The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1155218	1162358	5142799		Escherichia_phage(83.33%)	6	NA	NA
WP_001279003.1|1155218_1155857_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590420.1|1155853_1157116_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1157112_1158021_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001272542.1|1158186_1158984_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141302.1|1159034_1159691_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_000103864.1|1159796_1162358_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
>prophage 2
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1237877	1356583	5142799	integrase,capsid,tail,plate,portal,protease,terminase,holin,head,tRNA,lysis	Shigella_phage(23.96%)	139	1285777:1285793	1360104:1360120
WP_000531794.1|1237877_1239050_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
WP_001331174.1|1239010_1239217_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|1239258_1240125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008234.1|1240233_1240758_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_000081287.1|1240885_1241710_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135691.1|1241775_1242138_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000500990.1|1242606_1243119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1243321_1243996_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|1244086_1244287_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|1244330_1244882_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|1245057_1245237_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104933.1|1245226_1246168_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001332382.1|1246164_1246659_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_001350763.1|1246658_1247312_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	4.7e-126
WP_000210172.1|1247308_1247635_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|1247631_1248021_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061411.1|1248040_1248838_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_001350764.1|1248845_1249835_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001047143.1|1249848_1250601_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_000606308.1|1250786_1251122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000544527.1|1251273_1251579_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_001180490.1|1251565_1252042_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000092331.1|1252038_1252476_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001332386.1|1252546_1252798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026993.1|1252904_1253345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135216.1|1253447_1253798_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000929170.1|1253923_1254418_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	7.3e-87
WP_072011717.1|1254651_1256148_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605604.1|1256159_1256342_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466267.1|1256341_1257583_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_001193631.1|1257560_1258211_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|1258225_1259431_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601360.1|1259480_1259681_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1259683_1260007_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702385.1|1260003_1260414_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000213503.1|1260388_1260895_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000779291.1|1260891_1261452_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000497751.1|1261460_1261631_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155718.1|1261614_1263111_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000090998.1|1263110_1263467_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661051.1|1263466_1263736_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000807182.1|1263877_1265713_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_001350765.1|1265773_1267102_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000999498.1|1267098_1268178_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_000103707.1|1268177_1268726_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424731.1|1268725_1269151_+	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000539246.1|1270185_1270770_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000554665.1|1270773_1271517_+|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000356380.1|1271516_1272119_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|1272090_1272534_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_001115559.1|1272536_1273028_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_000834402.1|1273281_1275171_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000353910.1|1276222_1276996_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000174562.1|1277206_1277500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183405.1|1277587_1278376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|1279532_1280015_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1280146_1280623_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1280612_1280903_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1280964_1281306_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880938.1|1281454_1283116_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1283201_1284080_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001332400.1|1284202_1284796_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1284850_1286137_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1285777:1285793	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001189257.1|1286157_1287024_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1287115_1288477_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1288613_1288862_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1288880_1289429_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1289459_1290227_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1290268_1290616_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000972010.1|1290760_1290979_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_001407014.1|1291054_1292224_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.1	9.8e-207
WP_001407015.1|1292220_1292706_-|tail	phage tail protein	tail	O80317	Escherichia_phage	94.4	2.6e-81
WP_001407016.1|1292719_1295164_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	91.9	0.0e+00
WP_001407017.1|1295156_1295276_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.7e-13
WP_001029728.1|1295308_1295644_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	98.2	8.8e-52
WP_001207675.1|1295707_1296226_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001622317.1|1296241_1297420_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	96.2	9.9e-215
WP_001029791.1|1297551_1298148_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	80.7	1.2e-88
WP_001622316.1|1298147_1299173_-	hypothetical protein	NA	A0A2I8TVA9	Erwinia_phage	73.0	2.6e-134
WP_001622314.1|1299169_1299778_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	98.5	1.5e-113
WP_000246679.1|1299770_1300679_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	97.7	5.0e-158
WP_000127180.1|1300685_1301033_-	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	99.1	7.2e-57
WP_021524765.1|1301029_1301665_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	90.0	6.5e-104
WP_060710302.1|1301879_1302362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544870.1|1302354_1302999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001622309.1|1303053_1303500_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	92.5	4.6e-64
WP_001437785.1|1303492_1303960_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
WP_001384078.1|1303922_1304096_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_000697867.1|1304067_1304481_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.9	9.5e-64
WP_001622308.1|1304477_1304975_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	91.5	1.1e-87
WP_000134662.1|1304961_1305258_-|holin	holin	holin	O80308	Escherichia_phage	98.0	6.4e-46
WP_000870100.1|1305261_1305465_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	89.6	1.8e-28
WP_000214251.1|1305464_1305974_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	97.6	5.6e-90
WP_000203477.1|1306067_1306817_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	90.8	1.0e-116
WP_001622304.1|1306821_1307889_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.2	4.9e-197
WP_001085938.1|1307965_1308820_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	82.0	5.1e-128
WP_001622303.1|1308985_1310755_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	98.8	0.0e+00
WP_000517961.1|1310756_1311803_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.8	9.8e-190
WP_001622301.1|1311880_1312885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001622299.1|1313360_1314302_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	90.4	4.4e-165
WP_001622297.1|1314376_1314586_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	89.7	8.5e-29
WP_001622296.1|1314785_1315016_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	71.1	4.4e-26
WP_000232651.1|1315019_1315202_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	98.3	4.5e-26
WP_001622294.1|1315315_1317538_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.6	0.0e+00
WP_000752601.1|1317539_1317761_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	97.3	2.4e-34
WP_001246238.1|1317760_1317988_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.0e-31
WP_000963463.1|1318055_1318394_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_000920167.1|1318357_1318558_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	95.5	1.1e-30
WP_000459335.1|1318565_1319075_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_001278195.1|1319107_1319479_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	98.4	2.3e-61
WP_000093633.1|1319600_1320461_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	98.3	8.4e-163
WP_000823621.1|1320469_1320808_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	97.3	3.7e-58
WP_000218689.1|1320830_1321880_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	91.1	1.2e-190
WP_000589793.1|1322052_1322535_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969016.1|1322550_1323777_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1323766_1324285_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|1324433_1324799_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168025.1|1325008_1326079_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225230.1|1326089_1327211_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200106.1|1327253_1328414_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1328512_1328560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1328663_1329005_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1329274_1330012_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079096.1|1330146_1331127_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040118.1|1331123_1331855_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001350770.1|1331984_1334558_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_001298619.1|1343039_1344338_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_000464873.1|1344334_1344679_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1344703_1346059_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082937.1|1346172_1348833_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298618.1|1348864_1349563_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1349631_1350051_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997387.1|1350257_1351295_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1351342_1352032_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|1352336_1352720_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189209.1|1352775_1353363_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001350886.1|1353465_1354347_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1354379_1355714_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|1355845_1356583_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
1360104:1360120	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
>prophage 3
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1440458	1485507	5142799	integrase,terminase,holin	Escherichia_phage(54.9%)	54	1433511:1433528	1464653:1464670
1433511:1433528	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_001296289.1|1440458_1441925_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1441993_1443571_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_021524762.1|1443763_1445014_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.6	2.6e-237
WP_001077943.1|1445017_1445212_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_000163459.1|1445208_1445859_-	adenine methylase	NA	G9L699	Escherichia_phage	99.1	2.5e-127
WP_001341620.1|1445851_1446103_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|1446260_1446509_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_021524761.1|1446558_1447581_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.4	1.7e-175
WP_000983425.1|1447590_1448490_-	endonuclease	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
WP_021524760.1|1448486_1448786_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	91.9	6.0e-44
WP_021524759.1|1448793_1449828_-	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	48.2	9.4e-36
WP_000836290.1|1450139_1450724_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1450878_1451109_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_021524758.1|1451450_1452281_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.4	1.7e-152
WP_001561060.1|1452252_1453029_+	hypothetical protein	NA	G9L6A9	Escherichia_phage	99.6	3.0e-151
WP_001231252.1|1453146_1453491_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	4.8e-61
WP_021524756.1|1453552_1454032_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	92.7	1.1e-50
WP_021524755.1|1454028_1454334_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	87.9	2.0e-42
WP_021524754.1|1454320_1454893_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	98.9	5.8e-104
WP_021524753.1|1455170_1455452_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	2.0e-49
WP_021515113.1|1455444_1455783_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	2.2e-58
WP_024186774.1|1455823_1456498_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	2.0e-119
WP_021524752.1|1456494_1457970_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	3.2e-295
WP_001280570.1|1458060_1458432_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	98.4	3.2e-63
WP_001550154.1|1459130_1459337_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	58.8	7.4e-09
WP_021524751.1|1459351_1461031_+	hypothetical protein	NA	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.7	2.6e-301
WP_000133160.1|1461027_1461324_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_021527914.1|1461326_1462022_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	99.6	3.0e-94
WP_000268715.1|1462036_1463023_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627061.1|1463074_1463512_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	3.1e-73
WP_000012377.1|1463522_1463858_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424495.1|1463908_1464232_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000179259.1|1464231_1464837_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
1464653:1464670	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
WP_021527913.1|1464836_1467308_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000640916.1|1467307_1467772_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	100.0	6.4e-85
WP_000332877.1|1467771_1468347_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_021527912.1|1468346_1470860_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.1	0.0e+00
WP_021527911.1|1470856_1472659_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	96.3	0.0e+00
WP_021527910.1|1472664_1475139_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.2	0.0e+00
WP_001147903.1|1475334_1475631_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	6.2e-49
WP_000708858.1|1475662_1475824_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001154803.1|1475917_1476466_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_001609225.1|1476392_1476719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016236144.1|1476840_1477551_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.1	1.8e-102
WP_001188252.1|1477866_1478124_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_021527909.1|1478319_1481439_+	endo-alpha-sialidase	NA	A5VW57	Enterobacteria_phage	95.6	0.0e+00
WP_001276090.1|1481745_1482150_+	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000256103.1|1482136_1482445_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001567213.1|1482434_1483064_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.4e-113
WP_001336051.1|1483060_1483543_+	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	6.9e-74
WP_000755178.1|1483761_1484301_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001311989.1|1484316_1484835_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|1485145_1485337_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017553.1|1485354_1485507_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
>prophage 4
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1612675	1653805	5142799	integrase,head,coat,terminase,holin,portal,lysis	Enterobacteria_phage(77.36%)	57	1612586:1612602	1652721:1652737
1612586:1612602	attL	AATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1612675_1612876_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545737.1|1612933_1613101_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002106.1|1613173_1613458_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000161575.1|1613735_1614308_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000215166.1|1614309_1614609_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_021524750.1|1614605_1615124_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	99.4	4.6e-92
WP_001111304.1|1615218_1615515_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951332.1|1615538_1615922_-	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_000031365.1|1615921_1616527_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000167596.1|1617148_1617619_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_000219332.1|1617627_1617927_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000856967.1|1618448_1619099_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1619179_1619365_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1619473_1619767_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1619789_1620062_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_001350936.1|1620064_1621012_+	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
WP_001248388.1|1621008_1622385_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000229808.1|1622457_1622664_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000814617.1|1623293_1623704_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001254264.1|1623700_1623877_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000177653.1|1623873_1624299_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_000950973.1|1624291_1624468_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_001004257.1|1624460_1625183_+	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000002245.1|1625182_1625473_+	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001008199.1|1625469_1625832_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1625828_1626017_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027549.1|1626013_1626532_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000783734.1|1627128_1627452_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1627435_1627912_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_001350934.1|1627908_1628346_+|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_001139680.1|1628333_1628486_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001109020.1|1628691_1629234_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_000807788.1|1629461_1629704_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113731.1|1629706_1630147_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000200779.1|1630143_1631559_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000818371.1|1631560_1633759_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000372589.1|1633849_1634743_+	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000370106.1|1634761_1636015_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_001389518.1|1636056_1636245_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1636225_1636687_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122367.1|1636696_1638115_+	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_000785531.1|1638114_1638816_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_000627629.1|1638815_1639271_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000964905.1|1639273_1639966_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000257015.1|1639976_1641428_+	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_001622250.1|1641424_1641634_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	82.2	2.8e-11
WP_060710304.1|1641659_1643441_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.0	1.2e-91
WP_011703616.1|1643458_1643788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064337.1|1643984_1644551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|1644559_1645009_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000903306.1|1645057_1645594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051911.1|1645593_1645842_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000410001.1|1645956_1646109_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001350929.1|1646341_1647244_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000129907.1|1647344_1650290_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_000958671.1|1651403_1652561_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368123.1|1652872_1653805_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1652721:1652737	attR	AATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 5
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1891448	1900893	5142799		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569345.1|1891448_1892375_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783132.1|1892379_1893111_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1893091_1893199_-	protein YohO	NA	NA	NA	NA	NA
WP_001240394.1|1893258_1893990_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001295431.1|1894211_1895897_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1895893_1896613_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1896659_1897130_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1897170_1897632_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001332210.1|1897756_1899760_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001292784.1|1899756_1900893_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 6
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	1912983	1975097	5142799	capsid,tail,plate,head,lysis,terminase,holin,portal,tRNA,integrase	Escherichia_phage(41.86%)	69	1965050:1965066	1976466:1976482
WP_001350700.1|1912983_1915017_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
WP_001005448.1|1915148_1916258_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046487.1|1916520_1916802_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830454.1|1917095_1917638_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677332.1|1917718_1918393_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945347.1|1918408_1920889_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405724.1|1920904_1921939_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1922020_1922359_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134614.1|1922577_1923402_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1923522_1923795_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195614.1|1924017_1924806_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822262.1|1924802_1925603_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297940.1|1925667_1926486_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434049.1|1926537_1927284_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011933.1|1927257_1928223_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846205.1|1928219_1929224_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000858523.1|1929220_1930498_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1930754_1931807_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289810.1|1932035_1932890_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853836.1|1932918_1934181_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182910.1|1934190_1934643_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823289.1|1934673_1934958_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490666.1|1934961_1936317_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844241.1|1936364_1937405_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1937504_1938284_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807360.1|1938365_1939265_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001350699.1|1939680_1939998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1940432_1941446_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001350698.1|1941561_1941861_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_000043869.1|1941975_1942251_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217671.1|1942428_1942929_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|1942992_1943217_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|1943216_1943516_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|1943518_1943743_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|1943739_1944015_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268633.1|1944004_1946296_+	replication endonuclease	NA	M1SV59	Escherichia_phage	97.6	0.0e+00
WP_000423308.1|1946519_1948736_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038157.1|1949239_1950274_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.6e-200
WP_000156837.1|1950273_1952046_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085959.1|1952219_1953074_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
WP_001248549.1|1953132_1954206_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
WP_000203455.1|1954209_1954953_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_000988632.1|1955052_1955562_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
WP_000846408.1|1955561_1955765_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	6.8e-31
WP_000123123.1|1955768_1956050_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144105.1|1956049_1956547_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
WP_000736608.1|1956561_1956987_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_000040663.1|1956974_1957400_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	6.1e-66
WP_001300730.1|1957371_1957545_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917155.1|1957507_1957975_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001001811.1|1957967_1958420_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	9.1e-76
WP_001093701.1|1958486_1959122_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.1e-111
WP_000127164.1|1959118_1959466_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121478.1|1959470_1960379_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285322.1|1960371_1960902_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.5e-101
WP_000104719.1|1960912_1963642_+|tail	tail protein	tail	Q858V4	Yersinia_virus	81.6	0.0e+00
WP_001164151.1|1963645_1964173_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
WP_000711883.1|1964594_1965437_+	hypothetical protein	NA	NA	NA	NA	NA
1965050:1965066	attL	AAATACACCTGAATATC	NA	NA	NA	NA
WP_001447266.1|1965543_1966128_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	3.0e-07
WP_000836023.1|1966150_1966528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286695.1|1966858_1968091_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	1.1e-224
WP_001251412.1|1968063_1968582_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001031303.1|1968638_1968914_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1968946_1969066_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069909.1|1969058_1971506_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.8	0.0e+00
WP_000978873.1|1971520_1972000_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.1	2.1e-83
WP_000882921.1|1971999_1973163_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_000468308.1|1973244_1973463_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476019.1|1973735_1975097_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
1976466:1976482	attR	AAATACACCTGAATATC	NA	NA	NA	NA
>prophage 7
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	2030070	2036373	5142799		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|2030070_2031465_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|2031639_2032533_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|2032905_2033991_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|2033990_2034890_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|2034947_2035826_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|2035830_2036373_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 8
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	2769057	2831816	5142799	integrase,capsid,tail,head,protease,terminase,holin,portal,lysis	Enterobacteria_phage(36.0%)	74	2773781:2773796	2839182:2839197
WP_000422062.1|2769057_2770107_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559260.1|2770326_2771085_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_001278741.1|2771081_2771672_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2771711_2772587_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|2772799_2774695_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2773781:2773796	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|2774722_2775343_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|2775339_2776221_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2776358_2776403_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|2776494_2778057_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2778056_2779652_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|2779655_2781014_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209529.1|2781025_2782219_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|2782218_2783025_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|2783405_2783585_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|2783670_2784171_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|2784216_2784723_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|2785495_2785765_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2785821_2786490_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|2786544_2787129_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000216497.1|2787128_2790236_-	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_001233195.1|2790387_2790987_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000515772.1|2791054_2794534_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001332187.1|2794600_2794939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2795012_2795615_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140762.1|2795551_2796295_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2796299_2796998_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2796997_2797327_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082348.1|2797323_2799897_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|2799877_2800291_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2800317_2800749_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|2800762_2801515_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2801522_2801918_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2801914_2802448_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2802463_2802817_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|2802809_2803193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522602.1|2803244_2804273_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
WP_000256813.1|2804330_2804678_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_077818459.1|2804714_2805941_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.7e-76
WP_044696974.1|2805919_2806219_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	54.3	2.4e-16
WP_000831818.1|2806208_2807801_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2807797_2808004_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2807987_2809916_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2809887_2810436_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001331705.1|2810823_2811057_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000057035.1|2811114_2811525_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001082537.1|2811832_2812297_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_001351274.1|2813235_2813508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|2813473_2813818_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|2813822_2814038_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331708.1|2814187_2814349_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
WP_001331709.1|2814306_2814534_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000935515.1|2815808_2816858_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2817008_2817206_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762880.1|2817430_2818252_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|2818248_2818623_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|2818635_2819682_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|2819683_2819962_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_021524707.1|2820129_2820342_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	5.8e-25
WP_122083109.1|2820386_2820494_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000354966.1|2820902_2821904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639476.1|2821919_2822882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151217.1|2823073_2823496_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_001262357.1|2823536_2824607_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|2824678_2825104_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2825087_2825330_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|2825721_2826060_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2826352_2826508_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2826667_2826889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2826889_2827054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2827454_2827643_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2827639_2827831_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048434.1|2827923_2830395_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2830459_2830708_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2830685_2831816_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2839182:2839197	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	2938649	2983851	5142799	integrase,capsid,tail,portal,protease,terminase,head,tRNA,lysis	Enterobacteria_phage(54.39%)	66	2940843:2940856	2981732:2981745
WP_000654167.1|2938649_2938928_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2938924_2940985_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
2940843:2940856	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515327.1|2941043_2944526_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|2944586_2945219_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2945155_2945899_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|2945904_2946603_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2946602_2946932_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2946928_2949490_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459485.1|2949482_2949917_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_000479129.1|2949898_2950321_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001350574.1|2950336_2951077_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683145.1|2951084_2951480_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2951476_2952055_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2952066_2952420_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2952412_2952787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710312.1|2952838_2953867_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
WP_000256813.1|2953924_2954272_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_060710313.1|2954308_2955814_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000831818.1|2955803_2957396_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2957392_2957599_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021543142.1|2957582_2959511_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	5.1e-261
WP_000867565.1|2959482_2960031_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_000881610.1|2960593_2960776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2960982_2961309_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2961789_2962083_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2962173_2962356_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2962572_2963070_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2963069_2963285_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2963873_2964956_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2965144_2965528_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2965613_2965754_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2965750_2966113_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2966132_2966327_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2966319_2966661_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2966663_2966840_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2966836_2967364_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2967360_2967801_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2967874_2968165_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788873.1|2968161_2968863_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	6.4e-129
WP_000185431.1|2968859_2969759_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2969791_2970088_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2970229_2970445_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2970520_2971216_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2971255_2971813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2971809_2972562_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2972838_2973021_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2972998_2973271_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2973287_2973869_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2974082_2974283_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2974465_2974834_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2974906_2975071_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2975039_2975183_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2975258_2975555_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2975560_2976346_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2976342_2977023_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2977019_2977202_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2977174_2977366_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|2977752_2977974_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2977973_2978300_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2978283_2978523_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2978662_2978899_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2978888_2980031_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2980144_2981395_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2981566_2982220_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
2981732:2981745	attR	GATGAAGCCGGACG	NA	NA	NA	NA
WP_000476093.1|2982229_2982691_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2982744_2983851_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	3211468	3307743	5142799	integrase,capsid,plate,tail,protease,portal,terminase,head,tRNA,lysis	Salmonella_phage(54.84%)	96	3273259:3273284	3307818:3307843
WP_000886683.1|3211468_3212761_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|3212851_3214195_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3214205_3214817_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077107.1|3214975_3219019_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3219153_3219648_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3220191_3221157_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043638.1|3221279_3223046_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_001202198.1|3223046_3224768_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241673.1|3224809_3225514_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3225798_3226017_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001029748.1|3227623_3228625_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000415806.1|3229555_3230863_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101565.1|3231192_3234426_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000097886.1|3234422_3235406_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|3236118_3238395_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3238425_3238746_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3239068_3239293_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|3239365_3241312_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746477.1|3241308_3242424_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|3242574_3243531_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599822.1|3243527_3245186_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3245611_3246307_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|3246627_3247527_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3247670_3249323_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178694.1|3249334_3250303_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815373.1|3250435_3252154_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000566391.1|3252190_3253192_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136572.1|3253202_3254633_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3254731_3255745_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255187.1|3255741_3256572_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|3256568_3256892_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000027205.1|3257749_3258478_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3258495_3259227_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|3259233_3259950_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3259949_3260618_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3260843_3261575_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149763.1|3261603_3262731_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_000389260.1|3262771_3263260_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3263319_3264165_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105433.1|3264161_3265115_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3265124_3266258_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3266352_3267465_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3267814_3268291_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3268378_3269281_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|3269341_3270064_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|3270047_3270335_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|3270494_3270752_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|3270781_3271159_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3271428_3273114_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3273259:3273284	attL	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
WP_000972391.1|3273349_3273568_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011808.1|3273658_3274759_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	8.4e-176
WP_000980416.1|3274755_3275241_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_001282740.1|3275237_3278315_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.5	0.0e+00
WP_000763307.1|3278307_3278427_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	3.1e-12
WP_001281009.1|3278441_3278744_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207657.1|3278798_3279314_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046137.1|3279323_3280496_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
WP_000905071.1|3280638_3281205_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	7.1e-86
WP_128957840.1|3281232_3281631_+|tail	phage tail protein	tail	O22004	Shigella_phage	33.6	1.9e-08
WP_000426256.1|3281632_3282076_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.5	5.6e-54
WP_000368075.1|3282047_3282650_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	5.2e-95
WP_000104770.1|3282649_3284113_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.9	4.5e-201
WP_001086798.1|3284109_3284715_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.9e-109
WP_000268320.1|3284707_3285616_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	3.2e-144
WP_000177580.1|3285602_3285962_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_001096008.1|3285958_3286537_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	6.1e-93
WP_000635034.1|3286712_3288671_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000829160.1|3288816_3289254_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.1	1.2e-51
WP_001039944.1|3289246_3289678_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_001080920.1|3289773_3290202_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	2.9e-47
WP_000727853.1|3290198_3290576_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069917.1|3290577_3291090_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	2.6e-87
WP_000171568.1|3291070_3291286_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3291289_3291493_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673513.1|3291492_3291957_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_001054316.1|3292052_3292703_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	7.3e-111
WP_000742511.1|3292706_3293765_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216221.1|3293781_3294615_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	87.7	9.7e-124
WP_001098410.1|3294757_3296524_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520391.1|3296523_3297549_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	5.8e-171
WP_000560513.1|3297574_3298021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350593.1|3298017_3298665_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_000834899.1|3299109_3299535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3299694_3299928_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3299938_3300127_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000017478.1|3300280_3302695_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_000104166.1|3302691_3303549_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	3.9e-160
WP_000752613.1|3303545_3303773_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244213.1|3303772_3304006_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_000996712.1|3304073_3304415_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_000956193.1|3304532_3304829_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.5	7.1e-21
WP_000460891.1|3304836_3305346_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3305378_3305600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047328.1|3305725_3306295_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_000900884.1|3306310_3306502_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	70.5	2.4e-09
WP_000290937.1|3306690_3307743_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3307818:3307843	attR	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
>prophage 11
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	3584985	3637492	5142799	tail,protease,terminase,holin,portal,tRNA,integrase	Enterobacteria_phage(35.09%)	67	3615804:3615819	3642398:3642413
WP_001201816.1|3584985_3585939_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000239877.1|3586170_3586839_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000259980.1|3586893_3587199_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_001304815.1|3587256_3587556_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_001331488.1|3587575_3587884_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001201822.1|3588358_3589312_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_021524694.1|3589498_3590983_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|3591166_3591472_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000742376.1|3591540_3592197_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|3592251_3592350_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|3592389_3592683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|3592692_3592971_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_021524693.1|3592967_3595031_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
WP_021524692.1|3595095_3595695_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	94.0	4.0e-103
WP_021527897.1|3595762_3599455_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_077792027.1|3599701_3600334_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	7.1e-103
WP_021524656.1|3600279_3601023_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.0	2.4e-142
WP_021524657.1|3601033_3601732_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000847298.1|3601731_3602061_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021524658.1|3602057_3604670_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000533397.1|3604659_3605064_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_016236015.1|3605090_3605522_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_016234254.1|3605540_3606287_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_000682708.1|3606294_3606693_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_060710318.1|3606705_3607329_-|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	93.2	4.0e-98
WP_001281346.1|3607331_3607613_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097059.1|3607605_3607932_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_128958825.1|3608019_3609999_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
WP_016236019.1|3609988_3611491_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
WP_000102415.1|3611490_3611703_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077619.1|3611699_3613823_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_016236020.1|3613819_3614296_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_122986666.1|3614810_3614996_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_000992067.1|3615514_3616048_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.1e-99
3615804:3615819	attL	CGCTCAATGGCGTTAA	NA	NA	NA	NA
WP_021524662.1|3616153_3616426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524663.1|3616391_3616736_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000284510.1|3616740_3616956_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016236026.1|3617031_3617301_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	71.9	2.2e-08
WP_001304601.1|3617338_3617521_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_021524664.1|3617657_3619628_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	5.4e-250
WP_077462104.1|3620409_3620742_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_001204806.1|3620839_3621220_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_021524665.1|3621237_3622227_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
WP_001223333.1|3622236_3622752_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_021531991.1|3622767_3623565_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767103.1|3623584_3623974_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_021524668.1|3623970_3624297_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_021531977.1|3624293_3624947_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_021524670.1|3624946_3625441_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_021524650.1|3625437_3626433_-	hypothetical protein	NA	Q8SBF1	Shigella_phage	87.9	3.8e-50
WP_000995577.1|3626429_3626729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024186770.1|3626725_3626950_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
WP_021524652.1|3626954_3627791_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
WP_000515860.1|3627787_3628339_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|3628382_3628583_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_021527885.1|3628673_3629348_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.6	2.7e-132
WP_000135680.1|3630034_3630397_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3630462_3631287_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3631414_3631951_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3631941_3632304_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|3632303_3632609_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_000433949.1|3632608_3632980_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_001298992.1|3632835_3633999_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000729155.1|3634361_3635228_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3635229_3635442_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|3635549_3636071_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3636106_3637492_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
3642398:3642413	attR	TTAACGCCATTGAGCG	NA	NA	NA	NA
>prophage 12
NZ_CP012625	Escherichia coli strain SF-468 chromosome, complete genome	5142799	3845726	3962001	5142799	capsid,tail,portal,lysis,holin,terminase,head,integrase	Enterobacteria_phage(42.42%)	117	3909992:3910038	3958098:3958144
WP_000131041.1|3845726_3847760_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001314510.1|3847888_3848476_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001350625.1|3848489_3849962_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159135.1|3849975_3851664_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_060710320.1|3852733_3853297_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.6	1.5e-51
WP_001304859.1|3853626_3854421_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213047.1|3854574_3855336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071787751.1|3856481_3857675_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001005272.1|3857858_3858527_+	membrane protein	NA	NA	NA	NA	NA
WP_001298555.1|3858769_3859465_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023913.1|3859457_3860885_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102123.1|3860895_3861615_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295801.1|3862140_3862995_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046332.1|3863221_3864547_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|3864655_3864892_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3864903_3865497_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|3865656_3866526_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_000620995.1|3866773_3867631_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060710321.1|3867755_3872006_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174452.1|3872571_3873423_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_001172280.1|3873449_3874439_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910711.1|3874469_3875363_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001304867.1|3875562_3876489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860032.1|3876645_3877566_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182341.1|3877737_3878880_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000739809.1|3879353_3879455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3879819_3880083_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3880082_3880223_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|3881306_3881849_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730982.1|3881922_3882510_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|3882566_3883235_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131109.1|3883260_3885786_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265640.1|3885775_3887419_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001295798.1|3887387_3888098_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001295797.1|3888404_3888734_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3888982_3889597_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146243.1|3889811_3889997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298126.1|3895963_3896488_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|3896922_3897261_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_033560629.1|3897520_3898855_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060710322.1|3898935_3899649_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	50.2	3.0e-49
WP_060710323.1|3899682_3901512_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.5	5.6e-31
WP_000452039.1|3901526_3901730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710324.1|3901816_3902845_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_000582638.1|3902863_3903226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898164.1|3903222_3903435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710325.1|3903784_3904123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710326.1|3904124_3904535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000617151.1|3904667_3904946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710327.1|3904957_3905650_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_060710328.1|3905888_3906077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710329.1|3908259_3908799_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	3.2e-27
3909992:3910038	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_060710363.1|3910376_3911366_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_060710332.1|3911991_3913131_-	hypothetical protein	NA	J9Q803	Salmonella_phage	25.9	3.4e-18
WP_060710333.1|3914057_3915836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710334.1|3916637_3916925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710335.1|3916935_3917640_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	1.3e-57
WP_060710336.1|3917649_3917931_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	7.0e-18
WP_060710337.1|3917930_3920303_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	2.7e-171
WP_060710338.1|3920363_3923777_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_001332187.1|3923843_3924182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889074.1|3924254_3924857_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	8.1e-88
WP_060710340.1|3924793_3925537_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.3e-148
WP_060710341.1|3925542_3926241_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	9.9e-130
WP_000847364.1|3926240_3926570_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
WP_060710342.1|3926566_3929146_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.3	0.0e+00
WP_021544911.1|3929138_3929573_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.0e-63
WP_001552795.1|3929554_3929977_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	4.2e-59
WP_001467857.1|3929992_3930733_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	3.8e-132
WP_000683128.1|3930740_3931136_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|3931132_3931711_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752975.1|3931722_3932076_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_074152574.1|3932087_3932486_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	1.2e-60
WP_000063252.1|3932527_3933553_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001345004.1|3933609_3933942_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_060710344.1|3933951_3935271_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	3.7e-234
WP_060710345.1|3935251_3936853_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.4e-311
WP_000198149.1|3936849_3937056_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_060710346.1|3937052_3938978_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453558.1|3938952_3939498_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3939835_3940156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710347.1|3940536_3940980_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	81.4	1.3e-58
WP_060710348.1|3940967_3941474_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	99.4	8.6e-91
WP_000839596.1|3941473_3941689_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000066486.1|3942362_3942578_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_060710349.1|3942946_3943699_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	4.5e-136
WP_060710350.1|3943915_3944278_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	8.1e-59
WP_000774474.1|3944274_3944565_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	3.3e-47
WP_000224914.1|3944557_3944728_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001356995.1|3944727_3945183_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_001303586.1|3945179_3945281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017329.1|3945370_3945880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060710351.1|3946175_3946982_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	28.9	3.8e-16
WP_000065088.1|3947388_3947619_-	hypothetical protein	NA	Q286X0	Escherichia_phage	78.9	2.3e-27
WP_000062289.1|3947615_3947816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488730.1|3947812_3948106_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_060710352.1|3948102_3948804_-	Replication protein P	NA	Q9EYB6	Enterobacteria_phage	98.7	1.9e-128
WP_060710364.1|3948800_3949730_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.8e-110
WP_001182873.1|3949816_3950356_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3950386_3950614_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3950724_3951417_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_060710353.1|3951705_3952176_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	40.1	5.6e-20
WP_060710354.1|3952175_3952559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060710355.1|3953032_3953239_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
WP_060710356.1|3953314_3953611_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	3.1e-48
WP_000100847.1|3953616_3954402_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186811.1|3954398_3955079_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000682319.1|3955075_3955237_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000129285.1|3955229_3955787_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3955797_3956079_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_033554594.1|3956177_3956396_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	4.1e-34
WP_000488407.1|3956443_3956722_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_071830316.1|3956693_3957044_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	96.6	1.3e-58
WP_000051887.1|3956920_3958084_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893305.1|3958288_3959542_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
3958098:3958144	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3959553_3960657_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749902.1|3960945_3962001_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
>prophage 1
NZ_CP012626	Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence	110808	5215	43410	110808	integrase,protease,transposase	Macacine_betaherpesvirus(33.33%)	24	3208:3222	35971:35985
3208:3222	attL	TGCCAGTAAAGCGCC	NA	NA	NA	NA
WP_001067858.1|5215_5920_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_124793657.1|9824_11038_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	9.7e-165
WP_001312823.1|11221_11380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280979.1|12652_13606_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_060710369.1|14038_15148_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_001312822.1|15216_16119_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_014640565.1|16493_16682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|16802_17543_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|17827_18805_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949004.1|21786_22701_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|22700_23528_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000992806.1|23524_24382_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|24378_25236_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|26478_26859_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|27238_28432_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|28567_30292_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|30292_31240_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|31239_32982_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|32978_34256_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001238646.1|38064_39231_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
35971:35985	attR	GGCGCTTTACTGGCA	NA	NA	NA	NA
WP_000817028.1|39230_40202_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000343071.1|41377_41953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092896.1|41965_42178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082154.1|42438_43410_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
