481402_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386637.1|1481404_1481752_+	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_000950950.1|1481744_1481921_+	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_001004257.1|1481913_1482636_+	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000002245.1|1482635_1482926_+	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001008199.1|1482922_1483285_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1483281_1483470_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027549.1|1483466_1483985_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000783734.1|1484581_1484905_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1484888_1485365_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_001350934.1|1485361_1485799_+|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_001139680.1|1485786_1485939_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001109020.1|1486144_1486687_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_000807788.1|1486914_1487157_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113731.1|1487159_1487600_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000200779.1|1487596_1489012_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000818371.1|1489013_1491212_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000372589.1|1491302_1492196_+	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000013270.1|1492214_1493468_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_001362792.1|1493509_1493698_+	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1493678_1494140_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122367.1|1494149_1495568_+	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_000785531.1|1495567_1496269_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_000627629.1|1496268_1496724_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000964906.1|1496726_1497419_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	100.0	6.6e-118
WP_000246973.1|1497429_1498779_+	phage DNA ejection protein	NA	A5VW65	Enterobacteria_phage	100.0	4.5e-248
WP_001029855.1|1498778_1500938_+	hypothetical protein	NA	A5VW64	Enterobacteria_phage	100.0	0.0e+00
WP_000288815.1|1500938_1501262_-	hypothetical protein	NA	A5VW63	Enterobacteria_phage	100.0	4.9e-23
WP_000431541.1|1501284_1501704_-	hypothetical protein	NA	A5VW62	Enterobacteria_phage	100.0	1.6e-74
WP_001555940.1|1501688_1502270_-	hypothetical protein	NA	A5VW61	Enterobacteria_phage	100.0	1.7e-103
WP_001555939.1|1502330_1502579_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	100.0	3.1e-38
WP_001283825.1|1502602_1502860_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	100.0	4.5e-40
WP_000865489.1|1502965_1503106_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835351.1|1503369_1504293_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	100.0	1.7e-177
WP_000129909.1|1504393_1507339_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	100.0	0.0e+00
WP_000958671.1|1508641_1509799_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368123.1|1510110_1511043_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1523122:1523138	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
>prophage 4
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	1748703	1758148	5059732		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569345.1|1748703_1749630_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783132.1|1749634_1750366_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1750346_1750454_-	protein YohO	NA	NA	NA	NA	NA
WP_001240394.1|1750513_1751245_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001295431.1|1751466_1753152_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1753148_1753868_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1753914_1754385_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1754425_1754887_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001332210.1|1755011_1757015_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001292784.1|1757011_1758148_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 5
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	1855147	1863956	5059732		Enterobacteria_phage(57.14%)	8	NA	NA
WP_001116035.1|1855147_1856542_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	6.3e-19
WP_000183053.1|1856716_1857610_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699397.1|1857982_1859068_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_001023638.1|1859067_1859967_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857501.1|1860024_1860900_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100795.1|1860907_1861465_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000052607.1|1861461_1862709_+	O18 family O-antigen flippase	NA	NA	NA	NA	NA
WP_105453002.1|1862810_1863956_+	O18ab/O18ac family O-antigen polymerase	NA	Q9AYY5	Salmonella_phage	42.9	5.3e-80
>prophage 6
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	2666928	2730462	5059732	tail,portal,protease,integrase,head,capsid,lysis,terminase,holin	Enterobacteria_phage(34.0%)	73	2671651:2671666	2737828:2737843
WP_000422062.1|2666928_2667978_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559260.1|2668197_2668956_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_001278741.1|2668952_2669543_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2669581_2670457_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|2670669_2672565_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2671651:2671666	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|2672592_2673213_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|2673209_2674091_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2674228_2674273_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|2674364_2675927_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2675926_2677522_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|2677525_2678884_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209529.1|2678895_2680089_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|2680088_2680895_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|2681275_2681455_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|2681540_2682041_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|2682086_2682593_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|2683365_2683635_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2683691_2684360_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|2684414_2684999_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000216497.1|2684998_2688106_-	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_001233195.1|2688257_2688857_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000515773.1|2688924_2692404_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001332187.1|2692470_2692809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2692882_2693485_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140762.1|2693421_2694165_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2694169_2694868_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2694867_2695197_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082348.1|2695193_2697767_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|2697747_2698161_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479101.1|2698187_2698619_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.1e-41
WP_000235110.1|2698632_2699385_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2699392_2699788_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2699784_2700318_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_042016705.1|2700333_2700687_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.1e-40
WP_000201495.1|2700679_2701063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522591.1|2701114_2702143_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2702200_2702548_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253958.1|2702584_2704090_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000831813.1|2704079_2705672_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
WP_000259002.1|2705668_2705875_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622378.1|2705858_2707787_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000867575.1|2707758_2708307_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001331705.1|2708693_2708927_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000057035.1|2708984_2709395_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001082537.1|2709702_2710167_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000992052.1|2710465_2710999_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001351274.1|2711104_2711377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|2711342_2711687_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|2711691_2711907_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331708.1|2712056_2712218_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
WP_001331709.1|2712175_2712403_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000935515.1|2713677_2714727_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2714877_2715075_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762880.1|2715299_2716121_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|2716117_2716492_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|2716504_2717551_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|2717552_2717831_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001013637.1|2717998_2718211_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_122083109.1|2718255_2718363_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_014639476.1|2720565_2721528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151216.1|2721719_2722142_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_001262357.1|2722182_2723253_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|2723324_2723750_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2723733_2723976_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|2724367_2724706_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2724998_2725154_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2725313_2725535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2725535_2725700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2726100_2726289_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2726285_2726477_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048435.1|2726569_2729041_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2729105_2729354_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2729331_2730462_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2737828:2737843	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	2835139	2920491	5059732	tail,portal,plate,integrase,protease,head,capsid,transposase,lysis,tRNA,terminase	Enterobacteria_phage(35.42%)	123	2866388:2866403	2919445:2919460
WP_000983714.1|2835139_2835967_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.1e-07
WP_001101730.1|2835963_2836821_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|2836817_2837675_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000355360.1|2837766_2838060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654167.1|2838072_2838351_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2838347_2840408_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000904922.1|2840831_2841404_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_024189672.1|2841505_2841979_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	45.4	2.1e-30
WP_001529038.1|2841989_2842463_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_001529037.1|2842469_2843084_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077817332.1|2843083_2844715_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.0	6.5e-39
WP_000138756.1|2844717_2845296_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|2845288_2846392_-	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859116.1|2846382_2846730_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|2846784_2847381_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001529032.1|2847377_2848550_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_012602373.1|2848537_2848753_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_053811550.1|2848749_2849634_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	45.8	1.1e-53
WP_001529030.1|2849633_2852846_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_001202894.1|2852921_2853080_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|2853003_2853339_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|2853436_2853718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|2853720_2854242_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|2854241_2855669_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_032144500.1|2855658_2855913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101802.1|2855909_2856374_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	9.1e-39
WP_000271668.1|2856373_2856820_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2856821_2857160_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|2857169_2858123_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001702163.1|2858137_2859253_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.4	1.2e-97
WP_000135514.1|2859467_2859926_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|2859928_2860750_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090685.1|2860730_2862227_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	4.0e-168
WP_001404333.1|2862226_2863759_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.0	2.1e-185
WP_000124060.1|2863818_2864364_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|2864363_2864675_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2864674_2865001_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264661.1|2864997_2865648_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_053811551.1|2865631_2866372_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.0	9.4e-62
WP_000793146.1|2866374_2866725_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
2866388:2866403	attL	GCAACAGCCAGGCAGA	NA	NA	NA	NA
WP_000149906.1|2866855_2867332_+	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_001330012.1|2867369_2867957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042017008.1|2868041_2869028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259268.1|2869024_2869486_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000200153.1|2869536_2869725_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_000049025.1|2869777_2870086_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000533821.1|2870096_2871011_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_001529009.1|2871014_2872784_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.7	1.6e-229
WP_000960680.1|2872794_2873961_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843446.1|2873963_2874233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2874260_2874791_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632580.1|2875079_2875352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|2875361_2875658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|2875672_2875888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132037.1|2875884_2876568_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
WP_000631819.1|2876564_2876795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001702170.1|2876784_2877000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988472.1|2876989_2877442_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
WP_001281695.1|2877413_2877803_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_077817333.1|2877932_2881166_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	94.3	0.0e+00
WP_000090917.1|2881226_2881859_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2881795_2882539_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|2882544_2883243_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2883242_2883572_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2883568_2886130_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|2886122_2886557_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|2886538_2886961_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|2886976_2887717_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683145.1|2887724_2888120_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2888116_2888695_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2888706_2889060_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2889052_2889427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|2889478_2890507_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000256840.1|2890564_2890912_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253914.1|2890948_2892454_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|2892443_2894036_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|2894032_2894239_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001304453.1|2894222_2896151_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867568.1|2896122_2896671_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2897233_2897416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2897622_2897949_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2898429_2898723_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2898813_2898996_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2899212_2899710_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2899709_2899925_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2900513_2901596_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2901784_2902168_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2902253_2902394_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2902390_2902753_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2902772_2902967_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2902959_2903301_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2903303_2903480_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2903476_2904004_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2904000_2904441_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2904514_2904805_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2904801_2905503_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2905499_2906399_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2906431_2906728_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2906869_2907085_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2907160_2907856_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2907895_2908453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2908449_2909202_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2909478_2909661_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2909638_2909911_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2909927_2910509_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2910722_2910923_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2911105_2911474_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2911546_2911711_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2911679_2911823_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2911898_2912195_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2912200_2912986_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2912982_2913663_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2913659_2913842_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2913814_2914006_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|2914392_2914614_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2914613_2914940_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2914923_2915163_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2915302_2915539_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2915528_2916671_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2916784_2918035_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2918206_2918860_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_053811552.1|2918869_2919331_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2919384_2920491_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2919445:2919460	attR	TCTGCCTGGCTGTTGC	NA	NA	NA	NA
>prophage 8
NZ_CP012631	Escherichia coli strain SF-173 chromosome, complete genome	5059732	3209687	3307557	5059732	tail,portal,plate,protease,integrase,lysis,head,capsid,tRNA,terminase	Salmonella_phage(55.93%)	96	3244195:3244209	3310969:3310983
WP_000886683.1|3209687_3210980_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|3211070_3212414_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3212424_3213036_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077108.1|3213194_3217238_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3217372_3217867_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3218410_3219376_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043637.1|3219498_3221265_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_001202197.1|3221265_3222987_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001241673.1|3223028_3223733_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3224017_3224236_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350182.1|3225277_3225832_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029748.1|3225842_3226844_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000415806.1|3227774_3229082_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101565.1|3229411_3232645_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000097881.1|3232641_3233625_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|3234517_3236794_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3236824_3237145_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3237467_3237692_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|3237764_3239711_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746477.1|3239707_3240823_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|3240973_3241930_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599804.1|3241926_3243585_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3244010_3244706_+	aquaporin Z	NA	NA	NA	NA	NA
3244195:3244209	attL	TTAACCCGGCGGTCA	NA	NA	NA	NA
WP_000491135.1|3245026_3245926_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3246069_3247722_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178694.1|3247733_3248702_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815373.1|3248834_3250553_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000566391.1|3250589_3251591_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136572.1|3251601_3253032_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3253130_3254144_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255187.1|3254140_3254971_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|3254967_3255291_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001298306.1|3255416_3255932_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3256149_3256878_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3256895_3257627_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|3257633_3258350_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3258349_3259018_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001555857.1|3259243_3259975_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149763.1|3260003_3261131_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_000389260.1|3261171_3261660_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3261719_3262565_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000126095.1|3264754_3265867_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3266216_3266693_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3266780_3267683_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|3267743_3268466_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|3268449_3268737_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|3268896_3269154_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|3269183_3269561_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3269830_3271516_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3271751_3271970_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|3272060_3273161_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000980413.1|3273157_3273643_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_021523877.1|3273639_3276717_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3276709_3276829_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_021523876.1|3276843_3277146_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.2e-39
WP_021523875.1|3277200_3277716_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	1.4e-88
WP_021523874.1|3277725_3278898_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	3.9e-203
WP_021523873.1|3279040_3279607_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	3.8e-87
WP_001174921.1|3280035_3280476_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	2.3e-52
WP_021523888.1|3280447_3281041_-|tail	phage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.4	1.3e-58
WP_053811555.1|3281040_3282621_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.7	2.4e-179
WP_001086820.1|3282617_3283223_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_021523871.1|3283215_3284124_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_000177580.1|3284110_3284470_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021523870.1|3284466_3285045_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	3.6e-93
WP_000829122.1|3285113_3285560_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_021523869.1|3285552_3285984_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
WP_021523868.1|3286079_3286508_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	2.2e-47
WP_000727856.1|3286504_3286882_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_021523867.1|3286883_3287396_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.5	3.4e-87
WP_021523866.1|3287376_3287592_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
WP_000868175.1|3287595_3287799_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_021523865.1|3287798_3288263_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.0e-75
WP_000059191.1|3288358_3289009_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_021523864.1|3289012_3290068_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.3	2.4e-180
WP_021523863.1|3290084_3290918_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.2	4.8e-123
WP_001098431.1|3291060_3292827_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_021523862.1|3292826_3293861_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	1.7e-170
WP_021523861.1|3293916_3294096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001485637.1|3294175_3294373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523857.1|3295401_3296106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523856.1|3296102_3297014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050515810.1|3297029_3297563_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	42.1	8.9e-30
WP_021523854.1|3297748_3297919_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.4	7.4e-23
WP_021541826.1|3298071_3300486_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_000145290.1|3301335_3301638_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_021523850.1|3301634_3301862_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.0e-35
WP_021523849.1|3301861_3302095_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_001747374.1|3302162_3302504_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956187.1|3302621_3302918_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_000460893.1|3302925_3303435_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000187759.1|3303467_3303689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009712.1|3303814_3304693_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.7	1.6e-31
WP_021523848.1|3304708_3305737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608638.1|3305733_3306414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290951.1|3306504_3307557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.8e-106
3310969:3310983	attR	TTAACCCGGCGGTCA	NA	NA	NA	NA
>prophage 1
NZ_CP012632	Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence	93074	37434	76737	93074	integrase,transposase	Escherichia_phage(15.38%)	49	52119:52148	73644:73673
WP_001143759.1|37434_40440_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.8	0.0e+00
WP_021521279.1|41230_41437_+	microcin B17	NA	NA	NA	NA	NA
WP_000243884.1|41463_42351_+	McbB family protein	NA	NA	NA	NA	NA
WP_001528601.1|42352_43171_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_000611492.1|43151_44342_+	microcin B17-processing protein mcbD	NA	NA	NA	NA	NA
WP_000258040.1|44351_45077_+	microcin B17 immunity protein McbE	NA	NA	NA	NA	NA
WP_000155032.1|45073_45805_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	4.4e-11
WP_000351266.1|45808_46372_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001311056.1|47089_47572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053811580.1|47688_48537_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	2.3e-27
WP_000970000.1|48582_48864_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079928.1|48860_49130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162490202.1|49202_49343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130646.1|50045_50903_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|50895_50970_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_053811581.1|51207_51468_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071882631.1|51707_52091_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
52119:52148	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000429836.1|52143_52578_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|52649_53000_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|53013_53289_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|53324_53747_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|53798_55493_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|55510_55873_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|55869_56106_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|56141_56810_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|56848_58153_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067834.1|58199_58904_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|59025_59931_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|59927_61166_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|61165_61750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|62242_63007_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|63233_63539_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|63549_64755_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|64910_65114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|65241_66081_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|66074_66422_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|66585_67377_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|67382_67673_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|67784_68282_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|68426_69440_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|69642_69993_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|70118_70679_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|70681_73648_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_115915005.1|73616_73874_-	hypothetical protein	NA	NA	NA	NA	NA
73644:73673	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_001298565.1|73911_74121_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233838.1|74166_74628_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|74872_75085_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139321.1|75213_75774_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|75876_76737_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
