The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	251708	313256	4587291	holin,integrase,transposase	Acinetobacter_phage(28.57%)	54	250373:250389	305429:305445
250373:250389	attL	CAGCTTCGCTGTTTTTG	NA	NA	NA	NA
WP_000006255.1|251708_252206_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|252429_254169_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|254113_254899_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|254969_256025_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|256076_256370_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|256372_256771_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|256780_257233_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|258330_259788_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_010723085.1|260109_261126_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|261333_262737_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|262723_263656_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|263764_264811_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001030800.1|266393_266744_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|266837_267992_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|268286_269195_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|269209_271177_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|271403_272786_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|272797_274408_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|274412_275171_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|275309_276314_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|277508_278240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|278330_278957_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|279228_279927_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|279953_280808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|280926_281151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|281147_281588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|281704_283105_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|283389_283800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|283778_284735_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|284744_286943_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|286939_287896_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|287892_288582_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|288999_289614_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|289861_290191_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|290503_291214_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|291182_292826_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|292815_295341_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001698039.1|295366_296035_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|296092_296680_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|296754_297297_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|298120_298348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|298382_298523_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|298522_298786_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|299149_299251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|301299_302461_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|303734_304328_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|304339_304576_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|304684_306010_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
305429:305445	attR	CAAAAACAGCGAAGCTG	NA	NA	NA	NA
WP_000339594.1|306235_307090_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|307616_308336_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|308346_309774_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|309766_310462_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|310704_311373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|311585_313256_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 2
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	551600	564767	4587291	integrase,transposase	Enterobacteria_phage(56.25%)	21	551541:551587	569445:569491
551541:551587	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|551600_552764_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|552883_553147_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|553469_553565_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|553627_554789_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|555100_555433_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|555480_555630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|555687_557214_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|557678_558230_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|558239_559037_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|559153_559255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|559251_559707_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|559706_559877_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|559869_560160_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|560156_560519_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|560515_560656_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|560741_561125_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|561522_562539_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|562571_562982_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|563267_563474_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|563638_563833_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|564221_564767_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
569445:569491	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	1178030	1199423	4587291	tail,integrase,tRNA,portal,plate	Shigella_phage(25.0%)	33	1170025:1170039	1206126:1206140
1170025:1170039	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1178030_1179137_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1179190_1179652_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1179661_1180315_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1180486_1181737_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1182230_1182896_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1182896_1183601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1184058_1184952_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1185042_1186170_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1186150_1186396_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1186432_1186744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071592177.1|1186860_1187202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1187139_1187448_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1187622_1188297_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1188387_1188588_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1188631_1189189_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1189364_1189544_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1189533_1190901_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1190912_1191095_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1191094_1191568_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1191494_1192286_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1192276_1192861_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1192864_1193494_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1193495_1193909_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1193880_1194483_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1194482_1194977_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1195048_1195603_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1195709_1196543_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1196776_1196941_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1197043_1197367_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_120795380.1|1197623_1197668_-	protein YmgK	NA	NA	NA	NA	NA
WP_032082692.1|1197903_1198014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1198066_1198471_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1198691_1199423_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1206126:1206140	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	1591755	1636420	4587291	lysis,protease,transposase,tail	Enterobacteria_phage(30.0%)	57	NA	NA
WP_000527743.1|1591755_1593216_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1595192_1595306_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1595374_1595608_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1595924_1596515_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1596612_1597188_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1597187_1598150_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1598100_1598670_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1599058_1599292_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1599349_1599760_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1599911_1600085_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1600256_1600412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1600490_1600556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1600558_1600747_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1600757_1600970_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1601332_1601830_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1601826_1602360_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1602356_1602668_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1602672_1602888_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1603641_1603857_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1604157_1604370_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1604424_1604514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1604791_1605544_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1605557_1606607_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1606608_1606887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1606953_1607205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1607421_1607577_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1607648_1607936_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1607935_1608175_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1608199_1608505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1608707_1609040_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1609476_1609626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1609922_1610153_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1610236_1610644_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1610810_1610966_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1611125_1611344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1611911_1612100_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1612096_1612288_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001360138.1|1615030_1615141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1615198_1616218_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1616229_1617444_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1617649_1617976_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_088895425.1|1618272_1619500_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001138581.1|1619822_1620383_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1620385_1621096_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1621203_1621509_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1621707_1624134_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1624194_1626618_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1626628_1627246_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1627247_1628102_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1628144_1628759_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1628917_1630210_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1630162_1630858_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001019525.1|1632337_1633231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1633337_1634591_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1634987_1635323_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1635415_1635499_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1635598_1636420_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	2428937	2440147	4587291	integrase,tail	Enterobacteria_phage(53.33%)	16	2426912:2426928	2443822:2443838
2426912:2426928	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2428937_2429870_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2430181_2431339_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2431491_2431854_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2431850_2432771_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2432767_2434099_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2434133_2434415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2434713_2435154_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2435180_2435699_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2435748_2436024_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2436023_2436518_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2437240_2437603_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2437668_2438493_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2438620_2439157_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2439147_2439510_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2439509_2439815_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2439946_2440147_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2443822:2443838	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP011113	Escherichia coli strain RR1 chromosome, complete genome	4587291	2813939	2821078	4587291		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2813939_2816501_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2816606_2817263_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2817313_2818081_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2818276_2819185_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2819181_2820348_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2820439_2821078_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
