The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	1838796	1846483	3958620		Enterobacteria_phage(50.0%)	8	NA	NA
WP_053550562.1|1838796_1839867_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.6	2.2e-88
WP_053550563.1|1839869_1840781_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.7	6.0e-26
WP_053550564.1|1840817_1841696_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	56.3	3.1e-88
WP_053550565.1|1841695_1842238_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.1	1.2e-53
WP_053550566.1|1842374_1843253_+	YicC family protein	NA	NA	NA	NA	NA
WP_053550567.1|1843292_1843901_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.1	1.9e-20
WP_053550568.1|1843968_1844175_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_053550569.1|1844326_1846483_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	39.7	1.8e-12
>prophage 2
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	2099045	2105818	3958620		uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_053550790.1|2099045_2099534_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	5.3e-29
WP_053550791.1|2099553_2100273_-	creatininase family protein	NA	NA	NA	NA	NA
WP_053550792.1|2100513_2101029_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.7	2.3e-30
WP_053550794.1|2102155_2102923_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	32.2	1.3e-05
WP_053550795.1|2103042_2103639_-	DedA family protein	NA	NA	NA	NA	NA
WP_053550796.1|2103643_2104297_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.6	8.3e-30
WP_053550797.1|2104316_2105087_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.5	4.0e-55
WP_053550798.1|2105144_2105507_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053550799.1|2105536_2105818_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	46.1	2.0e-17
>prophage 3
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	2179101	2187864	3958620		Staphylococcus_phage(44.44%)	11	NA	NA
WP_053550856.1|2179101_2179566_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.7	5.9e-38
WP_053550857.1|2179643_2180849_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.8	9.8e-101
WP_053550858.1|2180882_2181533_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.3	5.7e-31
WP_096335479.1|2181517_2182603_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	3.0e-40
WP_053550860.1|2182673_2183141_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_053550861.1|2183137_2183614_-	cytidine deaminase	NA	A0A249XXA3	Clostridium_phage	39.7	2.7e-22
WP_053550862.1|2183614_2184865_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.8	5.6e-99
WP_053550863.1|2184966_2185422_-	ribose 5-phosphate isomerase B	NA	A0A222YX14	Synechococcus_phage	34.8	1.3e-18
WP_053550864.1|2185431_2186664_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_053550865.1|2186834_2187068_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	2.9e-09
WP_053550866.1|2187126_2187864_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.6	4.4e-11
>prophage 4
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	3541087	3613453	3958620	tRNA,protease,transposase,plate	Feldmannia_species_virus(20.0%)	56	NA	NA
WP_053551913.1|3541087_3542137_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_053551914.1|3542415_3542985_-	response regulator	NA	NA	NA	NA	NA
WP_096335490.1|3543119_3544106_-	response regulator	NA	NA	NA	NA	NA
WP_082351425.1|3544098_3545466_-	GHKL domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	40.5	1.0e-05
WP_157671897.1|3546107_3546677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053551918.1|3546811_3547453_+	porin family protein	NA	NA	NA	NA	NA
WP_053551919.1|3547540_3547921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551920.1|3548193_3549639_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_053551921.1|3549631_3551233_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_053551922.1|3551684_3551897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053551923.1|3552008_3552473_-	ferritin family protein	NA	NA	NA	NA	NA
WP_053551924.1|3552579_3553104_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	47.9	3.9e-38
WP_053551925.1|3553255_3553630_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_053551926.1|3553725_3553905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053551927.1|3553964_3554270_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_053551928.1|3554413_3555328_-	phospholipase A	NA	NA	NA	NA	NA
WP_053551929.1|3555408_3556530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551930.1|3556526_3557561_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_053551931.1|3557553_3558813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551932.1|3558900_3560778_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	32.0	2.5e-58
WP_082351326.1|3560961_3561438_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_053551933.1|3561554_3562619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551934.1|3562645_3565975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551935.1|3565971_3566529_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_053551936.1|3566543_3566978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551937.1|3566998_3569065_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_053551938.1|3569138_3571847_-	type VI secretion system ATPase TssH	NA	A0A0A8J958	Klebsiella_phage	33.5	1.6e-90
WP_053551939.1|3571863_3572850_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053551940.1|3572813_3574544_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_053551941.1|3574536_3574962_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_053552427.1|3575046_3575532_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_053551942.1|3575663_3577199_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_053551943.1|3577245_3577755_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_053551944.1|3577828_3579343_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_053551945.1|3579339_3580359_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053551946.1|3580391_3584063_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_157671898.1|3584059_3584809_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_053551948.1|3584820_3586164_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_053551949.1|3586178_3586643_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_053551950.1|3586639_3587224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551951.1|3588334_3588676_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_053551338.1|3589371_3590718_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_053551952.1|3592075_3592627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551953.1|3593212_3593464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053551954.1|3593531_3594191_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_053551955.1|3594299_3595301_-	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_053551956.1|3598810_3599848_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_053551957.1|3600107_3602669_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_053551958.1|3602720_3603386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053551959.1|3603530_3604367_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_053551960.1|3604582_3606628_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053551961.1|3606648_3607212_+	YfiR family protein	NA	NA	NA	NA	NA
WP_053551962.1|3607208_3609605_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	4.6e-41
WP_053551963.1|3609709_3611071_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_053551964.1|3611327_3612893_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_053551965.1|3612892_3613453_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	3749184	3757036	3958620		Lactococcus_phage(28.57%)	8	NA	NA
WP_053552062.1|3749184_3750702_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	4.3e-45
WP_157671909.1|3750788_3750953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053552063.1|3751129_3751330_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	57.1	1.5e-14
WP_053552064.1|3751556_3751757_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.1	5.0e-18
WP_053552065.1|3751976_3753560_+	phosphoglycerate dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	35.2	3.9e-25
WP_053552437.1|3753606_3754890_+	ATP phosphoribosyltransferase regulatory subunit	NA	A0A2I2L577	Orpheovirus	23.8	7.6e-19
WP_053552066.1|3754914_3756207_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.0	1.8e-68
WP_053552067.1|3756583_3757036_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.2	4.7e-40
>prophage 6
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	3773381	3802293	3958620	protease,transposase,tRNA,integrase	Bacillus_phage(28.57%)	26	3798861:3798891	3802328:3802358
WP_053549677.1|3773381_3774551_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053552081.1|3774663_3775278_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053552082.1|3775417_3775660_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096335456.1|3775887_3775998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053552083.1|3776222_3776579_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.2	5.2e-18
WP_053552084.1|3776654_3777431_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	34.8	3.4e-06
WP_053552085.1|3777854_3779981_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_053552086.1|3780101_3780896_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_053552087.1|3781020_3781335_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_053552088.1|3781415_3783992_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053552089.1|3784085_3786041_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053552090.1|3786217_3786646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053552091.1|3786727_3786997_+	glutaredoxin 3	NA	A0A141ZMK2	Faustovirus	36.8	1.2e-06
WP_053552092.1|3786977_3788825_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_053552093.1|3788959_3790195_-	DUF3365 domain-containing protein	NA	A0A1V0S925	Catovirus	38.6	9.9e-08
WP_053550358.1|3790757_3791873_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053552094.1|3791981_3792542_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_053552095.1|3792541_3793201_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_096335457.1|3793258_3794614_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_082351350.1|3794729_3795563_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_053552098.1|3795639_3796419_-	DUF116 domain-containing protein	NA	NA	NA	NA	NA
WP_053552439.1|3796420_3797332_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.1	1.5e-08
WP_082351351.1|3797361_3797880_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	4.4e-18
3798861:3798891	attL	TGTTATGTGAAGCGCGAACTTATGTGAAGTT	NA	NA	NA	NA
WP_082351111.1|3799025_3800291_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1I9SC88	Mycobacterium_phage	27.8	1.6e-05
WP_053552101.1|3800287_3801262_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_053550355.1|3801258_3802293_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3802328:3802358	attR	AACTTCACATAAGTTCGCGCTTCACATAACA	NA	NA	NA	NA
>prophage 7
NZ_CP010802	Desulfuromonas soudanensis strain WTL chromosome, complete genome	3958620	3815831	3852266	3958620	transposase,integrase,protease,tail,tRNA	Bacillus_phage(50.0%)	38	3846622:3846652	3852301:3852331
WP_053552114.1|3815831_3816734_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_053552115.1|3816735_3818019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053552116.1|3818145_3818517_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_053552117.1|3818528_3818813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053552118.1|3819012_3819594_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_082351354.1|3819753_3820311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053552119.1|3820340_3821336_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_053552120.1|3821737_3822031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053552121.1|3822314_3822521_-	LapA family protein	NA	NA	NA	NA	NA
WP_053552122.1|3822708_3823413_+	spermidine synthase	NA	NA	NA	NA	NA
WP_053552123.1|3823581_3825732_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	5.8e-72
WP_053552124.1|3825934_3826528_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_053552125.1|3826670_3827147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096335493.1|3827284_3829786_-	helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.7e-91
WP_096335459.1|3830142_3830811_-	YceH family protein	NA	NA	NA	NA	NA
WP_053552128.1|3830840_3832649_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	34.7	3.8e-32
WP_053552129.1|3832651_3833344_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.2e-31
WP_053552130.1|3833601_3834939_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_096335460.1|3835068_3836892_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.8	2.2e-27
WP_053552132.1|3836888_3837590_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	8.1e-39
WP_053552133.1|3837879_3838398_+	DUF1579 domain-containing protein	NA	NA	NA	NA	NA
WP_082351356.1|3838440_3839397_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_053552134.1|3839500_3839698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053552135.1|3839694_3839886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157671911.1|3839987_3840407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053552136.1|3840455_3841064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096335461.1|3841117_3842297_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.7	1.4e-72
WP_157671912.1|3842824_3843028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157671913.1|3843234_3843681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053549677.1|3843786_3844956_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157671914.1|3845078_3845324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157671915.1|3845391_3846015_+	hypothetical protein	NA	NA	NA	NA	NA
3846622:3846652	attL	TGTTATGTGAAGCGCGAACTTATGTGAAGTT	NA	NA	NA	NA
WP_082351111.1|3846786_3848052_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1I9SC88	Mycobacterium_phage	27.8	1.6e-05
WP_053552139.1|3848048_3848393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053551154.1|3848408_3849707_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	35.0	8.2e-53
WP_053549950.1|3849717_3850488_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	50.6	5.9e-67
WP_053552140.1|3850620_3851235_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_053550355.1|3851231_3852266_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3852301:3852331	attR	AACTTCACATAAGTTCGCGCTTCACATAACA	NA	NA	NA	NA
