The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	157517	216501	4512838	transposase,integrase,protease	Enterobacteria_phage(18.75%)	60	151129:151143	204245:204259
151129:151143	attL	AAACAGTTTTTTCAT	NA	NA	NA	NA
WP_000795949.1|157517_158693_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	27.4	2.9e-17
WP_001285422.1|158862_159075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|159435_160518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|161366_162580_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000081059.1|163469_165107_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|165106_166147_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|166231_166870_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|166869_167511_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|167533_168172_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|168634_169102_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|169119_170328_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|170338_171295_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|171294_172374_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|172375_173149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|173141_174284_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|174293_175352_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|175672_176254_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|176253_177411_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|177433_177889_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|177911_178952_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|179000_179579_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|179647_180223_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|180651_181893_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|181983_182439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|182679_182871_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	57.4	4.7e-10
WP_001151572.1|182962_183304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|184289_184544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|184546_186586_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|186582_187569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|188489_188882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|189540_190197_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000340139.1|190399_190897_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|190901_192290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|192690_192984_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|192988_194314_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|194374_194581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|194681_195092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|195810_196815_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|196905_197340_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012695446.1|197425_199831_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.0	6.6e-141
WP_000118563.1|199827_200904_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_000993245.1|200912_201125_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|201190_201427_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|201423_201789_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|201806_203492_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|203530_203956_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|203983_204259_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
204245:204259	attR	AAACAGTTTTTTCAT	NA	NA	NA	NA
WP_001294656.1|204274_204640_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|204711_205167_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|205844_206270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|206818_207127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|207142_208000_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001287391.1|208606_209011_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|209188_209482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|209507_209744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|210298_210964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|211021_211402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|211731_212592_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|212774_213332_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|213495_216501_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
>prophage 2
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	220514	268309	4512838	transposase,integrase	Escherichia_phage(42.86%)	51	245282:245341	255959:256779
WP_001067855.1|220514_221219_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|221298_221799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|221948_222590_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|222733_223438_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|223449_224106_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|224201_225386_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|225480_226590_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|227079_227784_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_088445540.1|227820_228855_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.1e-71
WP_001261740.1|229000_229792_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|229955_230303_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|230296_231136_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|231540_233082_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|234388_234841_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|234882_235527_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|236017_236857_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|237261_238803_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|239068_239569_+	hypothetical protein	NA	A0A2L0UZT6	Agrobacterium_phage	28.6	2.0e-07
WP_000019304.1|239568_240138_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	NA	NA	NA	NA
WP_000845039.1|240740_241754_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001082319.1|241911_242715_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|242714_243551_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_004248792.1|243731_244523_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000057569.1|244537_244879_-	hypothetical protein	NA	NA	NA	NA	NA
245282:245341	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|245334_246039_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|246114_246615_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|246742_247582_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|247575_247923_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012695487.1|249232_249664_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012695486.1|250026_250440_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695485.1|250567_251377_-	aminoglycoside N-acetyltransferase AAC(3)-IIg	NA	NA	NA	NA	NA
WP_006473457.1|251618_252974_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695484.1|253461_254043_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_000845048.1|254205_255219_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001044210.1|255865_256006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|256011_256716_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|257025_257919_+	hypothetical protein	NA	NA	NA	NA	NA
255959:256779	attR	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001371935.1|258090_258321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|258499_258820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|259336_259648_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|259652_260144_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781547.1|260696_260900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|260954_261179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|261218_261419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|261641_261953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802040.1|262006_262183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|262328_262610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137794.1|262826_263432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|263764_265133_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|265308_266649_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|267070_268309_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	772096	899958	4512838	holin,tRNA,lysis,protease,integrase,transposase,terminase,portal,plate,tail,capsid	Salmonella_phage(51.49%)	151	772897:772956	814763:814840
WP_000938182.1|772096_772777_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
772897:772956	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_000503667.1|773488_774136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|774178_774376_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|774558_774804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|775001_775394_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|775503_776112_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|776174_776360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|776608_777127_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|777141_778674_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|778673_779354_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|779350_780550_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|780550_780904_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|780903_781656_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|781774_782230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|782313_782646_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|782642_783710_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|783712_784015_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|784014_784590_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|784589_786599_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|786776_787229_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|787232_787676_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|787688_788834_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|788837_789401_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|789375_789765_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|789751_790306_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|790302_790710_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|790675_791065_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|791106_792048_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|792059_792557_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|792561_793794_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|793797_794544_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|794428_795898_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|795897_797520_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|797522_798152_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|798652_799108_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|799425_799965_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|799942_800245_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000658037.1|800447_800636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|801028_801607_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|801603_801897_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|801893_802490_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|802558_802750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|802933_803272_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|803271_803442_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|803438_804041_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|804033_804282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|804285_804966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|805003_806392_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|806388_807369_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|807371_807596_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|807618_808065_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_023972394.1|808470_808926_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_000387662.1|809610_809934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|809941_810187_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|810216_812481_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|812477_813032_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|813034_813217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|813429_813654_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|813654_814674_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|815261_815921_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
814763:814840	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
WP_000904446.1|816007_816337_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|816333_816615_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|816663_817443_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|817468_818017_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|818231_819443_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|819500_819818_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|819862_820276_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|820449_821112_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|821206_821665_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|821700_823755_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|823878_824325_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|824343_826497_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|826483_827089_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|827305_827815_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|828171_829224_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|829295_829748_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|829933_831694_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|831762_832281_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|832380_832548_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|832803_833367_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|833363_835004_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|835008_836262_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|836276_838184_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|838196_840305_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|840403_841513_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001670452.1|841509_842052_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|842217_843228_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|843435_846048_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|846474_846666_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|846936_847623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|847607_847907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|847975_848602_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|849249_850218_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|850693_851275_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|851274_853713_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|853766_854009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|854047_854923_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000246065.1|857469_858174_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|858071_858809_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|858818_859514_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|859603_860137_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_085947772.1|860454_861667_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000978296.1|862110_862443_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|862439_865427_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|865506_865836_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|865832_866231_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|866276_867026_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|867037_867439_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|867435_868002_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|867982_868282_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|868274_868598_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|868688_870770_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|870693_872241_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|872237_872444_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|872440_874579_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|874535_875069_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|875276_875756_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|875773_876226_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|876209_876539_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|876814_877501_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|877861_878311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|878446_878572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|878745_879063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|879129_879927_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|879916_880063_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|880059_880671_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|880673_880880_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|880879_881482_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|881564_881786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|881897_882131_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|882422_882713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|882790_883102_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|883098_883446_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|883456_884206_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|884208_885192_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|885276_885651_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|885616_885856_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|885975_886386_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|886435_886696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|886688_886847_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|886868_887168_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|887294_890180_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|890142_891300_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|891342_891582_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|891622_891871_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|891915_893208_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191406.1|893402_894605_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|894685_896119_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544853.1|896364_897579_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|897895_898357_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|898557_899958_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 4
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	964387	971701	4512838	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|964387_964765_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|964926_965124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|965337_967614_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|967644_967965_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|968288_968510_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|968639_970586_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|970582_971701_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
>prophage 5
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	1710654	1776435	4512838	lysis,protease,terminase,integrase,portal,plate,tail,head,capsid	Salmonella_phage(42.22%)	78	1740510:1740556	1771489:1771535
WP_000208240.1|1710654_1711185_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|1711194_1712526_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|1712592_1713522_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|1713614_1714100_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|1714321_1714561_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|1714959_1715805_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|1715825_1717334_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|1717445_1718456_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|1718552_1719299_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|1719404_1719833_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|1719933_1720530_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|1720642_1721410_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|1721501_1722266_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|1722275_1722566_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|1722648_1723524_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|1723552_1724575_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|1724603_1725605_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|1725601_1726645_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|1726638_1728174_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|1728429_1729389_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|1729475_1731068_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|1731081_1731432_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001519915.1|1731930_1732653_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|1732715_1733756_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|1733765_1734725_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|1734735_1736070_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|1736332_1737088_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|1737188_1738178_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|1738381_1739344_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|1739528_1740431_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
1740510:1740556	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|1740717_1741134_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|1741168_1741387_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|1741464_1742634_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|1742630_1743116_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|1743127_1745569_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|1745561_1745717_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|1745713_1746049_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|1746111_1746630_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|1746645_1747833_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|1747967_1748537_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|1748536_1750279_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|1750289_1750820_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|1750812_1751721_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|1751727_1752075_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|1752071_1752713_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|1752789_1754166_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|1754170_1754638_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|1754630_1755098_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|1755205_1755619_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|1755615_1756125_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|1756108_1756330_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|1756320_1756524_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|1756523_1757024_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|1757121_1757880_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|1757883_1759044_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|1759075_1759939_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|1760103_1761873_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|1761872_1762910_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|1763430_1763622_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|1763620_1764052_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|1764185_1765226_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|1765222_1765420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|1765598_1767875_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|1767864_1768140_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|1768136_1768361_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|1768662_1768887_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|1768950_1769451_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001005165.1|1769441_1769618_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	80.4	2.3e-19
WP_001583792.1|1769620_1769893_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|1770029_1770323_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|1770392_1771373_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|1771557_1772058_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1771489:1771535	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|1772208_1772907_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|1772903_1774277_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|1774324_1774528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|1774648_1775044_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559230.1|1775055_1775745_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|1775814_1776435_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 6
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	2616459	2673152	4512838	holin,tRNA,terminase,integrase,portal,plate,tail,head,capsid	Cronobacter_phage(65.0%)	60	2625660:2625680	2675459:2675479
WP_000785626.1|2616459_2616858_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|2616860_2617166_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877300.1|2617207_2617576_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|2617720_2618104_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|2618107_2618770_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|2619219_2620464_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098837.1|2620718_2621687_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	2.2e-39
WP_000617688.1|2621957_2622956_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|2623044_2623737_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|2623888_2624386_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019993.1|2624471_2625608_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
2625660:2625680	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_000121526.1|2625688_2627707_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|2627877_2629257_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|2629686_2631207_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478471.1|2631594_2633160_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|2633156_2633804_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213689.1|2634035_2634803_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|2635060_2636842_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|2636831_2637869_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000514631.1|2638454_2639036_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|2639179_2639401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|2639431_2639935_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|2639944_2640172_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|2640161_2640587_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|2640586_2640988_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|2641055_2641289_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|2641279_2642140_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|2642136_2644158_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|2644277_2644484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|2644457_2644781_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|2644777_2645839_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|2645835_2647611_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|2647771_2648575_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|2648636_2649659_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|2649662_2650364_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|2650460_2650913_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|2650909_2651416_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|2651412_2652120_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|2652116_2653244_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|2653240_2653696_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|2653705_2653999_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|2653995_2654337_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|2654336_2654669_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|2654640_2654829_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|2654815_2655073_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|2655260_2657231_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|2657227_2657557_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|2657553_2658738_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|2658730_2659318_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|2659327_2661562_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|2661574_2662129_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|2662118_2662844_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|2662815_2663361_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|2663360_2665064_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000340945.1|2666461_2666764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|2667087_2667594_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|2667717_2669565_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918864.1|2669714_2671460_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|2671695_2671911_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264391.1|2672138_2673152_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
2675459:2675479	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 7
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	3146867	3152680	4512838		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|3146867_3149201_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|3149215_3149536_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|3149532_3149760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|3149756_3150314_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|3150310_3150577_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|3151117_3151855_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|3151851_3152097_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|3152113_3152680_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 8
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	3212830	3289570	4512838	holin,tRNA,lysis,protease,integrase,terminase,transposase,portal,tail,head,capsid	Salmonella_phage(36.84%)	89	3204911:3204927	3295417:3295433
3204911:3204927	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|3212830_3213868_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3213983_3214673_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3214991_3215375_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|3215436_3216024_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001670786.1|3216126_3217026_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|3217043_3218378_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|3218507_3219245_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|3219229_3220852_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|3221115_3221280_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|3221276_3221852_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|3221883_3222534_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|3222533_3223490_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|3223486_3223966_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|3224463_3225693_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|3225670_3225955_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|3225995_3226235_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|3226277_3227435_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|3227397_3230325_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|3230451_3230802_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|3230823_3230982_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|3231438_3232101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|3232100_3232487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|3232479_3233319_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|3233377_3233773_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|3233872_3234115_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|3234074_3234449_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|3234540_3235425_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|3235421_3236117_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|3236130_3236829_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|3236936_3237569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|3237811_3238045_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|3238161_3238410_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|3238444_3239047_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096562.1|3239255_3239867_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|3239863_3240004_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|3240000_3240678_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|3240950_3241514_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|3242020_3242209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|3242423_3243110_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|3243385_3243715_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|3243698_3244151_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|3244168_3244621_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|3244856_3245258_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|3245544_3246090_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|3246061_3247993_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|3247976_3248180_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|3248176_3249757_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|3249746_3251243_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|3251255_3251603_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|3251657_3252686_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|3252743_3253103_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|3253113_3253497_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|3253524_3254103_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|3254151_3255282_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|3255390_3255792_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|3255799_3256546_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|3256596_3256992_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|3256988_3257327_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|3257298_3260394_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|3260396_3260726_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|3260735_3261434_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|3261440_3262178_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|3262075_3262723_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|3262784_3266147_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|3266185_3266428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|3266481_3268854_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|3268850_3269675_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|3269664_3270243_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|3270339_3270567_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|3270673_3270886_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|3271638_3271758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|3272470_3272608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|3273092_3274586_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|3274990_3276790_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|3276806_3277781_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|3278054_3278735_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|3278731_3279637_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|3279648_3280377_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|3280388_3281120_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|3281119_3281500_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|3281611_3281872_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|3281909_3282836_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|3282951_3284148_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|3284169_3285087_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|3285125_3285974_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|3286089_3286983_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|3286993_3288355_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|3288358_3288994_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|3289018_3289570_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
3295417:3295433	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	3733478	3742649	4512838	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|3733478_3734426_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|3734409_3735141_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3735121_3735229_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|3735288_3736020_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|3736242_3737928_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|3737924_3738644_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3738690_3739158_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3739214_3739745_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3739916_3740375_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|3740615_3742649_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 10
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	3810739	3821246	4512838		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|3810739_3812143_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|3812320_3813214_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|3813590_3814676_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|3814675_3815575_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|3815622_3816501_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|3816501_3817053_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|3817058_3818033_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|3818048_3818822_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|3818826_3819906_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|3819932_3821246_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 11
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	3917777	3925028	4512838		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|3917777_3918197_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|3918199_3919468_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|3919922_3920135_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3920145_3920334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|3920591_3921788_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|3922437_3922749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|3922828_3923524_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|3923597_3925028_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 12
NZ_CP012599	Salmonella enterica subsp. enterica serovar Newport strain 0307-213 chromosome, complete genome	4512838	4377059	4444964	4512838	transposase	Escherichia_phage(26.92%)	60	NA	NA
WP_001567368.1|4377059_4378463_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|4378491_4379124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|4379601_4380570_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_012695470.1|4380730_4381546_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_012695469.1|4381682_4382576_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021243026.1|4382769_4383927_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695467.1|4384004_4384589_+	MFS transporter	NA	NA	NA	NA	NA
WP_012695470.1|4389485_4390301_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_088445543.1|4391522_4392680_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695467.1|4392757_4393342_+	MFS transporter	NA	NA	NA	NA	NA
WP_001567369.1|4395999_4396632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|4397109_4398078_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_012695470.1|4398238_4399054_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_012695469.1|4399190_4400084_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021243026.1|4400277_4401435_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695467.1|4401512_4402097_+	MFS transporter	NA	NA	NA	NA	NA
WP_022652343.1|4402118_4403087_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|4403306_4404710_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|4404742_4405447_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|4405533_4405854_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|4405899_4407189_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|4407201_4407627_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|4407686_4408514_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|4408532_4410011_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|4410502_4410778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|4410918_4411116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|4412102_4412360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|4412433_4412748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|4412795_4413692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|4413694_4414210_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|4414424_4415852_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|4415912_4416080_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	54.5	1.9e-07
WP_000078513.1|4416102_4417422_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|4417434_4417638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|4417701_4418907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|4418903_4419722_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572379.1|4419926_4420094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019951.1|4420187_4420460_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|4420582_4421698_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|4421955_4422390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|4422607_4423954_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_072196614.1|4423992_4424961_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|4425149_4426769_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|4426845_4427322_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|4427487_4428192_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4429825_4430728_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4430989_4431751_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4431771_4432632_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4432768_4433473_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|4433593_4436560_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|4436638_4437643_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|4437824_4438001_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|4438330_4439146_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001445143.1|4439428_4439680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|4439710_4441204_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|4441414_4441639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|4441635_4442373_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|4442858_4442999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4443004_4443709_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|4444259_4444964_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
