The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	532190	592465	2372492	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	46	NA	NA
WP_004585366.1|532190_533243_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013815638.1|533260_534037_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005874669.1|534046_534889_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005874556.1|534996_535224_-	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
WP_004585370.1|535270_536098_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_125026584.1|536603_536678_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_004585423.1|537514_538183_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013816575.1|538179_538374_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_023847604.1|538763_540572_+	tetratricopeptide repeat-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004585426.1|540584_541268_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053444038.1|541381_542068_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004585428.1|542159_542645_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	1.3e-27
WP_053444039.1|542785_545317_+|protease	thiol protease/hemagglutinin PrtT	protease	NA	NA	NA	NA
WP_053444041.1|546555_548226_+	peptidylarginine deiminase PPAD	NA	NA	NA	NA	NA
WP_053444042.1|548450_549983_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010956309.1|550318_550489_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_144419628.1|550928_552301_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.8	1.2e-09
WP_021679513.1|552439_554248_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.1	6.1e-46
WP_053444043.1|554369_556016_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_077070601.1|556084_556315_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_053444044.1|556311_557253_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_023846932.1|557688_560292_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004585438.1|562196_563882_+	putative transporter	NA	NA	NA	NA	NA
WP_004585439.1|563971_564490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004585440.1|564486_565452_-	cation transporter	NA	NA	NA	NA	NA
WP_053444045.1|565714_566251_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_053444046.1|566744_569600_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_004585445.1|569626_570343_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_053444047.1|570326_571241_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_053444048.1|571237_572383_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_021677368.1|572635_574015_+	tryptophanase	NA	NA	NA	NA	NA
WP_053444049.1|574270_574447_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080998259.1|574497_574740_-	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_053444050.1|575749_577267_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	41.6	8.6e-54
WP_004585450.1|577369_578389_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_005873531.1|578426_579314_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_021663463.1|579313_579832_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004585453.1|579824_581690_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_021663461.1|581679_583137_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_053444051.1|583164_584376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013816610.1|584767_585226_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_013816611.1|585290_586001_+	DUF3256 family protein	NA	NA	NA	NA	NA
WP_053444052.1|586037_586964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444053.1|587147_589727_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.1e-109
WP_023846945.1|589760_590963_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004585672.1|591562_592465_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	715885	784671	2372492	tRNA,transposase,integrase	Tupanvirus(21.43%)	58	776837:776853	791890:791906
WP_004585672.1|715885_716788_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_053444090.1|716941_718099_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_023847614.1|718625_721022_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	43.8	7.0e-183
WP_004584586.1|721054_721546_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A1W5P0X3	Cronobacter_phage	42.7	1.9e-26
WP_004584585.1|721657_721936_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_080998267.1|722256_723771_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004584582.1|723767_724391_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_021665263.1|724397_724925_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053444093.1|724912_726922_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	35.9	2.9e-105
WP_004584579.1|726934_728170_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080998320.1|728457_728727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004584578.1|728971_729238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021662614.1|729267_730029_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004584576.1|730043_730775_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_005874788.1|731020_732082_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_053444094.1|732096_734727_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	41.7	4.6e-95
WP_053444096.1|735098_735809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584511.1|737310_738897_-	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	43.7	3.2e-91
WP_013815980.1|738931_740719_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	45.5	3.1e-26
WP_004584509.1|741293_741929_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004584508.1|742012_742759_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	3.2e-17
WP_004584507.1|742802_743507_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004584506.1|743503_744103_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053444097.1|744099_744810_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_004584504.1|745126_746083_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_010956255.1|746771_748109_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_080998264.1|748435_749569_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_053444098.1|749623_751732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444099.1|752236_753322_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.4	4.5e-20
WP_021679632.1|753677_754343_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	27.7	1.5e-10
WP_053444100.1|754389_756261_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.1	1.5e-55
WP_053444101.1|756286_757852_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004584492.1|758792_759518_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004584491.1|759527_760661_-	4-phosphoerythronate dehydrogenase PdxB	NA	NA	NA	NA	NA
WP_004584490.1|760664_760976_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_004584488.1|761251_761710_-	DUF4293 domain-containing protein	NA	NA	NA	NA	NA
WP_004584487.1|761739_762072_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004584486.1|762213_763026_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004584485.1|763376_764549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004584484.1|764563_765214_-	viroplasmin family protein	NA	NA	NA	NA	NA
WP_005875017.1|765241_766255_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004584482.1|766267_766807_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_053444103.1|766815_768603_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	40.4	2.8e-128
WP_053444104.1|768651_770199_-	DUF4301 family protein	NA	NA	NA	NA	NA
WP_053444105.1|770663_771665_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_053444106.1|771654_772059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080998268.1|772289_772802_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_053444107.1|772805_773756_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_053444108.1|774447_774726_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053444109.1|774728_775016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053444110.1|775049_775952_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
776837:776853	attL	TTTATTGTTATACAATT	NA	NA	NA	NA
WP_053444111.1|776854_778138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444112.1|778127_779165_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_053444113.1|779136_780240_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053444114.1|780236_780944_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.8	1.4e-17
WP_053444115.1|780940_781678_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.5	5.7e-11
WP_053444116.1|782213_783443_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.5	8.3e-23
WP_053444117.1|783468_784671_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
791890:791906	attR	AATTGTATAACAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	963220	1033977	2372492	tRNA,transposase,protease	Bacillus_virus(28.57%)	55	NA	NA
WP_021664734.1|963220_964654_+|protease	cysteine protease	protease	NA	NA	NA	NA
WP_021677664.1|965108_965795_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_013815795.1|965811_966168_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053444175.1|966232_967648_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_144419662.1|967689_968547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021662201.1|968580_969459_-	MCE family protein	NA	NA	NA	NA	NA
WP_053444177.1|969499_970690_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PTK7	Bacillus_virus	35.5	6.2e-23
WP_053444136.1|971149_972238_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_053444178.1|973182_974115_+	DtxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053444652.1|974151_976326_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_004584279.1|976363_978010_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004584278.1|978078_979032_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004584277.1|979050_979515_+	arginine repressor	NA	NA	NA	NA	NA
WP_004584276.1|979945_981673_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_004584274.1|981906_984204_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.3	9.8e-118
WP_004584273.1|984203_985583_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_053444179.1|985608_988512_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	47.8	8.9e-249
WP_005873451.1|988582_989956_-	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_005873460.1|990050_990785_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.4	1.8e-28
WP_004584269.1|990803_991550_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053444180.1|991786_993127_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_053444181.1|993510_995208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144419663.1|995638_995755_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_053444182.1|995922_996900_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_013815769.1|996906_997506_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_053444183.1|997548_999192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004584258.1|999188_1001999_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004584257.1|1002170_1003352_-	DUF4876 domain-containing protein	NA	NA	NA	NA	NA
WP_004584255.1|1003702_1006429_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	36.0	1.1e-86
WP_021664784.1|1006596_1006740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444184.1|1006794_1009338_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004584250.1|1009957_1011454_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_053444185.1|1011757_1013155_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_004584247.1|1013907_1014735_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.6e-14
WP_004584246.1|1014748_1015603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584245.1|1015599_1016358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584244.1|1016354_1016726_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053444186.1|1016999_1019450_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004584241.1|1019480_1020221_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_053444187.1|1020531_1022811_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_021663955.1|1022969_1023962_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_021663954.1|1024036_1024318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004584236.1|1024449_1024986_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_004584235.1|1024989_1025616_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_004584234.1|1025637_1026753_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_004584233.1|1026749_1027064_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053444188.1|1028346_1028652_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_077094531.1|1028700_1028910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444189.1|1029032_1030994_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	3.8e-126
WP_005874110.1|1031098_1031704_+	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_004584226.1|1031781_1031979_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_053444190.1|1032091_1032439_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004584223.1|1032961_1033462_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_081396921.1|1033403_1033775_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077083745.1|1033731_1033977_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	1105850	1172103	2372492	tRNA,transposase,integrase	Ralstonia_phage(20.0%)	54	1138629:1138669	1188754:1188794
WP_053444217.1|1105850_1106936_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	1.7e-19
WP_144419643.1|1107586_1109002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444219.1|1109078_1110647_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053444220.1|1110631_1111660_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053444221.1|1111826_1114052_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_021664060.1|1114234_1114483_+	DUF4492 domain-containing protein	NA	NA	NA	NA	NA
WP_080998281.1|1114502_1116092_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004584131.1|1116137_1117301_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_021677204.1|1117447_1118239_+	patatin-like phospholipase family protein	NA	M1I2P3	Paramecium_bursaria_Chlorella_virus	28.8	1.1e-07
WP_053444223.1|1118235_1119930_+	alpha-amylase	NA	NA	NA	NA	NA
WP_053444224.1|1120467_1123674_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	31.3	3.3e-127
WP_053444225.1|1124268_1124961_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_053444226.1|1125185_1126838_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_173568180.1|1127224_1127398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080998282.1|1127966_1129658_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_053444227.1|1129693_1130890_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_053444228.1|1131375_1132140_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_023847532.1|1132136_1133237_-	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II	NA	NA	NA	NA	NA
WP_053444229.1|1133252_1134503_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021664999.1|1134499_1135861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005874177.1|1135857_1136823_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004584116.1|1136896_1137919_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.6	2.7e-115
WP_053444230.1|1137939_1138395_-	peroxiredoxin	NA	NA	NA	NA	NA
1138629:1138669	attL	GAGGAAAGAGACTAAAAATTTTCAAACGCGATCGCCCTGAC	NA	NA	NA	NA
WP_080998283.1|1138721_1139099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444231.1|1139268_1140180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444232.1|1140343_1141768_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_053444656.1|1142013_1142916_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053444233.1|1143004_1144108_+|integrase	site-specific integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	27.8	2.6e-07
WP_053444234.1|1144208_1144931_+	mobilization protein	NA	NA	NA	NA	NA
WP_053444235.1|1145023_1145386_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053444236.1|1145392_1146769_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_053444657.1|1148030_1148378_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_053444237.1|1148374_1149298_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_053444238.1|1149294_1149990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444239.1|1150318_1151152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444240.1|1151237_1152170_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	28.3	5.7e-24
WP_053444241.1|1152270_1153356_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_053444242.1|1153373_1153814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444243.1|1154120_1155272_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_053444244.1|1155277_1156831_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.1	7.5e-162
WP_053444245.1|1156834_1157539_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_053444246.1|1157541_1160370_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_053444247.1|1160510_1160735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053444248.1|1160805_1162326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444249.1|1162342_1162507_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053444250.1|1162720_1163989_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_041590594.1|1163992_1164313_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004584112.1|1164709_1165492_-	DUF4393 domain-containing protein	NA	A0A1S5SAN8	Streptococcus_phage	26.1	3.4e-14
WP_005874045.1|1165528_1166014_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_053444251.1|1166443_1167529_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.1	1.7e-19
WP_053444252.1|1168147_1169371_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	41.2	8.5e-36
WP_053444253.1|1169404_1169878_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_023847469.1|1170012_1170360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584223.1|1171602_1172103_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
1188754:1188794	attR	GAGGAAAGAGACTAAAAATTTTCAAACGCGATCGCCCTGAC	NA	NA	NA	NA
>prophage 5
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	1851221	1925222	2372492	transposase,protease	Ralstonia_phage(22.22%)	52	NA	NA
WP_004585672.1|1851221_1852124_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_080998304.1|1852360_1852639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444455.1|1852726_1853362_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	30.4	3.2e-10
WP_023847771.1|1854108_1855311_+	aminopeptidase	NA	NA	NA	NA	NA
WP_053444456.1|1855430_1857467_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_053444457.1|1857483_1858968_-	DUF3943 domain-containing protein	NA	NA	NA	NA	NA
WP_012458522.1|1858964_1859180_-|protease	Spi family protease inhibitor	protease	NA	NA	NA	NA
WP_013815169.1|1859730_1862034_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_053444458.1|1862030_1864037_+	alpha amylase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053444459.1|1864086_1866867_+	DNA polymerase I	NA	J9PVA4	Bacillus_phage	30.8	2.3e-68
WP_023847765.1|1867012_1867834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444460.1|1868119_1871005_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.4	1.0e-15
WP_053444461.1|1871083_1872301_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_157763428.1|1872561_1872654_-	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_143734284.1|1872622_1872691_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_005874149.1|1873056_1873647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458512.1|1873650_1874589_+	DUF2764 domain-containing protein	NA	NA	NA	NA	NA
WP_005874139.1|1874598_1876353_+	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004583479.1|1876364_1877684_+	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004583478.1|1877699_1878314_+	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_053444462.1|1878310_1880125_+	ATPase	NA	NA	NA	NA	NA
WP_004583476.1|1880178_1880655_+	ATP synthase subunit C	NA	NA	NA	NA	NA
WP_005874128.1|1881015_1883304_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	30.9	2.3e-10
WP_004583473.1|1883551_1884097_-	2-oxoacid:acceptor oxidoreductase family protein	NA	NA	NA	NA	NA
WP_004583472.1|1884125_1884890_-	2-oxoglutarate oxidoreductase	NA	NA	NA	NA	NA
WP_004583471.1|1884906_1885086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005874126.1|1885106_1886189_-	3-methyl-2-oxobutanoate dehydrogenase subunit VorB	NA	NA	NA	NA	NA
WP_004583469.1|1886207_1886435_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_053444463.1|1886666_1888688_-	DNA primase	NA	A0A1B0WMR3	Flavobacterium_phage	34.6	4.2e-48
WP_004583467.1|1888729_1889494_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004583466.1|1889490_1890012_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004583465.1|1890280_1891096_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004583462.1|1892453_1893950_-	ammonia-forming cytochrome c nitrite reductase	NA	NA	NA	NA	NA
WP_053444465.1|1893971_1894583_-	cytochrome c nitrite reductase small subunit	NA	NA	NA	NA	NA
WP_004583460.1|1895465_1896080_+	PorT family protein	NA	NA	NA	NA	NA
WP_021662359.1|1896212_1897490_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	69.0	2.1e-162
WP_053444466.1|1897705_1898125_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_004583457.1|1898261_1898765_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004583456.1|1898981_1899194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444467.1|1899364_1901038_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_053444468.1|1901512_1903636_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.5	8.1e-66
WP_144419650.1|1903681_1903900_-	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_144419651.1|1904009_1905382_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.8	1.2e-09
WP_053444470.1|1905777_1906593_+	glycogen/starch synthase	NA	NA	NA	NA	NA
WP_053444471.1|1906695_1908063_+	DUF4270 domain-containing protein	NA	NA	NA	NA	NA
WP_004583450.1|1908165_1909401_+	nucleoside permease	NA	NA	NA	NA	NA
WP_053444472.1|1909782_1914921_+	DUF2436 domain-containing protein	NA	NA	NA	NA	NA
WP_012458490.1|1915576_1916500_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_021680035.1|1916480_1917500_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053444473.1|1917947_1923149_+	DUF2436 domain-containing protein	NA	NA	NA	NA	NA
WP_053444474.1|1923416_1924052_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	29.7	1.2e-09
WP_004585672.1|1924319_1925222_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011996	Porphyromonas gingivalis AJW4 chromosome, complete genome	2372492	2248146	2307367	2372492	tRNA,transposase	Shigella_phage(16.67%)	52	NA	NA
WP_144419628.1|2248146_2249519_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.8	1.2e-09
WP_021662294.1|2249626_2250397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444592.1|2250692_2251649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143735337.1|2252136_2252337_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_021663252.1|2252438_2252651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004584658.1|2252802_2253381_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_080998264.1|2253488_2254622_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_004584657.1|2255474_2256446_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005873709.1|2256562_2257372_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ36	Paenibacillus_phage	32.4	2.1e-30
WP_021663757.1|2257424_2258504_-	asparaginase	NA	NA	NA	NA	NA
WP_004584653.1|2259102_2260113_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_053444595.1|2260252_2261200_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053444596.1|2261311_2261986_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004584649.1|2261982_2262426_-	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_144419637.1|2262727_2264100_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	1.1e-18
WP_004584647.1|2264495_2265077_+	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_053444597.1|2265102_2266575_+	DUF3868 domain-containing protein	NA	NA	NA	NA	NA
WP_053444598.1|2266630_2267794_+	fimbrial protein	NA	NA	NA	NA	NA
WP_021663766.1|2267932_2268844_+	FimB/Mfa2 family fimbrial subunit	NA	NA	NA	NA	NA
WP_053444686.1|2268857_2270231_+	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_053444599.1|2270245_2272258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053444600.1|2272254_2273907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158487794.1|2274104_2274197_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_053444602.1|2274440_2274992_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_010956508.1|2274998_2275184_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_012457314.1|2275363_2276371_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_012457315.1|2276449_2277349_+	GTPase Era	NA	NA	NA	NA	NA
WP_023846881.1|2277411_2278725_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_053444603.1|2278775_2282075_+	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_004585672.1|2282761_2283664_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_053444604.1|2283825_2284512_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_004584630.1|2284709_2285291_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013816029.1|2285327_2286665_-	purine permease	NA	H9YQ34	environmental_Halophage	45.9	3.4e-22
WP_053444605.1|2286826_2287498_-	PorT family protein	NA	NA	NA	NA	NA
WP_053444606.1|2287557_2289063_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021678035.1|2289585_2290266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023847600.1|2290255_2291623_-	C10 family peptidase	NA	NA	NA	NA	NA
WP_144006499.1|2291935_2292043_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012457321.1|2292464_2292650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053444687.1|2292676_2293567_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_053444607.1|2293612_2294359_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_053444608.1|2294706_2295708_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_004584619.1|2295731_2296157_+	SufE family protein	NA	NA	NA	NA	NA
WP_053444609.1|2296160_2297558_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_021677258.1|2298406_2299306_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053444610.1|2299302_2300454_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_004583692.1|2300490_2301261_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_012457328.1|2301257_2301815_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_053444611.1|2301811_2303359_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.8	5.4e-43
WP_043895842.1|2303818_2305258_-	DUF3868 domain-containing protein	NA	NA	NA	NA	NA
WP_004583687.1|2305302_2305896_-	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_053444612.1|2306287_2307367_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	26.2	7.8e-17
