The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	1137819	1144959	5048243		Escherichia_phage(83.33%)	6	NA	NA
WP_001279003.1|1137819_1138458_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590420.1|1138454_1139717_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1139713_1140622_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001272542.1|1140787_1141585_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141302.1|1141635_1142292_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_000103864.1|1142397_1144959_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
>prophage 2
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	1735492	1744937	5048243		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569345.1|1735492_1736419_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783132.1|1736423_1737155_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1737135_1737243_-	protein YohO	NA	NA	NA	NA	NA
WP_001240394.1|1737302_1738034_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001295431.1|1738255_1739941_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1739937_1740657_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1740703_1741174_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1741214_1741676_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001332210.1|1741800_1743804_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001292784.1|1743800_1744937_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 3
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	1840570	1849286	5048243		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001115981.1|1840570_1841965_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|1842139_1843033_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|1843405_1844491_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|1844490_1845390_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|1845447_1846326_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|1846330_1846879_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_001362820.1|1846910_1848149_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000735124.1|1848158_1849286_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 4
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	2064753	2162048	5048243	holin,terminase,portal,head,protease,capsid,integrase,tail,tRNA	Enterobacteria_phage(46.38%)	112	2066478:2066493	2086275:2086290
WP_001025351.1|2064753_2066487_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
2066478:2066493	attL	GAATATTCACCGGAAT	NA	NA	NA	NA
WP_001304291.1|2066702_2067269_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185753.1|2067282_2068029_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214282.1|2068416_2069517_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176867.1|2069541_2071971_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564725.1|2072135_2073107_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2073103_2073847_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_001313931.1|2073887_2074283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050575735.1|2074335_2075106_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362005.1|2075087_2076401_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_000528718.1|2076456_2076693_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030158.1|2076701_2076848_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	2.8e-23
WP_000457723.1|2076851_2077094_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000206826.1|2077178_2077523_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_021556325.1|2077519_2077705_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	88.7	3.5e-18
WP_001289973.1|2078218_2078704_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_157837585.1|2078700_2079249_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	68.2	4.1e-38
WP_001421234.1|2079203_2079386_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_001300189.1|2079372_2079687_-	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000179800.1|2079640_2079958_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001199104.1|2080206_2080788_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_021556324.1|2080793_2080982_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.8e-09
WP_000141093.1|2081176_2081383_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_021556323.1|2081673_2082174_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_000838344.1|2082277_2082934_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_001090258.1|2083269_2083977_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_024226990.1|2084085_2084937_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	66.5	3.1e-93
WP_000626793.1|2084933_2085128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|2085124_2085349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000995578.1|2085345_2085645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060682015.1|2085641_2086628_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	1.7e-55
2086275:2086290	attR	GAATATTCACCGGAAT	NA	NA	NA	NA
WP_000988266.1|2086638_2087538_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_021553033.1|2087534_2088935_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	3.2e-244
WP_021553034.1|2088931_2089189_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.8	4.7e-21
WP_021553035.1|2089241_2090231_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	94.5	2.1e-186
WP_000904114.1|2090243_2090618_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|2090614_2091436_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|2091660_2091858_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001331709.1|2094330_2094558_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_077817322.1|2094515_2094677_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	3.0e-13
WP_000284510.1|2094827_2095043_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021556320.1|2095047_2095392_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_001092883.1|2095442_2095976_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001151823.1|2096132_2096315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|2096329_2096461_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071587457.1|2096683_2096869_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_000347013.1|2097281_2097422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2097554_2097740_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000867489.1|2098134_2098680_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_016248238.1|2098654_2100580_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000198149.1|2100576_2100783_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_016248239.1|2100779_2102381_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
WP_016248240.1|2102361_2103681_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_001299443.1|2103690_2104023_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063261.1|2104079_2105105_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_000158858.1|2105146_2105533_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.2	1.2e-52
WP_000752997.1|2105544_2105898_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_000975010.1|2105913_2106489_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000683079.1|2106485_2106881_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2106888_2107641_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_001542190.1|2107654_2108086_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	4.8e-42
WP_000533402.1|2108112_2108526_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_060682017.1|2108506_2111080_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000847298.1|2111076_2111406_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|2111405_2112104_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001542192.1|2112114_2112858_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_032300536.1|2112803_2113436_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_060682018.1|2113779_2117253_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_001228316.1|2117320_2117920_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_060682019.1|2118071_2121098_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	2.8e-56
WP_000885577.1|2121097_2121682_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_001217553.1|2121797_2122046_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891620.1|2122400_2122967_-	hydrolase	NA	NA	NA	NA	NA
WP_001258675.1|2123276_2125049_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077393227.1|2125041_2125494_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2125522_2126263_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2126297_2126819_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024939.1|2126820_2127423_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072123646.1|2127494_2127560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2127698_2128310_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2128318_2129329_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|2129545_2130331_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2130327_2131083_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|2131161_2132094_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2132109_2133432_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001296141.1|2133550_2134522_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091149.1|2134653_2136096_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056695.1|2136223_2137093_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301724.1|2137430_2138906_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001069461.1|2139140_2140952_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2140988_2141630_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173466.1|2141685_2142864_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2142997_2143288_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2143354_2143711_+	protein YebF	NA	NA	NA	NA	NA
WP_000024728.1|2144037_2144697_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936959.1|2144905_2146966_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2146962_2147625_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|2147647_2148304_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2148405_2148636_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|2148774_2149149_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879319.1|2149152_2150025_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000984819.1|2150037_2150379_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812741.1|2150773_2151430_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000929522.1|2151430_2151706_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2151726_2151963_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024188929.1|2152080_2153520_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001447255.1|2153599_2156233_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207278.1|2156201_2157485_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001029108.1|2157614_2158112_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431376.1|2158208_2158907_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055805.1|2158926_2160975_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
WP_000984517.1|2161166_2162048_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	2641794	2704554	5048243	holin,terminase,portal,head,protease,capsid,integrase,tail,lysis	Enterobacteria_phage(35.42%)	72	2646518:2646533	2711920:2711935
WP_000422064.1|2641794_2642844_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559260.1|2643063_2643822_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_001278741.1|2643818_2644409_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2644448_2645324_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|2645536_2647432_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2646518:2646533	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|2647459_2648080_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|2648076_2648958_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2649095_2649140_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|2649231_2650794_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2650793_2652389_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|2652392_2653751_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209528.1|2653762_2654956_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|2654955_2655762_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|2656142_2656322_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|2656407_2656908_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|2656953_2657460_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|2658232_2658502_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2658558_2659227_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|2659281_2659866_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_064759829.1|2659865_2662973_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_001233195.1|2663124_2663724_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000515772.1|2663791_2667271_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001332187.1|2667337_2667676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2667749_2668352_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140762.1|2668288_2669032_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2669036_2669735_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2669734_2670064_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082348.1|2670060_2672634_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|2672614_2673028_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2673054_2673486_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|2673499_2674252_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2674259_2674655_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2674651_2675185_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2675200_2675554_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|2675546_2675930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021543836.1|2675981_2677010_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256817.1|2677067_2677415_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253963.1|2677451_2678957_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000831818.1|2678946_2680539_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2680535_2680742_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2680725_2682654_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2682625_2683174_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001331705.1|2683560_2683794_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000057035.1|2683851_2684262_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001082537.1|2684569_2685034_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_001351274.1|2685972_2686245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|2686210_2686555_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|2686559_2686775_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331708.1|2686924_2687086_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
WP_001331709.1|2687043_2687271_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000935515.1|2688545_2689595_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2689745_2689943_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762880.1|2690167_2690989_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|2690985_2691360_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|2691372_2692419_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|2692420_2692699_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001013637.1|2692866_2693079_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_122083109.1|2693123_2693231_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000354966.1|2693639_2694641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639476.1|2694656_2695619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151217.1|2695810_2696233_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_001262357.1|2696273_2697344_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|2697415_2697841_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001362937.1|2698459_2698798_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2699090_2699246_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2699405_2699627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2699627_2699792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2700192_2700381_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2700377_2700569_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048435.1|2700661_2703133_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2703197_2703446_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2703423_2704554_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2711920:2711935	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	2811387	2857842	5048243	transposase,terminase,portal,head,protease,capsid,integrase,tail,tRNA,lysis	Enterobacteria_phage(53.45%)	67	2813581:2813594	2855723:2855736
WP_000654167.1|2811387_2811666_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2811662_2813723_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
2813581:2813594	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515327.1|2813781_2817264_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|2817324_2817957_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2817893_2818637_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|2818642_2819341_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2819340_2819670_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2819666_2822228_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459485.1|2822220_2822655_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_000479129.1|2822636_2823059_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|2823074_2823815_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683145.1|2823822_2824218_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2824214_2824793_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2824804_2825158_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2825150_2825525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522649.1|2825576_2826605_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000256840.1|2826662_2827010_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253914.1|2827046_2828552_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|2828541_2830134_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|2830130_2830337_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001304453.1|2830320_2832249_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867565.1|2832220_2832769_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_000881610.1|2833331_2833514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|2833683_2834831_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000830178.1|2834973_2835300_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2835780_2836074_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2836164_2836347_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2836563_2837061_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2837060_2837276_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2837864_2838947_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2839135_2839519_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2839604_2839745_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2839741_2840104_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2840123_2840318_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2840310_2840652_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_024188928.1|2840654_2840831_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	94.8	2.2e-25
WP_000153286.1|2840827_2841355_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2841351_2841792_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2841865_2842156_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2842152_2842854_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2842850_2843750_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2843782_2844079_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2844220_2844436_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2844511_2845207_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2845246_2845804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2845800_2846553_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2846829_2847012_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2846989_2847262_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2847278_2847860_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2848073_2848274_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2848456_2848825_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2848897_2849062_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2849030_2849174_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2849249_2849546_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2849551_2850337_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2850333_2851014_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2851010_2851193_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2851165_2851357_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|2851743_2851965_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2851964_2852291_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2852274_2852514_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2852653_2852890_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2852879_2854022_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2854135_2855386_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2855557_2856211_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
2855723:2855736	attR	GATGAAGCCGGACG	NA	NA	NA	NA
WP_000476093.1|2856220_2856682_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2856735_2857842_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	3104943	3115003	5048243	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_001101565.1|3104943_3108177_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000097886.1|3108173_3109157_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|3109809_3112086_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3112116_3112437_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3112759_3112984_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|3113056_3115003_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 8
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	3195033	3239104	5048243	transposase,plate,capsid,integrase,tail	Burkholderia_virus(42.5%)	57	3189393:3189407	3232918:3232932
3189393:3189407	attL	ATTATCAGTACCATC	NA	NA	NA	NA
WP_000146360.1|3195033_3195300_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|3195564_3195825_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000253505.1|3196052_3197138_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386565.1|3197278_3198241_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|3198268_3200419_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000904922.1|3200556_3201129_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001529038.1|3201200_3201674_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_000072166.1|3201680_3202295_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077817324.1|3202294_3203926_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	1.0e-39
WP_000138756.1|3203928_3204507_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|3204499_3205603_-	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859111.1|3205593_3205941_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001404342.1|3205995_3206592_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_000808006.1|3206588_3207743_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
WP_012602373.1|3207730_3207946_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001555962.1|3207942_3208827_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	45.7	4.9e-49
WP_001555963.1|3208826_3211712_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.1	1.7e-79
WP_001202894.1|3211787_3211946_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|3211869_3212205_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001513983.1|3212302_3212584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034292.1|3212586_3213108_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_001555964.1|3213107_3214535_-	hypothetical protein	NA	A4JWK5	Burkholderia_virus	76.1	1.0e-213
WP_032143024.1|3214524_3214779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555966.1|3214775_3215240_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	3.1e-39
WP_001555967.1|3215239_3215686_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	5.0e-34
WP_000537457.1|3215687_3216026_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|3216035_3216989_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|3217003_3218119_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001555969.1|3218333_3218792_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	9.9e-30
WP_001555971.1|3218794_3219616_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.5e-97
WP_000090676.1|3219596_3221090_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.9	3.9e-168
WP_032143027.1|3221089_3222622_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.2	7.3e-186
WP_000124060.1|3222681_3223227_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|3223226_3223538_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|3223537_3223864_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264662.1|3223860_3224511_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.2	1.1e-08
WP_060682029.1|3224494_3225223_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	9.2e-62
WP_000838563.1|3225225_3225576_-	membrane protein	NA	A4JWP3	Burkholderia_virus	52.2	9.9e-22
WP_001297461.1|3225941_3226517_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000522931.1|3226926_3227538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031885.1|3227558_3228545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259267.1|3228541_3229003_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000200154.1|3229053_3229242_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	7.9e-18
WP_000049026.1|3229294_3229603_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.9	2.1e-23
WP_001405162.1|3229613_3230525_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.0	1.6e-71
WP_000990528.1|3230528_3232298_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	4.0e-228
WP_000960676.1|3232308_3233475_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.9	3.3e-122
3232918:3232932	attR	ATTATCAGTACCATC	NA	NA	NA	NA
WP_001555976.1|3233477_3233747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405163.1|3233774_3234305_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	67.9	8.2e-60
WP_000632572.1|3234593_3234866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|3234875_3235181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555977.1|3235177_3235861_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_001555979.1|3235857_3236085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555981.1|3236077_3236293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972907.1|3236282_3236735_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	4.7e-24
WP_001281694.1|3236706_3237096_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
WP_000007119.1|3237742_3239104_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 9
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	3675670	3737797	5048243	integrase,holin,transposase,capsid	Escherichia_phage(20.0%)	51	3667362:3667398	3745178:3745214
3667362:3667398	attL	TCGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000131041.1|3675670_3677704_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001314510.1|3677832_3678420_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001350625.1|3678433_3679906_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159135.1|3679919_3681608_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_001363228.1|3682678_3683242_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.8	2.7e-53
WP_001304859.1|3683571_3684366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213047.1|3684519_3685281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071787751.1|3686426_3687620_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_060682037.1|3687803_3688472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298555.1|3688714_3689410_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023913.1|3689402_3690830_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102123.1|3690840_3691560_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295801.1|3692086_3692941_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046332.1|3693167_3694493_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|3694601_3694838_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3694849_3695443_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|3695602_3696472_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_000620995.1|3696719_3697577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092542.1|3697701_3701952_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174452.1|3702517_3703369_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_001172280.1|3703395_3704385_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910711.1|3704415_3705309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001304867.1|3705508_3706435_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860032.1|3706591_3707512_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182341.1|3707683_3708826_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000739809.1|3709299_3709401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3709765_3710029_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3710028_3710169_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_021543817.1|3711252_3711801_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730982.1|3711874_3712462_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|3712518_3713187_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_060682038.1|3713212_3715738_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265640.1|3715727_3717371_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_021543816.1|3717339_3718050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295797.1|3718356_3718686_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3718934_3719549_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146243.1|3719763_3719949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298126.1|3725913_3726438_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|3726872_3727211_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_032149698.1|3727468_3728803_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001240680.1|3728884_3729562_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	52.3	1.7e-46
WP_000891723.1|3729609_3731451_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.6	2.9e-19
WP_060682039.1|3731847_3732876_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_000996198.1|3732892_3733267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000806868.1|3733266_3733476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390663.1|3734482_3734791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|3734790_3734994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516769.1|3735051_3735435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221929.1|3735531_3735801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609976.1|3735810_3736437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114042865.1|3736523_3737797_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.0	3.5e-173
3745178:3745214	attR	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACGA	NA	NA	NA	NA
>prophage 10
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	4134589	4187872	5048243	transposase	Stx2-converting_phage(20.0%)	46	NA	NA
WP_000343765.1|4134589_4135810_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001328298.1|4136451_4136697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295734.1|4137494_4138211_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001295733.1|4138230_4139337_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991462.1|4139400_4140381_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
WP_001363826.1|4140963_4142007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|4142132_4143279_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000366620.1|4144168_4146244_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
WP_000504875.1|4146236_4147523_+	McrC family protein	NA	NA	NA	NA	NA
WP_000781649.1|4147632_4149372_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_001295727.1|4149384_4150575_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_032339588.1|4150567_4152208_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001016257.1|4152603_4153350_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4153364_4154906_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001467148.1|4156039_4156198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|4156297_4156474_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|4156490_4156979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|4156975_4157353_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|4157442_4157811_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|4157973_4158195_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_021543855.1|4158257_4158734_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|4158749_4159223_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_021543893.1|4159564_4160383_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	2.1e-46
WP_001323397.1|4160537_4160696_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001069743.1|4163983_4164856_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250228.1|4164940_4165858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296557.1|4166689_4166887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|4167058_4167661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|4167756_4167963_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|4168736_4168886_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_085949152.1|4169789_4171062_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000270962.1|4171780_4172182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4172169_4172604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4172958_4173339_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4173335_4173683_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|4173732_4175118_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|4175356_4176715_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|4178276_4178798_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4178794_4179748_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|4179834_4182159_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|4182203_4183106_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4183102_4184101_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4184097_4185054_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4185054_4185822_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4186378_4186636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|4187569_4187872_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	4406481	4419455	5048243		Escherichia_phage(50.0%)	17	NA	NA
WP_001696682.1|4406481_4408500_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.5	4.7e-39
WP_001696681.1|4408516_4409242_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_060682059.1|4409343_4409922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696196.1|4409921_4411187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001696194.1|4411447_4411669_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	54.1	5.3e-13
WP_001696193.1|4411665_4411881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696191.1|4411929_4412343_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	77.8	1.5e-29
WP_000360280.1|4412353_4412551_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.3e-31
WP_000013837.1|4412552_4412774_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	74.6	4.5e-20
WP_001696190.1|4412775_4413174_-	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.6	1.4e-32
WP_032297182.1|4413687_4414287_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	64.8	1.4e-55
WP_001696187.1|4414273_4414495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696186.1|4414491_4414704_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	82.2	1.7e-13
WP_006859641.1|4415128_4415707_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_032353285.1|4415703_4416435_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	37.3	8.2e-18
WP_032353286.1|4416427_4418077_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_000004195.1|4418066_4419455_-	replicative DNA helicase	NA	O80281	Escherichia_phage	50.1	5.8e-113
>prophage 12
NZ_CP012635	Escherichia coli strain SF-088 chromosome, complete genome	5048243	4760431	4812438	5048243	plate,holin,terminase,portal,head,protease,capsid,integrase,tail,lysis	Yersinia_virus(55.56%)	63	4776365:4776411	4809650:4809696
WP_000208235.1|4760431_4760962_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4760971_4762303_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|4762369_4763296_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4763388_4763874_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4763958_4764204_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4764628_4765474_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4765496_4767005_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4767175_4768186_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796344.1|4768282_4769029_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4769033_4769462_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4769488_4769788_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4769999_4770440_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802217.1|4770540_4771140_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4771247_4772015_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000709001.1|4772069_4772825_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758730.1|4772931_4773921_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4774240_4775203_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|4775383_4776286_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4776365:4776411	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_021517629.1|4776521_4776740_-	prophage transcriptional regulator OgrK	NA	Q858U4	Yersinia_virus	100.0	2.8e-38
WP_001540338.1|4776820_4777984_-	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.7	1.7e-206
WP_001540336.1|4777983_4778463_-|tail	phage tail protein	tail	Q858U6	Yersinia_virus	100.0	2.3e-85
WP_001540334.1|4778477_4780925_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	100.0	0.0e+00
WP_032668170.1|4780917_4781037_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	100.0	1.8e-15
WP_001031303.1|4781069_4781345_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001540332.1|4781402_4781921_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	100.0	1.4e-93
WP_001540330.1|4781933_4783124_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	100.0	1.9e-226
WP_001540329.1|4783524_4784304_+	hypothetical protein	NA	Q858R7	Enterobacteria_phage	100.0	3.7e-117
WP_001540328.1|4784455_4784983_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	100.0	2.7e-95
WP_001540327.1|4784986_4787728_-|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	99.9	0.0e+00
WP_001285334.1|4787738_4788269_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	100.0	1.0e-102
WP_001121478.1|4788261_4789170_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|4789174_4789522_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001540326.1|4789518_4790154_-|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	100.0	1.1e-114
WP_001001786.1|4790220_4790673_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917151.1|4790665_4791133_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_072174950.1|4791095_4791269_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001540324.1|4791240_4791666_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	100.0	5.0e-68
WP_001540323.1|4791653_4792079_-	hypothetical protein	NA	Q858W1	Yersinia_virus	100.0	3.2e-67
WP_001144101.1|4792093_4792591_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4792590_4792872_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846411.1|4792875_4793079_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	100.0	3.0e-31
WP_000988628.1|4793078_4793588_-|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_001540320.1|4793687_4794431_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	100.0	9.8e-128
WP_060682065.1|4794434_4795508_-|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	99.7	3.9e-202
WP_001085953.1|4795566_4796421_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|4796594_4798367_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001540313.1|4798366_4799401_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	100.0	1.4e-201
WP_001540309.1|4799776_4800895_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	100.0	2.6e-172
WP_000688782.1|4800881_4801874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001540306.1|4801874_4802813_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_032141994.1|4803300_4803750_-	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	100.0	6.4e-82
WP_001540303.1|4803749_4806035_-	replication endonuclease	NA	Q858T4	Yersinia_virus	99.9	0.0e+00
WP_000027667.1|4806024_4806300_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113261.1|4806296_4806521_-	TraR/DksA family transcriptional regulator	NA	Q858T6	Yersinia_virus	98.6	1.7e-35
WP_001277891.1|4806523_4806823_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001540300.1|4806822_4807047_-	DUF2732 family protein	NA	Q858T8	Yersinia_virus	100.0	6.1e-33
WP_000217670.1|4807110_4807611_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001540298.1|4807780_4808053_-	hypothetical protein	NA	Q1JS42	Enterobacteria_phage	100.0	3.1e-47
WP_000777029.1|4808189_4808483_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985242.1|4808552_4809533_+|integrase	site-specific integrase	integrase	Q858U3	Yersinia_virus	100.0	4.7e-186
WP_001350872.1|4809719_4810220_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4809650:4809696	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033720.1|4810369_4811068_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4811064_4812438_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP012636	Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence	149683	25141	85541	149683	protease,integrase,transposase	Enterobacteria_phage(15.79%)	49	69710:69725	91820:91835
WP_001514245.1|25141_25882_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001332052.1|26002_26191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|26564_27473_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|27535_28645_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|29077_30031_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|30134_30524_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|31303_31462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|31645_32858_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_000928804.1|34312_35500_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733252.1|35496_37437_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
WP_001312828.1|37440_38811_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|39607_40549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|42809_44003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114042867.1|45226_46455_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	6.1e-175
WP_000738422.1|47081_47375_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|50520_51636_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_011402704.1|51649_55435_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933672.1|55538_56768_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|56852_57809_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|57853_60031_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|60885_61920_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|62479_62788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514250.1|62886_63069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324224.1|63065_63263_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001332356.1|63977_65219_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|65193_67308_+	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|67477_67789_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|67766_68003_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|68942_69212_+	membrane protein	NA	NA	NA	NA	NA
WP_001017350.1|69208_69475_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000670963.1|69530_69983_-	N-acetyltransferase	NA	NA	NA	NA	NA
69710:69725	attL	GTGACGGATCTGGTGC	NA	NA	NA	NA
WP_000343091.1|70275_70536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518980.1|70532_71123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142431.1|71142_71400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080729.1|71528_71864_+	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_001283335.1|71885_73766_-	colicin	NA	NA	NA	NA	NA
WP_060682073.1|73951_74800_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.6	7.0e-29
WP_000969996.1|74845_75127_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|75123_75393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|76036_79003_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|79006_79567_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|79555_79723_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|79742_80093_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|80295_81309_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|81464_81938_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067855.1|82089_82794_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|83378_84239_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|84388_84790_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|84836_85541_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
91820:91835	attR	GCACCAGATCCGTCAC	NA	NA	NA	NA
