The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	1086391	1128438	4294639	lysis,protease,integrase,portal,capsid,terminase	Enterobacteria_phage(26.53%)	56	1086303:1086318	1127336:1127351
1086303:1086318	attL	ATGGCGTCCCCTGCAG	NA	NA	NA	NA
WP_007776948.1|1086391_1086589_-	AlpA family phage regulatory protein	NA	K7P7V0	Enterobacteria_phage	77.8	1.9e-22
WP_032968335.1|1086620_1086968_-	hypothetical protein	NA	F1C5B4	Cronobacter_phage	92.2	8.8e-55
WP_032968333.1|1087311_1088118_-	DUF551 domain-containing protein	NA	A0A2H4FRZ0	Salmonella_phage	71.7	3.3e-12
WP_007776945.1|1088173_1088701_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	65.1	2.7e-47
WP_007893381.1|1088697_1088859_-	DUF2737 family protein	NA	A0A0K2FIU6	Enterobacter_phage	56.9	2.7e-06
WP_144432651.1|1088869_1089175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007776942.1|1089217_1089802_-	hypothetical protein	NA	G9L666	Escherichia_phage	78.5	1.3e-79
WP_007776939.1|1089798_1090479_-	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	85.8	2.4e-112
WP_038882282.1|1090478_1090622_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	76.6	2.2e-12
WP_007841606.1|1090611_1090800_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	74.2	6.9e-22
WP_071603002.1|1090780_1090933_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	67.3	1.1e-14
WP_007706462.1|1091027_1091177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071603003.1|1091333_1091618_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_032967804.1|1091594_1091837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967803.1|1091881_1092505_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	81.2	5.2e-90
WP_032967801.1|1093942_1094644_-	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	83.3	7.9e-111
WP_032967800.1|1094755_1094992_+	antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	83.6	1.9e-29
WP_038882287.1|1095120_1095399_+	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	73.9	2.4e-31
WP_165688899.1|1095439_1095583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967799.1|1095579_1096428_+	replication protein	NA	C6ZR51	Salmonella_phage	74.5	1.4e-114
WP_038882290.1|1096538_1098419_+	AAA family ATPase	NA	B9UDH8	Salmonella_phage	90.7	0.0e+00
WP_038882295.1|1099666_1100017_+	hypothetical protein	NA	F1C5C6	Cronobacter_phage	94.0	1.5e-57
WP_038882291.1|1100352_1100643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059223195.1|1100836_1101277_+	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	91.8	3.2e-70
WP_032967878.1|1101273_1101453_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	63.8	7.3e-13
WP_032967879.1|1101445_1101781_+	DUF2591 family protein	NA	G8C7S4	Escherichia_phage	79.0	1.2e-45
WP_071603077.1|1101773_1101956_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	66.7	9.1e-19
WP_032967881.1|1102211_1102607_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	97.7	5.0e-70
WP_032967882.1|1102603_1102795_+	hypothetical protein	NA	A0A1R3Y5V4	Salmonella_virus	57.1	5.2e-09
WP_007779152.1|1102791_1102971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080629873.1|1102967_1103309_+	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	77.4	3.2e-49
WP_032967883.1|1103305_1104085_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	80.5	5.9e-107
WP_032986368.1|1104616_1104862_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	85.7	1.4e-27
WP_165756546.1|1104870_1105368_+	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	73.3	5.7e-71
WP_032967885.1|1105357_1105723_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	42.0	1.7e-11
WP_071603005.1|1105898_1106270_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	70.3	9.8e-44
WP_007779445.1|1106275_1106518_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	48.6	1.3e-09
WP_032967797.1|1107180_1107672_+|terminase	terminase	terminase	A0A190XCG3	Acinetobacter_phage	50.4	8.7e-32
WP_007770945.1|1107671_1109132_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.0	1.8e-218
WP_038882300.1|1109131_1111306_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	78.6	0.0e+00
WP_038882301.1|1111319_1112231_+	scaffolding protein	NA	A0A0M3ULI9	Salmonella_phage	84.8	5.4e-136
WP_007773761.1|1112230_1113535_+|capsid	phage capsid protein	capsid	G5DA99	Enterobacteria_phage	71.3	9.4e-174
WP_032967824.1|1113575_1113773_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	42.6	7.8e-08
WP_038882302.1|1113756_1114272_+	recombinase RmuC	NA	E7C9U0	Salmonella_phage	64.3	8.8e-51
WP_038882303.1|1114231_1115653_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	68.5	4.3e-196
WP_038882304.1|1115652_1116321_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	72.3	3.3e-42
WP_032969231.1|1116320_1116776_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	89.2	2.7e-75
WP_038882305.1|1116784_1117465_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	79.9	3.4e-66
WP_038882306.1|1117474_1118914_+	phage DNA ejection protein	NA	A0A192Y834	Salmonella_phage	53.4	2.6e-116
WP_038882308.1|1118913_1120899_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	73.5	4.2e-266
WP_050570126.1|1121051_1123163_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	58.5	8.6e-52
WP_038882310.1|1123175_1124615_-	hypothetical protein	NA	F1C5A9	Cronobacter_phage	25.3	3.5e-28
WP_007779916.1|1124616_1125537_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	93.0	4.9e-161
WP_032967911.1|1125533_1125896_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	98.3	3.1e-58
WP_007779919.1|1126016_1127174_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	73.3	4.1e-165
WP_032983646.1|1127487_1128438_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	80.1	1.8e-129
1127336:1127351	attR	ATGGCGTCCCCTGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	1452337	1461323	4294639		Burkholderia_phage(33.33%)	9	NA	NA
WP_007794693.1|1452337_1452577_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	84.8	5.5e-32
WP_007776171.1|1452731_1453856_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.9	3.2e-106
WP_007776167.1|1454498_1455197_+	phosphohydrolase	NA	S4W232	Pandoravirus	25.5	3.6e-07
WP_007776166.1|1455257_1456691_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.3	5.2e-101
WP_032968279.1|1456674_1457172_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.0	4.0e-32
WP_007776162.1|1457175_1458087_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_023898472.1|1458265_1459180_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004388133.1|1459269_1459452_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_023898473.1|1459652_1461323_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	7.9e-24
>prophage 3
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	1475447	1492114	4294639	head,holin,lysis,protease,tail	Cronobacter_phage(33.33%)	27	NA	NA
WP_007774940.1|1475447_1476737_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	66.4	1.5e-171
WP_071603019.1|1476771_1477023_-	excisionase family protein	NA	S4TND0	Salmonella_phage	68.5	6.2e-26
WP_015386538.1|1477166_1477334_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032983760.1|1477330_1478227_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	57.1	1.0e-38
WP_007776158.1|1478223_1478460_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007776157.1|1478459_1479638_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	83.3	3.4e-106
WP_007776155.1|1479634_1479964_+|protease	SOS-response repressor and protease LexA	protease	S5FXP5	Shigella_phage	50.0	7.4e-19
WP_032968278.1|1479960_1480716_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	88.0	3.1e-137
WP_032968904.1|1480730_1481114_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	76.4	8.5e-51
WP_007776144.1|1481302_1481626_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	65.1	8.5e-36
WP_105609544.1|1481852_1482335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032983761.1|1482495_1482876_+	membrane protein	NA	F1C592	Cronobacter_phage	96.8	1.0e-59
WP_007776138.1|1482862_1483135_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.2	1.8e-18
WP_032983762.1|1483142_1483766_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	92.3	6.8e-106
WP_032968274.1|1483765_1484230_+|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	57.7	4.0e-34
WP_032968273.1|1484429_1485020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032968271.1|1485019_1485454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032968269.1|1485616_1485970_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.9	4.3e-49
WP_032968268.1|1486033_1486453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007776129.1|1486446_1486773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.9	3.3e-27
WP_007776127.1|1486910_1487240_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	1.2e-21
WP_004388601.1|1487286_1487742_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	75.0	1.4e-55
WP_007776123.1|1487790_1488186_+|tail	phage tail assembly chaperone	tail	F1C576	Cronobacter_phage	88.5	1.4e-59
WP_080629967.1|1488310_1488781_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	69.9	5.6e-60
WP_032983697.1|1489957_1490353_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	54.3	3.1e-11
WP_014728470.1|1490430_1490868_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	100.0	9.4e-78
WP_032983696.1|1490851_1492114_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	97.9	2.0e-242
>prophage 4
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	1660029	1709071	4294639	lysis,protease,tail,capsid,terminase	Cronobacter_phage(40.98%)	73	NA	NA
WP_007777843.1|1660029_1661316_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	59.0	2.8e-138
WP_032804352.1|1661349_1661598_-	excisionase family protein	NA	S4TND0	Salmonella_phage	51.9	8.9e-17
WP_050555921.1|1661638_1662193_-	hypothetical protein	NA	A0A291AXI6	Shigella_phage	48.1	1.5e-35
WP_012125677.1|1662834_1663023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967863.1|1664130_1664334_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	77.3	1.2e-22
WP_007777849.1|1664330_1664813_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.7	1.2e-70
WP_071601099.1|1665285_1665447_-	DUF2737 family protein	NA	A0A1Q1PUW2	Escherichia_phage	50.9	6.0e-06
WP_144432653.1|1665457_1665763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071603024.1|1665773_1666247_-	hypothetical protein	NA	Q716E9	Shigella_phage	82.7	4.0e-74
WP_032967864.1|1666258_1666687_-	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	68.3	5.4e-46
WP_007778080.1|1666687_1667311_-	hypothetical protein	NA	A0A1W6JP21	Morganella_phage	68.8	8.4e-72
WP_007841605.1|1667307_1667451_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	78.7	7.6e-13
WP_038882406.1|1667440_1667629_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	75.8	6.9e-22
WP_071603025.1|1667609_1667768_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	82.7	4.6e-19
WP_007778130.1|1667793_1668762_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	93.2	3.7e-50
WP_007893358.1|1668847_1669075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007778131.1|1669195_1669375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967867.1|1669434_1669917_-	hypothetical protein	NA	G8C7T5	Escherichia_phage	48.1	3.2e-26
WP_032967868.1|1669913_1670228_-	hypothetical protein	NA	A0A0N7BZP1	Escherichia_phage	51.0	1.1e-14
WP_038882408.1|1670593_1671283_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	98.7	2.2e-121
WP_012815642.1|1671381_1671609_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	55.4	7.1e-13
WP_032971330.1|1671727_1672006_+	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	77.2	1.5e-33
WP_085959971.1|1672040_1672187_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	75.0	4.6e-13
WP_032967871.1|1672179_1673037_+	replication protein	NA	K7PL20	Enterobacteria_phage	55.6	2.6e-79
WP_038882411.1|1673147_1675028_+	AAA family ATPase	NA	B9UDH8	Salmonella_phage	91.0	0.0e+00
WP_038882413.1|1675045_1675795_+	hypothetical protein	NA	F1C5C5	Cronobacter_phage	45.0	7.1e-41
WP_007778493.1|1676062_1676413_+	hypothetical protein	NA	F1C5C6	Cronobacter_phage	96.6	3.5e-59
WP_007778496.1|1676414_1676558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038882415.1|1676550_1676823_+	hypothetical protein	NA	U5P0J0	Shigella_phage	48.8	7.7e-06
WP_041461066.1|1677016_1677457_+	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	91.8	4.2e-70
WP_032967872.1|1677453_1678029_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.4	9.5e-62
WP_071603027.1|1678004_1678184_+	NinE family protein	NA	G8C7M6	Escherichia_phage	49.1	2.3e-06
WP_007778601.1|1678173_1678398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007778604.1|1678397_1678766_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	54.7	2.3e-24
WP_038882428.1|1678758_1678935_+	NinF family protein	NA	Q5G8S2	Enterobacteria_phage	62.1	2.6e-15
WP_038882429.1|1678927_1679230_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	45.7	6.6e-14
WP_032968653.1|1679222_1679834_+	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	97.0	2.5e-105
WP_050570128.1|1679830_1680022_+	hypothetical protein	NA	A0A1R3Y5V4	Salmonella_virus	57.1	8.9e-09
WP_032967874.1|1680018_1680198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007778679.1|1680427_1681018_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	98.5	1.1e-108
WP_007778777.1|1682112_1682304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032986368.1|1682515_1682761_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	85.7	1.4e-27
WP_167346755.1|1682769_1683267_+	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	71.2	5.9e-68
WP_158506671.1|1683405_1683939_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	46.5	5.6e-32
WP_032967889.1|1683928_1684393_+|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	73.2	8.8e-50
WP_007779579.1|1684556_1685261_+	DNA-binding protein Roi of bacteriophage BP-933W	NA	Q5MBW0	Stx1-converting_phage	81.3	2.4e-99
WP_038882433.1|1685361_1685604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007779657.1|1685636_1685837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967891.1|1685846_1686341_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	76.5	6.7e-48
WP_007779660.1|1686276_1687530_+|terminase	phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	91.7	4.4e-205
WP_007779663.1|1688086_1689430_+	DUF1073 domain-containing protein	NA	G0ZND5	Cronobacter_phage	97.2	1.2e-237
WP_032968667.1|1689377_1690340_+|capsid	minor capsid protein	capsid	G0ZND6	Cronobacter_phage	80.6	1.2e-24
WP_038882434.1|1690356_1691631_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	99.1	6.4e-236
WP_007786504.1|1691630_1692083_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	98.7	9.1e-76
WP_032986381.1|1692097_1693195_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	99.7	5.2e-210
WP_032967896.1|1693205_1693502_+	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	93.9	1.3e-46
WP_032967897.1|1693560_1693962_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	99.2	6.0e-71
WP_071603028.1|1693961_1694132_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.0	9.1e-13
WP_007779732.1|1694134_1694485_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	86.1	2.3e-55
WP_007779733.1|1694486_1694948_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	45.8	1.4e-28
WP_032967899.1|1694944_1695325_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	44.9	2.7e-28
WP_032967901.1|1695382_1696138_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	52.2	2.4e-57
WP_007779740.1|1696191_1696881_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	46.4	5.9e-50
WP_032967902.1|1696953_1697331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007779743.1|1697390_1700321_+|tail	phage tail length tape-measure protein 1	tail	F1C5E9	Cronobacter_phage	48.2	1.1e-142
WP_007779747.1|1700320_1700818_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	97.0	3.3e-95
WP_032967903.1|1700817_1701288_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.9	5.7e-81
WP_050555926.1|1701250_1701667_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	92.0	1.7e-73
WP_032967906.1|1701653_1704131_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	90.4	0.0e+00
WP_038882437.1|1704187_1706332_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	72.3	3.2e-54
WP_007775782.1|1706352_1707798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059223196.1|1707794_1708712_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	96.7	1.7e-166
WP_007775768.1|1708708_1709071_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	97.5	8.9e-58
>prophage 5
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	2323160	2333357	4294639	tRNA	Bacillus_phage(14.29%)	12	NA	NA
WP_007783693.1|2323160_2323625_-	lipoprotein nlpC precursor	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_007783690.1|2323702_2324449_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.7	3.8e-10
WP_004387815.1|2324448_2325000_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_032968130.1|2325029_2326031_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_007676383.1|2326108_2326408_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_007783675.1|2326412_2328800_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.0	2.8e-06
WP_007792775.1|2328815_2329799_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	1.4e-33
WP_023898905.1|2330017_2330164_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_007783664.1|2330183_2330540_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2330587_2330785_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012905609.1|2330882_2331425_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.1e-14
WP_004387090.1|2331428_2333357_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.1e-130
>prophage 6
NZ_CP013940	Cronobacter malonaticus LMG 23826 chromosome, complete genome	4294639	3189279	3214000	4294639	protease,transposase,integrase	Ralstonia_phage(28.57%)	21	3189048:3189089	3217196:3217237
3189048:3189089	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
WP_007780382.1|3189279_3190599_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_016246899.1|3191479_3192244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071601457.1|3192705_3193326_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_071601456.1|3195761_3196025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|3196039_3196303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601204.1|3196531_3196708_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007780320.1|3196847_3197417_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_032986565.1|3197522_3200372_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	4.0e-129
WP_032986562.1|3200619_3202437_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.0	2.1e-99
WP_001275372.1|3202524_3202983_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|3203005_3203920_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_007791120.1|3204021_3204909_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090779.1|3204998_3205610_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_007780005.1|3205689_3206835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029039045.1|3206824_3207265_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_023899359.1|3207268_3208978_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_032967912.1|3208980_3209478_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_007779958.1|3209455_3210421_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_023899362.1|3210445_3211597_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_007777755.1|3211821_3212802_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.0	1.5e-91
WP_085959969.1|3212852_3214000_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	8.6e-147
3217196:3217237	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
