The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	564288	607812	5370032	coat,protease	Streptococcus_phage(20.0%)	53	NA	NA
WP_001232991.1|564288_565002_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001180555.1|565145_565331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002981.1|565344_565593_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_142339005.1|565632_566790_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000666168.1|566812_567826_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000713773.1|567891_568539_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000826910.1|568683_569211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920743.1|570062_570452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218968.1|571253_571619_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000026896.1|571660_572044_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000640870.1|572534_572879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568174.1|572891_573191_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001242140.1|573343_573688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000601791.1|574099_575125_+	methionine ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|575117_575783_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053563423.1|575806_576619_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000722397.1|576692_577499_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000929163.1|577737_578523_+	Fe-S cluster assembly ATPase SufC	NA	NA	NA	NA	NA
WP_053563424.1|578538_579831_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001020767.1|579830_581051_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
WP_000009523.1|581040_581472_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001118824.1|581520_582918_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_080672443.1|583467_584859_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000248467.1|584924_585227_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_053563425.1|585281_586013_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_053563426.1|586086_587070_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000166367.1|587259_588156_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000272751.1|588176_588656_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_053563427.1|588730_589285_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_142339007.1|589427_589862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016079840.1|589887_590703_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006918851.1|590803_591538_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053563429.1|591572_592151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435946.1|592269_592578_+	YutD family protein	NA	NA	NA	NA	NA
WP_001174588.1|592623_593121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000392611.1|593494_593761_-	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|593777_594749_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000274010.1|594896_595337_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000503347.1|595417_596050_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000276470.1|596157_596922_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_053563430.1|597110_597692_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000575380.1|598248_599064_-	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_053563431.1|599060_600173_-|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_053563432.1|600178_601525_-	adenine/guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_053563433.1|601469_602573_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_053563434.1|602735_603215_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665103.1|603238_603730_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_053563435.1|603850_604852_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125507.1|604913_605129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|605448_605685_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248588.1|605880_606189_+	YuzD family protein	NA	NA	NA	NA	NA
WP_003272363.1|606241_607036_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053563436.1|607134_607812_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	998460	1006144	5370032		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_001036841.1|998460_999444_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	4.2e-17
WP_053563581.1|999433_1000204_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	5.8e-14
WP_053563582.1|1000236_1001001_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|1001073_1001397_-	heme oxygenase	NA	NA	NA	NA	NA
WP_053563583.1|1001690_1002890_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	3.6e-71
WP_001014310.1|1002928_1003123_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|1003123_1003297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053563584.1|1003465_1004158_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.8e-06
WP_053563585.1|1004159_1005095_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	1.4e-22
WP_043938371.1|1005220_1006144_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 3
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	2881320	2958636	5370032	tail,protease,capsid,portal,integrase,bacteriocin,head,holin,terminase	Bacillus_phage(55.81%)	86	2887450:2887470	2958282:2958302
WP_071714916.1|2881320_2881515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	66.0	6.7e-12
WP_053564335.1|2881650_2882919_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	4.1e-25
WP_000120182.1|2883011_2883119_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_053564336.1|2883255_2884056_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_053564337.1|2884048_2885749_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	22.7	2.6e-06
WP_053564338.1|2885759_2886308_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053564339.1|2886716_2887397_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
2887450:2887470	attL	ATTTATCCTGCTATTTGCAGG	NA	NA	NA	NA
WP_053564340.1|2889536_2891663_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_053564341.1|2891897_2893685_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000766393.1|2894107_2894959_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_023522059.1|2895134_2895713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564342.1|2895822_2897037_-	cytochrome P450	NA	NA	NA	NA	NA
WP_000289127.1|2897177_2897675_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000046095.1|2897777_2897933_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_053564343.1|2898003_2898636_-	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000106397.1|2898625_2899909_-	MFS transporter	NA	NA	NA	NA	NA
WP_053564344.1|2900176_2901412_-	cytochrome P450	NA	NA	NA	NA	NA
WP_053564345.1|2901571_2901976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564346.1|2902121_2903126_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000362069.1|2903335_2903548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878369.1|2903876_2904080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564347.1|2904200_2904617_-	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_053564348.1|2904761_2905526_-	DUF3959 family protein	NA	NA	NA	NA	NA
WP_053564349.1|2905732_2907415_-	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_053564350.1|2908083_2909190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053564351.1|2909361_2910180_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	87.5	5.2e-146
WP_053564352.1|2910179_2910605_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	91.5	5.0e-68
WP_053564353.1|2910645_2916450_-	peptidase S74	NA	D2XR28	Bacillus_phage	44.0	0.0e+00
WP_053564354.1|2916446_2917922_-|tail	phage tail protein	tail	A0A1Z1LZM7	Bacillus_phage	55.6	5.5e-162
WP_053564355.1|2917963_2920117_-|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	74.7	1.6e-93
WP_053564356.1|2920334_2920592_-	hypothetical protein	NA	D2XR26	Bacillus_phage	88.1	3.4e-35
WP_053564357.1|2920846_2922058_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.6	9.6e-189
WP_044798004.1|2922073_2922235_-	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	86.8	4.3e-20
WP_053564358.1|2922288_2922651_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	83.3	2.5e-52
WP_053564359.1|2922655_2923243_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.5	3.3e-86
WP_053564360.1|2923243_2923573_-	hypothetical protein	NA	D2XR22	Bacillus_phage	82.6	2.1e-45
WP_000146466.1|2923569_2923938_-	hypothetical protein	NA	D2XR21	Bacillus_phage	54.2	5.4e-26
WP_053564361.1|2923930_2924230_-|head	phage head closure protein	head	R9TPZ2	Paenibacillus_phage	38.3	4.8e-09
WP_053564362.1|2924226_2924499_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	56.2	8.5e-21
WP_053564363.1|2924501_2924792_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	41.0	2.4e-05
WP_053564364.1|2924828_2925995_-|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	54.7	2.6e-82
WP_053564365.1|2926008_2926593_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	47.3	7.0e-36
WP_053564366.1|2926558_2927770_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.7	2.2e-137
WP_053564367.1|2927785_2929498_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	71.8	9.5e-251
WP_053564368.1|2929463_2929838_-	hypothetical protein	NA	A0A2H4J5M7	uncultured_Caudovirales_phage	41.5	4.3e-15
WP_053564370.1|2930333_2930543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564371.1|2930548_2930851_-	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	44.4	6.4e-17
WP_053564372.1|2931490_2931811_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_053564373.1|2931830_2932361_-	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	3.4e-21
WP_053564374.1|2932499_2932691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564375.1|2933202_2933772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564376.1|2934088_2935747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053565500.1|2936182_2936989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564377.1|2937173_2938196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564378.1|2938411_2939140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564379.1|2939646_2940342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016081850.1|2940684_2941854_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.6	6.1e-23
WP_053564380.1|2942663_2943614_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_053564381.1|2943827_2944370_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	89.4	3.1e-86
WP_053564382.1|2944369_2944852_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.9	2.7e-70
WP_053564383.1|2944879_2945050_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	78.6	8.5e-11
WP_001013579.1|2945148_2945337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564384.1|2945357_2945480_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_053564385.1|2945582_2945747_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	50.0	1.6e-06
WP_053564386.1|2945840_2946044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564387.1|2946192_2946399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053564388.1|2946634_2946994_+	cell division protein DivIVC	NA	NA	NA	NA	NA
WP_053565501.1|2947082_2947304_-	hypothetical protein	NA	A0A060AG41	Listeria_phage	45.7	5.3e-13
WP_053564389.1|2947351_2947564_-	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	79.0	4.3e-20
WP_000811858.1|2947578_2947833_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	85.7	8.8e-36
WP_000805171.1|2947847_2948021_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	1.8e-24
WP_016124626.1|2948046_2948241_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	89.1	4.3e-27
WP_053564390.1|2948256_2949132_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	44.5	2.1e-60
WP_053564391.1|2949070_2949955_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	50.3	1.5e-42
WP_053564392.1|2949961_2950138_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	82.8	1.9e-21
WP_053564394.1|2950331_2950598_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	91.8	6.4e-37
WP_053564395.1|2950654_2950846_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	83.6	1.9e-22
WP_053564396.1|2951043_2951397_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	86.2	2.8e-48
WP_053564397.1|2951715_2951862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564398.1|2951899_2953051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564399.1|2953690_2954170_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053564400.1|2954470_2954932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564401.1|2955165_2956275_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.8	1.8e-146
WP_000736205.1|2956313_2957015_-	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_053564402.1|2957326_2957812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048564718.1|2958306_2958636_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
2958282:2958302	attR	CCTGCAAATAGCAGGATAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	3607385	3616684	5370032		Bacillus_phage(71.43%)	9	NA	NA
WP_053564722.1|3607385_3608258_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
WP_053565514.1|3608391_3609063_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	91.2	5.3e-64
WP_000818985.1|3609210_3609930_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_053564723.1|3610126_3610714_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_053564724.1|3610738_3611812_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_053565515.1|3611808_3612486_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	2.1e-121
WP_053564725.1|3612526_3614287_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.1e-273
WP_053564726.1|3614527_3615292_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_053564727.1|3615391_3616684_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	2.9e-10
>prophage 5
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	5147559	5155935	5370032		Synechococcus_phage(50.0%)	8	NA	NA
WP_053565400.1|5147559_5148147_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.6e-27
WP_053565401.1|5148143_5149184_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000879026.1|5149289_5150705_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055560.1|5150689_5152909_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000666784.1|5152892_5153576_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5153572_5153827_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170549.1|5153819_5154539_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000625682.1|5154627_5155935_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 6
NZ_CP012483	Bacillus cereus strain NJ-W chromosome, complete genome	5370032	5163670	5171621	5370032		Bacillus_phage(33.33%)	6	NA	NA
WP_053565404.1|5163670_5165176_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	5.4e-32
WP_000929891.1|5165159_5165861_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000833096.1|5166006_5167332_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_164468883.1|5167718_5169260_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_001029992.1|5169663_5171298_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_000917311.1|5171336_5171621_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
