The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	5466	52923	3654829	integrase,transposase,coat	Streptococcus_phage(33.33%)	44	6508:6523	49235:49250
WP_013145465.1|5466_5715_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_014195683.1|5923_6103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374718.1|6151_7417_-	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
6508:6523	attL	TTTCCCCGACCGCTTC	NA	NA	NA	NA
WP_053413457.1|7587_9024_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
WP_053413458.1|9357_11634_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155467790.1|11837_12947_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S4VZ68	Pandoravirus	36.7	8.4e-06
WP_053413459.1|13264_14923_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013523649.1|15109_15895_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413460.1|16552_17770_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_053413461.1|17959_20143_-	malate synthase G	NA	NA	NA	NA	NA
WP_013145472.1|20250_21696_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_155467691.1|21692_23054_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_053413463.1|23053_24376_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_053413464.1|24620_25526_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080997763.1|25522_26320_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_053413466.1|26383_26971_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413467.1|27146_28034_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.0e-19
WP_013145479.1|28030_28834_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013523641.1|28986_29625_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_053413468.1|29673_30828_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_013523639.1|31049_31538_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053414940.1|31766_32690_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.3	1.6e-79
WP_053414941.1|32914_34018_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.5	1.1e-10
WP_013145486.1|34494_34635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413469.1|34737_36675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231015.1|36869_37055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413470.1|37075_37366_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_053413471.1|37459_38821_+	peptidase S8	NA	A0A127AWU5	Bacillus_phage	37.9	1.9e-39
WP_013145490.1|39018_39594_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.2	1.2e-11
WP_011231011.1|39761_39932_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_053413472.1|40040_40220_-	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_013145491.1|40220_40424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413473.1|40507_41563_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S4VZ68	Pandoravirus	36.7	6.1e-06
WP_013145493.1|42015_42681_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_053413475.1|42686_43487_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_053414942.1|43505_44315_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_053413476.1|44487_45510_-	glycosyltransferase family 2 protein	NA	A0A075B8F6	Enterobacteria_phage	38.5	1.0e-50
WP_053413477.1|45511_47191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467694.1|47180_47351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413478.1|47571_48552_-	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_053413479.1|48551_50234_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
49235:49250	attR	TTTCCCCGACCGCTTC	NA	NA	NA	NA
WP_053413480.1|50407_51244_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_167337607.1|51361_51571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413482.1|51642_52923_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	83976	93520	3654829	capsid,head	Pseudomonas_phage(33.33%)	11	NA	NA
WP_053413515.1|83976_85917_+|head	phage head morphogenesis protein	head	Q5ZQY4	Pseudomonas_phage	33.8	3.6e-36
WP_053413516.1|85931_86879_+	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	29.4	2.7e-21
WP_053413517.1|86894_87248_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_053413518.1|87264_88179_+|capsid	major capsid protein	capsid	A4JWK0	Burkholderia_virus	48.2	6.5e-73
WP_053413519.1|88192_88414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413520.1|88551_89814_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	8.5e-31
WP_155467705.1|90423_90864_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_053413522.1|90863_91403_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.6	4.2e-11
WP_053413523.1|91399_91894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413524.1|91886_92108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167337608.1|92104_93520_+	DUF2586 family protein	NA	H7BVM2	unidentified_phage	35.3	3.6e-46
>prophage 3
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	99524	107344	3654829	tail,plate	Faecalibacterium_phage(33.33%)	9	NA	NA
WP_053413534.1|99524_100673_+|plate	baseplate J/gp47 family protein	plate	A0A2K9VGW9	Faecalibacterium_phage	31.5	1.2e-44
WP_053413535.1|100669_102049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413536.1|102049_102436_+|tail	phage tail protein	tail	B6SBU8	Clostridium_virus	38.3	1.2e-12
WP_053413537.1|102452_102881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413538.1|102896_103274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413539.1|103270_104758_+	hypothetical protein	NA	A0A2K9V2U1	Faecalibacterium_phage	34.0	4.5e-15
WP_053413540.1|104824_105163_+	diversity-generating retroelement protein Avd	NA	D4HTV8	Vibrio_phage	43.2	2.3e-15
WP_053413541.1|105455_106544_+	DNA polymerase	NA	D4HTV9	Vibrio_phage	52.4	2.2e-96
WP_080997767.1|106549_107344_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP3	uncultured_phage	55.6	2.8e-48
>prophage 4
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	135651	271553	3654829	terminase,holin,capsid,lysis,transposase,integrase,tRNA	Bacillus_phage(14.29%)	116	217429:217467	273326:273364
WP_013145586.1|135651_136296_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_053413555.1|136605_137268_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_013145588.1|137257_138007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413556.1|138141_139407_-	MFS transporter	NA	NA	NA	NA	NA
WP_053413557.1|139626_140361_-	sporulation protein	NA	A0A0E3T7R5	Bacillus_phage	64.0	1.9e-38
WP_053413558.1|140827_143449_-	mannosylglycerate hydrolase	NA	NA	NA	NA	NA
WP_053413559.1|143468_145373_-	PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC	NA	NA	NA	NA	NA
WP_013523540.1|145495_146230_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413560.1|146309_147065_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013523538.1|147211_148648_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_013523537.1|149006_149558_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_053414947.1|149753_150422_+	NAD-dependent deacylase	NA	S5M4R0	Bacillus_phage	42.0	3.9e-43
WP_053413562.1|151316_153410_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_053413563.1|153556_154282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413564.1|154458_155055_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013145600.1|155134_156619_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_053413565.1|156764_161324_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_013523530.1|161449_162358_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013523529.1|162427_162820_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_013523528.1|162833_163448_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_013523527.1|163466_164465_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_053413566.1|164546_165533_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_053413568.1|166734_168087_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011230922.1|168116_169583_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013523524.1|169867_171496_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413569.1|171851_173132_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011230920.1|173572_173803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413569.1|174961_176242_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013523521.1|177086_178376_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_031206329.1|178395_179751_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013523519.1|179819_180710_-	apolipoprotein acyltransferase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	37.2	7.3e-45
WP_053413571.1|181056_182565_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_053413572.1|182829_183141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413573.1|183240_184674_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	44.8	1.0e-109
WP_053413574.1|185062_188800_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155467711.1|188969_189824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413575.1|190344_190926_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_053413576.1|191059_192496_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_053413577.1|192601_193480_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053413578.1|193899_195621_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_053413579.1|195645_197475_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_053413580.1|197715_198612_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413581.1|198642_199566_-	cation transporter	NA	NA	NA	NA	NA
WP_011230902.1|199583_199892_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011230901.1|200084_200402_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_033010984.1|200469_200940_-	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_053413582.1|201197_201719_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_053413583.1|201734_203396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413584.1|203641_203899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413585.1|204499_205339_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_053413586.1|205588_206716_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013523501.1|206820_207369_-	YpiB family protein	NA	NA	NA	NA	NA
WP_013523500.1|207387_208740_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_053413587.1|208936_210124_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413588.1|210468_211974_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_011230891.1|212383_212875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413589.1|213117_213990_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_053413590.1|214241_215654_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_053413591.1|215619_215829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523495.1|216048_217353_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_053413592.1|217423_218413_-	restriction endonuclease	NA	NA	NA	NA	NA
217429:217467	attL	ATTCGGGCACATACATTTTCTGCAGCGGAAGCAACGCCC	NA	NA	NA	NA
WP_033021287.1|218588_219107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033021289.1|219747_220284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414949.1|220297_221968_-	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	23.6	1.5e-11
WP_053414950.1|221951_224096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524701.1|226465_227653_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155467717.1|227705_227888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413593.1|227884_229432_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_053413594.1|229656_232158_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_053413595.1|232126_233806_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_053414951.1|234350_234599_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	56.1	1.0e-17
WP_013523048.1|235089_235968_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053413596.1|236119_236812_-	N-acetylmuramoyl-L-alanine amidase	NA	A0T2N4	Geobacillus_phage	82.5	4.6e-103
WP_053413597.1|236808_237219_-|holin	phage holin family protein	holin	A0A1U9WQR6	Geobacillus_phage	54.0	2.0e-34
WP_053413599.1|237601_241708_-	hypothetical protein	NA	A0A0C5AFG1	Bacillus_phage	30.7	3.4e-169
WP_080997770.1|241721_242006_-	transglycosylase SLT domain-containing protein	NA	G1BNB6	Mycobacterium_phage	47.8	4.3e-15
WP_155467720.1|242089_243820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167337603.1|243948_244203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167337609.1|244549_244687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413603.1|244686_244992_-	hypothetical protein	NA	A0A0K2CNW8	Brevibacillus_phage	36.0	1.5e-05
WP_080997771.1|245016_246180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080997772.1|246181_246487_-	hypothetical protein	NA	A0A0K1Y8A9	Streptomyces_phage	45.5	4.5e-10
WP_053413605.1|247538_249095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413606.1|249097_249673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467723.1|249678_249930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413608.1|250019_250985_-|capsid	phage major capsid protein	capsid	A0A2H4PHY1	TM7_phage	22.3	2.0e-11
WP_053413609.1|250998_251979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413610.1|252055_254125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413611.1|254126_255836_-|terminase	phage terminase large subunit family protein	terminase	S5MAY0	Bacillus_phage	26.0	1.8e-31
WP_053413612.1|255828_256296_-	helix-turn-helix domain-containing protein	NA	A0A090DCM3	Clostridium_phage	65.5	3.1e-47
WP_053413613.1|256346_256559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413614.1|257292_258882_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	30.6	4.5e-37
WP_053413615.1|259170_259605_-	transcriptional regulator	NA	E5DV97	Deep-sea_thermophilic_phage	58.7	7.2e-46
WP_053413616.1|259692_260118_-	hypothetical protein	NA	A6M9A1	Geobacillus_virus	60.0	8.3e-39
WP_053413617.1|260098_260344_-	DUF3310 domain-containing protein	NA	A0A088F894	Idiomarinaceae_phage	56.5	1.2e-13
WP_053413618.1|260349_260844_-	hypothetical protein	NA	A0A0C5AJE6	Paenibacillus_phage	50.3	5.1e-32
WP_053413619.1|260853_261402_-	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	48.1	8.8e-33
WP_053413620.1|261420_261603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080997773.1|262039_262456_-	HNH endonuclease	NA	A6M989	Geobacillus_virus	66.7	5.5e-19
WP_053413621.1|262452_262881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413622.1|262885_264136_-	DNA helicase	NA	A0A0U4B0A1	Bacillus_phage	37.6	5.4e-78
WP_013144074.1|264132_264396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413623.1|264414_265341_-	DnaD domain protein	NA	A0A068C8G6	Acinetobacter_phage	50.3	7.4e-40
WP_053413624.1|265355_265580_-	hypothetical protein	NA	E5DV81	Deep-sea_thermophilic_phage	55.2	1.7e-14
WP_167337610.1|265599_265758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413625.1|265754_266453_-	ERF family protein	NA	H9A0R5	Staphylococcus_phage	42.6	6.8e-38
WP_053413626.1|266449_266926_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	71.7	4.3e-52
WP_053413627.1|266939_267137_-	hypothetical protein	NA	A6M980	Geobacillus_virus	73.3	4.3e-22
WP_053413628.1|267137_267476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413629.1|267830_268106_-	hypothetical protein	NA	S6B9Z9	Thermus_phage	94.5	4.0e-42
WP_053413630.1|268077_268347_-	DUF771 domain-containing protein	NA	A0A1B1IMW0	Lactococcus_phage	36.2	6.5e-05
WP_053413631.1|268343_268883_-	phage antirepressor KilAC domain-containing protein	NA	Q0H241	Geobacillus_phage	97.7	3.0e-94
WP_053413633.1|269094_269331_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	50.7	8.5e-09
WP_128578086.1|269493_269916_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	64.8	4.0e-41
WP_053413635.1|269935_270376_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	93.7	4.5e-72
WP_053413636.1|270419_271553_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	52.4	1.1e-106
273326:273364	attR	ATTCGGGCACATACATTTTCTGCAGCGGAAGCAACGCCC	NA	NA	NA	NA
>prophage 5
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	825390	888994	3654829	protease,coat,tRNA	Pseudomonas_phage(28.57%)	58	NA	NA
WP_053413828.1|825390_827007_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_011232075.1|827165_828269_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_013524231.1|828283_829114_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_053413829.1|829142_830699_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013524233.1|830804_831929_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_013144620.1|831944_832484_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_053413546.1|832620_833883_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_011232080.1|834487_835336_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011232081.1|835357_835801_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_053413830.1|835817_837116_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_053413832.1|837352_837901_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_011232084.1|838071_838362_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011232085.1|838377_838707_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_011232086.1|838709_839018_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_053413833.1|839509_840370_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_053413834.1|840362_841130_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_080997787.1|841105_841366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144615.1|841392_842196_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_020278403.1|842198_842882_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_013144613.1|842931_843450_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013144612.1|843446_844313_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011232093.1|844332_845355_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_013524237.1|845512_846193_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013524238.1|846326_846902_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_053414973.1|847334_848450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232097.1|848566_849028_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_053413835.1|849049_849769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144607.1|849765_850341_-	fimbrial protein	NA	NA	NA	NA	NA
WP_053413836.1|850330_851269_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_053413837.1|851290_852046_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_053413838.1|852088_852628_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_053413839.1|852713_853925_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_013524244.1|853911_854967_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_023633503.1|854979_856644_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_053413840.1|856640_858011_-	VanW family protein	NA	NA	NA	NA	NA
WP_013144599.1|858027_858807_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_053413841.1|858796_860413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144597.1|860556_861177_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_013524249.1|861160_861739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413842.1|861782_863489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413843.1|863583_866817_-	VWA domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	30.3	6.2e-09
WP_053413844.1|866885_868181_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013144592.1|868397_871040_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	7.2e-165
WP_053413845.1|871515_871704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413846.1|871741_872773_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_053413847.1|872816_873872_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_013144589.1|873990_875280_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013144588.1|875296_876271_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_053413848.1|876271_877039_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013144586.1|877035_877968_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_053413849.1|877983_878802_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_053413850.1|878812_880177_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013144583.1|880343_880829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413546.1|880905_882168_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_013144582.1|882754_883342_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_053413851.1|883338_885681_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.2	1.4e-172
WP_053413852.1|885911_887585_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.7	1.1e-12
WP_011232128.1|887728_888994_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.0	6.3e-151
>prophage 6
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1086553	1146469	3654829	holin,transposase,tRNA	Staphylococcus_phage(64.71%)	55	NA	NA
WP_053413721.1|1086553_1087918_-|transposase	ISLre2-like element ISGsp5 family transposase	transposase	NA	NA	NA	NA
WP_008880936.1|1088289_1088511_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053413929.1|1088605_1089352_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011232307.1|1089456_1089669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013524380.1|1089885_1091511_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_053413930.1|1091623_1092934_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	58.9	2.2e-29
WP_008880941.1|1093128_1093308_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_053413931.1|1093423_1095064_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_013524385.1|1095586_1096861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053413546.1|1097028_1098291_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_013144427.1|1099100_1099415_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	47.9	2.1e-15
WP_053413932.1|1099472_1101890_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.4	0.0e+00
WP_053413933.1|1102277_1103477_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	46.7	1.9e-96
WP_013144424.1|1103687_1103852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232317.1|1103870_1104134_-	YtzC family protein	NA	NA	NA	NA	NA
WP_053413934.1|1104426_1105014_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	45.2	1.5e-41
WP_041468697.1|1105071_1106154_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
WP_013144421.1|1106519_1107068_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_013522881.1|1107638_1108901_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_053413935.1|1108974_1110186_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.7	2.8e-164
WP_053413936.1|1110648_1112235_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	1.6e-196
WP_053413937.1|1112349_1113525_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413938.1|1115189_1116092_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_053413939.1|1116371_1116614_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_053413940.1|1116706_1117495_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	38.1	3.0e-34
WP_053413941.1|1117786_1118791_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053413942.1|1118809_1119601_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	2.7e-35
WP_053413943.1|1119584_1120394_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053413944.1|1120506_1120974_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	39.0	3.5e-22
WP_053413945.1|1121032_1121365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524459.1|1121426_1121822_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	48.3	9.2e-24
WP_013524460.1|1121974_1122415_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	67.8	9.5e-54
WP_015731617.1|1122680_1122839_+	YtzI protein	NA	NA	NA	NA	NA
WP_013524462.1|1122861_1123338_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013524463.1|1123551_1123794_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.5	4.9e-20
WP_013524464.1|1123881_1125066_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_013524465.1|1125145_1126132_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053413946.1|1126262_1127612_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_053413947.1|1127627_1128659_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_053414983.1|1128765_1130724_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_053413948.1|1130820_1132899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144399.1|1133045_1133534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413949.1|1133552_1133843_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_013144397.1|1134169_1134331_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_015731616.1|1134396_1134594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413950.1|1134900_1136373_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.6	5.1e-67
WP_011232345.1|1136489_1137308_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_053413951.1|1137308_1138121_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_053413952.1|1138132_1139866_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013524476.1|1139858_1141235_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_015731614.1|1141403_1142333_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_053413953.1|1142418_1143228_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_053413954.1|1143327_1144122_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_013524480.1|1144339_1145458_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.6	5.2e-88
WP_013523048.1|1145590_1146469_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1195758	1248103	3654829	coat,transposase	Streptococcus_phage(16.67%)	57	NA	NA
WP_013524701.1|1195758_1196946_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413975.1|1197042_1197231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167337616.1|1198202_1198361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413977.1|1198533_1199139_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_053413978.1|1199248_1200247_-	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	29.3	2.9e-05
WP_053413979.1|1200265_1200886_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_053413980.1|1201140_1202634_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	2.5e-61
WP_013524521.1|1202817_1203627_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_049777109.1|1203644_1204247_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	44.9	1.2e-14
WP_013144344.1|1204646_1204970_-	YuiB family protein	NA	NA	NA	NA	NA
WP_011232421.1|1205096_1205234_-	YuiA family protein	NA	NA	NA	NA	NA
WP_053414987.1|1205346_1205862_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_053414988.1|1205981_1207205_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053413981.1|1207487_1208480_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	2.3e-31
WP_013144339.1|1208642_1208945_-	LapA family protein	NA	NA	NA	NA	NA
WP_013144338.1|1209170_1209536_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-20
WP_053413982.1|1209677_1210550_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_053413983.1|1211056_1212337_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013144336.1|1212452_1212692_-	YuzB family protein	NA	NA	NA	NA	NA
WP_011232429.1|1212861_1213932_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013144335.1|1214017_1214371_-	YuzD family protein	NA	NA	NA	NA	NA
WP_013144334.1|1214461_1214698_+	NifU family protein	NA	NA	NA	NA	NA
WP_053413546.1|1214773_1216036_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_013524530.1|1216828_1217743_-	homoserine kinase	NA	NA	NA	NA	NA
WP_053413984.1|1217739_1218801_-	threonine synthase	NA	NA	NA	NA	NA
WP_011232434.1|1218800_1220099_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_053413985.1|1220191_1221166_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.1	3.3e-22
WP_013144329.1|1221313_1222315_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_011232437.1|1222610_1223108_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	2.3e-40
WP_053413546.1|1223225_1224488_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_011232438.1|1225075_1225846_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_013144328.1|1225870_1226308_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_021321783.1|1226408_1226678_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_013144327.1|1226736_1227021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144326.1|1227059_1227335_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_011232443.1|1227447_1228134_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_013144325.1|1228256_1229153_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_053413986.1|1229319_1230309_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_053413987.1|1230305_1230512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232446.1|1230557_1231265_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.3e-12
WP_013524536.1|1231267_1232047_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	8.2e-16
WP_011232448.1|1232021_1232996_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_053413988.1|1233012_1233891_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013524538.1|1233997_1235194_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013144318.1|1235827_1236574_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_011232452.1|1236626_1236929_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_053413989.1|1236990_1238373_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_053413990.1|1238390_1239293_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_053414989.1|1239316_1240165_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_013144314.1|1240349_1240982_+	LysE family translocator	NA	NA	NA	NA	NA
WP_013144313.1|1241092_1242055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144312.1|1242051_1243107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524543.1|1243357_1244113_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.9	1.8e-36
WP_013524544.1|1244109_1245615_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_053413587.1|1245964_1247152_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413991.1|1247247_1247577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110107822.1|1247914_1248103_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1330225	1339114	3654829		Streptococcus_phage(28.57%)	10	NA	NA
WP_053414021.1|1330225_1330636_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	90.4	2.6e-69
WP_033012077.1|1330759_1330912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232532.1|1331524_1332115_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	1.4e-52
WP_053413546.1|1332758_1334021_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_011232533.1|1334124_1334382_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_011232534.1|1334396_1335359_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.6	7.1e-54
WP_013146373.1|1335479_1336433_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	45.0	7.5e-64
WP_013146374.1|1336429_1337326_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	1.0e-06
WP_014196721.1|1337344_1337821_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_013146376.1|1338157_1339114_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	56.7	1.9e-91
>prophage 9
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1373827	1382290	3654829		Bacillus_phage(33.33%)	10	NA	NA
WP_013146407.1|1373827_1375468_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.1	2.6e-48
WP_013524615.1|1375541_1375835_-	transporter	NA	NA	NA	NA	NA
WP_013524616.1|1376032_1377331_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A222YZS8	Streptomyces_phage	44.5	8.0e-16
WP_013146410.1|1377359_1378253_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011232571.1|1378233_1378929_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.3	7.0e-27
WP_053414040.1|1379189_1379525_-	cytochrome c	NA	NA	NA	NA	NA
WP_053414041.1|1379587_1380451_-	YitT family protein	NA	NA	NA	NA	NA
WP_013524619.1|1380587_1380848_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	70.9	1.9e-30
WP_013146415.1|1380816_1381071_-	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	54.1	1.4e-17
WP_167337625.1|1381188_1382290_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	2.4e-05
>prophage 10
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1442120	1497298	3654829	protease,integrase,transposase	Streptococcus_phage(25.0%)	40	1443558:1443617	1497299:1497563
WP_053413457.1|1442120_1443557_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
1443558:1443617	attL	CTTTTTTGTCCTCCGGAGCCCTTTGAACAGAACTCCTGCCGGATTCGGCGAAGCGAACCC	NA	NA	NA	NA
WP_053414077.1|1443838_1445287_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_013524679.1|1445288_1446020_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_053414078.1|1446037_1447351_-	nucleotide sugar dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	30.6	3.4e-38
WP_053414079.1|1447366_1448380_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053414080.1|1448376_1449114_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_053414081.1|1449232_1450351_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.3	1.6e-41
WP_013524684.1|1450609_1451692_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_013524685.1|1451961_1454355_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_013524686.1|1454393_1455287_+	accessory Sec system S-layer assembly protein	NA	NA	NA	NA	NA
WP_053414082.1|1455460_1456873_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_023633621.1|1456904_1457645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021321954.1|1457808_1458210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414083.1|1458393_1460352_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_053414084.1|1460507_1461740_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	38.7	1.2e-16
WP_013523048.1|1462081_1462960_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053414086.1|1462983_1463718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523133.1|1463891_1465559_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_155467752.1|1465696_1465873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414997.1|1466027_1466432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524693.1|1466582_1467494_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013524694.1|1467493_1468102_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053414087.1|1468790_1473773_-	amylopullulanase	NA	NA	NA	NA	NA
WP_053414088.1|1474114_1475764_+	alpha-amylase	NA	NA	NA	NA	NA
WP_053414089.1|1475861_1478189_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_053414090.1|1478541_1479267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414091.1|1480016_1480439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080997800.1|1481911_1485121_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_053414094.1|1485494_1486274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413732.1|1486638_1487772_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053414095.1|1487818_1489171_-	peptidoglycan-binding protein	NA	A0A0A8WF62	Clostridium_phage	40.7	2.4e-15
WP_053414998.1|1489325_1489835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414096.1|1490044_1490452_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	31.0	2.3e-06
WP_025039147.1|1490572_1490920_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	68.0	1.5e-33
WP_013524709.1|1491201_1491642_+	YwpF-like family protein	NA	NA	NA	NA	NA
WP_053414097.1|1491698_1492328_-	class D sortase	NA	NA	NA	NA	NA
WP_053414098.1|1492334_1493234_-	processed acidic surface protein	NA	NA	NA	NA	NA
WP_053414099.1|1493615_1494992_-	aspartate kinase	NA	NA	NA	NA	NA
WP_053414100.1|1495258_1495693_-	DUF1284 domain-containing protein	NA	NA	NA	NA	NA
WP_053414101.1|1495861_1497298_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
1497299:1497563	attR	CTTTTTTGTCCTCCGGAGCCCTTTGAACAGAACTCCTGCCGGATTCGGCGAAGCGAACCCTTGACCAACCGAACACCGCCAAAGGTAAAATTCGGTCATGGCAAGGGCGGCTTTCTTATTGCCTTCTTTTTTGTCCCCGTCGCCCTTGACGACTCTTCCGCACCTTTGGCGGGTGTTGGTCAAGGGCGAATCCGGCTCTCCGCATGCCCAATGATGCTCAATGGGATGGCCTGTGTGGAGTTTTCATAGAACTTTTGACGCTACC	NA	NA	NA	NA
>prophage 11
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1524182	1588404	3654829	transposase	Bacillus_phage(30.77%)	55	NA	NA
WP_053414120.1|1524182_1525055_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.1	1.1e-45
WP_011229672.1|1525051_1525378_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053413569.1|1525503_1526784_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053414121.1|1527178_1527565_+	VOC family protein	NA	NA	NA	NA	NA
WP_053414122.1|1527656_1528643_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053414123.1|1528833_1529253_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	61.9	2.1e-42
WP_053414999.1|1529268_1530333_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_053414124.1|1530357_1530705_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	46.0	1.6e-11
WP_013146522.1|1530925_1531309_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_053414125.1|1532278_1533214_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_053414126.1|1533245_1534190_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_053414127.1|1534186_1535680_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.9e-16
WP_053414128.1|1535713_1536112_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_053414129.1|1536111_1537005_-	ribokinase	NA	NA	NA	NA	NA
WP_053414130.1|1537001_1537991_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.1	3.8e-26
WP_167337618.1|1538220_1538376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053415000.1|1538730_1539183_-	VanZ family protein	NA	NA	NA	NA	NA
WP_041469501.1|1539741_1539927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414131.1|1540648_1541833_-	amidohydrolase	NA	NA	NA	NA	NA
WP_053414133.1|1543380_1544259_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053414134.1|1546088_1547462_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.1	5.9e-86
WP_053415001.1|1547695_1549042_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	34.6	7.5e-17
WP_155467756.1|1549301_1549691_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011232727.1|1549811_1550522_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.4	6.1e-26
WP_053414135.1|1551437_1553633_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_053414136.1|1553931_1555248_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_053415002.1|1555464_1557111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414137.1|1557107_1559882_+	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.0	1.5e-32
WP_053413768.1|1560260_1561523_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_013524761.1|1562224_1563196_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_053414138.1|1563470_1563959_-	macro domain-containing protein	NA	G3MBI4	Bacillus_virus	56.8	1.3e-43
WP_053414139.1|1563955_1564327_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_013524764.1|1564348_1564780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524765.1|1564782_1566096_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013524766.1|1566181_1567069_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	1.5e-77
WP_053414140.1|1567350_1568409_-	glycoside hydrolase family 130 protein	NA	NA	NA	NA	NA
WP_013146551.1|1568411_1569359_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_053414141.1|1569399_1570230_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_053414142.1|1570216_1571095_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013524770.1|1571096_1572422_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_053414143.1|1572915_1573929_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_053414144.1|1573989_1574883_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_053414145.1|1575085_1576018_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013524774.1|1576312_1576786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013524775.1|1576829_1577030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146555.1|1577264_1577762_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_053414146.1|1577933_1578857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414147.1|1578999_1579458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053414148.1|1579471_1580080_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_053415003.1|1580303_1580573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524781.1|1580838_1581612_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_053414149.1|1583149_1584169_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_053414151.1|1584632_1585808_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013524787.1|1586285_1587050_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_053413857.1|1587183_1588404_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.4	6.3e-55
>prophage 12
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1663136	1716022	3654829	protease,transposase,coat,tRNA	Bacillus_phage(16.67%)	55	NA	NA
WP_011232868.1|1663136_1664810_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_053414183.1|1664813_1665245_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_053414184.1|1665877_1666396_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_080997803.1|1666555_1666744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414185.1|1666941_1667817_-	agmatinase	NA	NA	NA	NA	NA
WP_053414186.1|1667830_1668658_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_053414187.1|1668913_1670959_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_013524825.1|1671090_1671606_-	YwhD family protein	NA	NA	NA	NA	NA
WP_013524826.1|1671625_1672294_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011232876.1|1672424_1672613_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_053414188.1|1672713_1674015_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	4.2e-49
WP_013146644.1|1674195_1674714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524829.1|1674727_1676026_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.6	3.6e-24
WP_011232879.1|1676170_1676398_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_013524830.1|1676573_1677227_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	51.5	9.9e-07
WP_013146647.1|1677365_1678217_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_013524831.1|1678340_1679321_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_053414189.1|1679575_1680322_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_013524834.1|1680641_1681070_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_053414190.1|1681094_1681655_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015376087.1|1681850_1682222_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_053414191.1|1682488_1682788_-	YwdI family protein	NA	NA	NA	NA	NA
WP_013524842.1|1682801_1683491_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	50.2	2.1e-55
WP_013524843.1|1683662_1684046_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_013146655.1|1684174_1684525_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_013146656.1|1684521_1685010_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_020753862.1|1684969_1685740_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	30.6	1.2e-16
WP_053415004.1|1685789_1687700_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_011232895.1|1687873_1688509_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_053414192.1|1689982_1690414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414193.1|1690563_1691175_-	flavoprotein	NA	A0A068EE92	Pigeonpox_virus	37.3	3.1e-18
WP_053414194.1|1691189_1692401_-	MFS transporter	NA	NA	NA	NA	NA
WP_053414197.1|1694630_1695860_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.1	1.4e-83
WP_013146659.1|1696298_1696817_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013146660.1|1696976_1697198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013524847.1|1697301_1697937_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_167337619.1|1698109_1698259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146663.1|1698433_1699816_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	29.9	9.6e-52
WP_013146664.1|1700104_1700935_-	glycosyltransferase family 2 protein	NA	A0A1V0SAG8	Catovirus	33.0	6.9e-05
WP_053414198.1|1701160_1702357_-	MFS transporter	NA	NA	NA	NA	NA
WP_053414199.1|1702701_1703196_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_155467758.1|1703221_1703365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031212056.1|1703377_1703596_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_013524862.1|1703686_1704922_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013146672.1|1705039_1706173_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_053414200.1|1706381_1706981_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_053414201.1|1707026_1707842_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_062899067.1|1707967_1708855_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_013524865.1|1708909_1710367_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_013524701.1|1710563_1711751_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013524866.1|1712136_1712958_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013524867.1|1713029_1713686_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_053414202.1|1713682_1714405_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	6.2e-34
WP_053414203.1|1714563_1715619_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	36.5	1.2e-22
WP_013146681.1|1715623_1716022_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	66.7	1.7e-46
>prophage 13
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1733028	1742786	3654829		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_011232933.1|1733028_1734249_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	6.1e-18
WP_013146695.1|1734350_1735145_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.7	6.5e-45
WP_013146696.1|1735151_1735934_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_011232936.1|1735920_1737249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146697.1|1737241_1739071_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.2	5.6e-23
WP_011232938.1|1739077_1739791_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.7e-44
WP_053414207.1|1739979_1741266_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.5	8.6e-71
WP_013146699.1|1741421_1742786_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	7.9e-123
>prophage 14
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	1978558	2113517	3654829	protease,coat,holin,transposase,tRNA	Pseudomonas_phage(12.12%)	109	NA	NA
WP_013144031.1|1978558_1979065_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_053413546.1|1979665_1980928_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_053414269.1|1981112_1982051_+	ROK family protein	NA	NA	NA	NA	NA
WP_013144033.1|1982475_1983297_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_053414270.1|1983600_1984674_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_013144037.1|1984947_1985676_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_155467760.1|1985686_1986349_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_013144038.1|1986296_1987439_+	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_053414271.1|1987692_1988796_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_053414272.1|1988802_1990179_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_011229735.1|1990251_1990974_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013144041.1|1991034_1992438_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.9	1.7e-64
WP_053413546.1|1993010_1994273_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_053414273.1|1994337_1994961_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011229738.1|1995074_1995464_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_013144042.1|1995543_1996557_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_013144043.1|1996805_1997960_+	alanine racemase	NA	NA	NA	NA	NA
WP_013144044.1|1998086_1998368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|1998372_1998723_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_053414274.1|1998988_2001154_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_013144046.1|2001172_2001286_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_013144047.1|2001375_2001825_+	SprT family protein	NA	U5J9G1	Bacillus_phage	26.6	4.9e-05
WP_053414275.1|2005653_2006115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144048.1|2009667_2010126_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_053414276.1|2010122_2010863_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011229747.1|2010822_2011275_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013144049.1|2011271_2012285_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.6	2.3e-66
WP_013522881.1|2012909_2014172_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_053414278.1|2014500_2016111_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	34.9	5.9e-53
WP_080997797.1|2016140_2017622_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229750.1|2018079_2018568_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013144051.1|2018583_2019225_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_013144052.1|2019242_2019395_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_053414280.1|2019415_2020159_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_080997811.1|2020174_2020354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414281.1|2020342_2020522_-	YdiK family protein	NA	NA	NA	NA	NA
WP_053414282.1|2020518_2021253_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013144057.1|2021608_2021893_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.5	1.1e-18
WP_053414283.1|2021997_2023614_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	3.4e-165
WP_053414285.1|2024362_2025592_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.7e-84
WP_053414286.1|2025841_2027212_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_013522881.1|2027812_2029075_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_053414287.1|2029295_2030252_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_053414288.1|2030248_2031430_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_053414289.1|2031426_2033589_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_053415009.1|2033791_2035324_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.5	5.0e-17
WP_053414290.1|2035614_2036940_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.2	4.1e-52
WP_080997812.1|2037028_2037400_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053414291.1|2037793_2039452_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_041468649.1|2039792_2040263_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_053413587.1|2040756_2041944_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013144123.1|2042051_2042615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144124.1|2044910_2045354_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_013144125.1|2045715_2046204_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	1.8e-21
WP_013144126.1|2046196_2047345_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_053414292.1|2047341_2048637_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_053414293.1|2048697_2049441_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	42.1	1.0e-44
WP_053414294.1|2049428_2049683_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_053414295.1|2049679_2050366_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_053414296.1|2050349_2052578_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.2	1.2e-168
WP_053414297.1|2052553_2053966_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	3.7e-51
WP_053414298.1|2054089_2055130_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.6	8.0e-67
WP_053414299.1|2055126_2055759_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	7.1e-26
WP_053414300.1|2055721_2057260_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.3	1.2e-79
WP_053414301.1|2057283_2058576_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_053414302.1|2058575_2058899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144137.1|2058885_2059131_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_053414303.1|2059227_2060973_+	adenine deaminase	NA	NA	NA	NA	NA
WP_080997813.1|2060991_2062023_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_011229782.1|2062115_2062451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414305.1|2062549_2063269_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_053415010.1|2063297_2065472_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.1	4.9e-135
WP_053414306.1|2065492_2067505_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.0	1.2e-127
WP_013522832.1|2067501_2068725_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_013522833.1|2069199_2069757_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	30.1	2.3e-12
WP_053415011.1|2069796_2071239_-	flavin monoamine oxidase family protein	NA	A0A2K9L3H9	Tupanvirus	24.8	6.8e-16
WP_053414307.1|2071374_2072148_-	VOC family protein	NA	NA	NA	NA	NA
WP_041469323.1|2072177_2072705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229790.1|2072863_2073154_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_053414308.1|2073166_2074624_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_053414309.1|2074637_2076068_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_053414310.1|2076243_2077548_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.2	1.6e-19
WP_053413569.1|2078394_2079675_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011229795.1|2080071_2080242_+	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
WP_011229796.1|2080428_2080818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414311.1|2081804_2082545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414312.1|2082541_2083243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414313.1|2083256_2083910_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	32.2	3.6e-25
WP_041468197.1|2084584_2085148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012820636.1|2085289_2086540_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_012820635.1|2086532_2087333_+	ExeA family protein	NA	NA	NA	NA	NA
WP_013522847.1|2087926_2088625_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053414314.1|2088611_2090030_+	HAMP domain-containing histidine kinase	NA	Q6XM27	Feldmannia_irregularis_virus	21.9	4.3e-07
WP_053414315.1|2090325_2091984_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_053414316.1|2092506_2093295_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_053414317.1|2093296_2094043_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_053414318.1|2094058_2094751_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.5	2.3e-54
WP_053414319.1|2095565_2096153_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053414320.1|2097000_2097294_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RNR0	Bacillus_phage	45.8	1.9e-05
WP_053414321.1|2097693_2098323_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053414322.1|2098577_2099705_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.5	3.2e-29
WP_013522856.1|2099721_2100624_-	substrate-binding region of ABC-type glycine betaine transporter	NA	NA	NA	NA	NA
WP_053414323.1|2101094_2101784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414324.1|2101928_2103419_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_053414325.1|2103421_2104618_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_053414326.1|2104577_2108699_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_053414327.1|2108695_2109916_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_013144185.1|2110060_2110975_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_053414113.1|2111858_2113517_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2124241	2180556	3654829	integrase,transposase	Rhodobacter_phage(11.11%)	47	2127241:2127277	2139138:2139174
WP_012820636.1|2124241_2125492_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_012820635.1|2125484_2126285_+	ExeA family protein	NA	NA	NA	NA	NA
2127241:2127277	attL	GTTTTTATCGTACCTATGAGGGATTGAAACAAAAATA	NA	NA	NA	NA
WP_053414333.1|2128412_2129609_+	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_013522872.1|2129611_2130952_+	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_053414334.1|2130951_2131860_+	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_013522874.1|2131856_2133497_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_013522875.1|2133496_2134627_+	type III-B CRISPR module-associated protein Cmr3	NA	NA	NA	NA	NA
WP_053414335.1|2134626_2135520_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_053414336.1|2135533_2135986_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_053413457.1|2136203_2137640_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
WP_053414337.1|2140225_2141281_+	P1 family peptidase	NA	NA	NA	NA	NA
2139138:2139174	attR	GTTTTTATCGTACCTATGAGGGATTGAAACAAAAATA	NA	NA	NA	NA
WP_053414338.1|2141363_2142596_-	MFS transporter	NA	NA	NA	NA	NA
WP_053413546.1|2143378_2144641_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_053414339.1|2144734_2145388_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_053414340.1|2145347_2145869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414341.1|2146002_2146431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414342.1|2146521_2147223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013522887.1|2147581_2147992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414343.1|2148381_2150691_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_013524701.1|2150911_2152099_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414345.1|2152132_2152717_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013523048.1|2152925_2153804_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080997815.1|2154076_2155450_-	GHKL domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.4	8.7e-13
WP_013522892.1|2155430_2156102_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	2.2e-33
WP_053414347.1|2156336_2156759_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013522894.1|2156759_2156993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414348.1|2156973_2158179_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	30.0	2.6e-13
WP_053413732.1|2158695_2159829_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013522896.1|2160107_2160899_+	hydrolase	NA	NA	NA	NA	NA
WP_013524701.1|2161015_2162203_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413587.1|2162617_2163805_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053413732.1|2164783_2165917_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053414351.1|2166279_2167668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414352.1|2167664_2168066_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_053414353.1|2168166_2169057_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_053415013.1|2169275_2169812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414354.1|2169833_2171354_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	26.7	6.1e-07
WP_041469538.1|2171496_2172417_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.6	1.3e-25
WP_053414355.1|2172495_2173869_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.1	2.9e-125
WP_013522905.1|2174421_2174589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414356.1|2174601_2174955_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_053414357.1|2175395_2175776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414358.1|2175947_2177417_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_053414359.1|2177659_2177947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414360.1|2178040_2178412_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013522911.1|2178374_2178800_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_053413721.1|2179191_2180556_+|transposase	ISLre2-like element ISGsp5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2450070	2496796	3654829	transposase,bacteriocin	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053414456.1|2450070_2451384_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_011230188.1|2451741_2451963_-	spore germination protein	NA	NA	NA	NA	NA
WP_053414457.1|2451962_2452361_-	spore germination protein GerPE	NA	NA	NA	NA	NA
WP_013146202.1|2452357_2452549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414458.1|2452545_2453148_-	spore germination protein GerPC	NA	NA	NA	NA	NA
WP_013146201.1|2453231_2453444_-	spore germination protein GerPB	NA	NA	NA	NA	NA
WP_011230193.1|2453459_2453681_-	spore germination protein	NA	NA	NA	NA	NA
WP_013523084.1|2453751_2453976_-	spore germination protein	NA	NA	NA	NA	NA
WP_011230195.1|2454126_2454351_+	spore germination protein	NA	NA	NA	NA	NA
WP_013523086.1|2454561_2456157_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.7	2.4e-38
WP_013523087.1|2456294_2457461_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011230198.1|2457471_2457642_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_013523089.1|2457958_2458861_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011230200.1|2459005_2459359_+	YisL family protein	NA	NA	NA	NA	NA
WP_053414459.1|2459483_2462327_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011230202.1|2462480_2463029_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_013523091.1|2463271_2465119_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	25.9	4.0e-21
WP_053414460.1|2465159_2466512_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_053413650.1|2466911_2468024_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	65.1	1.1e-146
WP_155467766.1|2468063_2468882_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053414461.1|2468998_2470765_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_053414462.1|2471011_2472286_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_053414463.1|2472357_2473638_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_053414464.1|2473637_2474480_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_053414465.1|2474552_2476088_+	alpha-amylase	NA	NA	NA	NA	NA
WP_053414466.1|2476106_2477126_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_053414467.1|2477243_2479175_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013523101.1|2479375_2480362_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011230214.1|2480389_2481409_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_053414468.1|2481438_2482749_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_053414469.1|2482921_2483785_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.1	1.0e-59
WP_013523104.1|2484015_2484309_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_053414470.1|2484333_2484753_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_053414471.1|2484920_2488331_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	1.7e-09
WP_053414472.1|2488323_2490171_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_013523108.1|2490458_2490842_-	membrane protein	NA	NA	NA	NA	NA
WP_013146158.1|2491144_2491321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413569.1|2491443_2492724_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053414443.1|2493293_2494751_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155467768.1|2494778_2494994_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_053414473.1|2495137_2496796_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2510010	2569064	3654829	protease,transposase	Streptococcus_phage(50.0%)	59	NA	NA
WP_080997854.1|2510010_2510799_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_053414482.1|2511831_2512323_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_013523048.1|2513179_2514058_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_023817502.1|2514289_2515492_+	CoA transferase	NA	NA	NA	NA	NA
WP_080997822.1|2515494_2516460_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_053414285.1|2516524_2517754_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.7e-84
WP_053413732.1|2518214_2519348_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053415022.1|2519453_2520494_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_053414483.1|2520552_2521059_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_053414484.1|2521055_2522333_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_080997823.1|2522389_2522521_-	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_053414486.1|2522961_2523825_-	DegV family protein	NA	NA	NA	NA	NA
WP_053414487.1|2524024_2524225_-	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_165570920.1|2524227_2524380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523121.1|2524708_2525515_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_053414488.1|2525631_2526399_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013523123.1|2526600_2526972_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	62.4	1.3e-40
WP_053414489.1|2526961_2529085_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	63.3	3.4e-242
WP_013523125.1|2529302_2529548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414490.1|2529647_2530394_-	Fic family protein	NA	NA	NA	NA	NA
WP_053413768.1|2530597_2531860_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_013146127.1|2532479_2532782_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_053414491.1|2532804_2534055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146125.1|2534051_2534261_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_013146124.1|2534257_2534497_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_013146123.1|2534734_2535427_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_053414492.1|2535659_2538023_+	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_053414493.1|2538347_2539115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414494.1|2539379_2540435_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_011230263.1|2540900_2541068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523134.1|2541197_2541431_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_053415023.1|2541535_2542117_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_144319731.1|2542177_2542405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080997824.1|2542659_2543262_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013146116.1|2543570_2543948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414495.1|2544029_2544809_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053415025.1|2544873_2546295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523139.1|2546310_2546952_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	8.7e-32
WP_053414496.1|2547285_2549268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041469364.1|2549293_2549947_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.5	4.3e-18
WP_013146110.1|2549968_2550337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414497.1|2550422_2551541_+	TIGR04053 family radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_053414498.1|2551901_2552663_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_013146107.1|2552640_2553222_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_053414499.1|2553356_2554523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414500.1|2554525_2555482_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	3.2e-30
WP_013523143.1|2555468_2556548_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053414501.1|2556827_2558003_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_053414502.1|2558246_2559311_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_053414503.1|2559518_2560217_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_013146100.1|2560434_2561097_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_053414504.1|2561151_2562177_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_053414505.1|2562264_2562972_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_053414506.1|2563387_2564647_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_053414507.1|2564643_2565144_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_053414508.1|2565140_2565605_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_041469367.1|2565604_2565835_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_053414509.1|2565840_2566569_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_053414285.1|2567834_2569064_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.7e-84
>prophage 18
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2621014	2684133	3654829	integrase,transposase,coat,bacteriocin	Bacillus_phage(38.46%)	59	2617584:2617598	2639589:2639603
2617584:2617598	attL	ATCGTCAAGGCGATC	NA	NA	NA	NA
WP_053414528.1|2621014_2622109_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_053414101.1|2622277_2623714_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
WP_053414529.1|2624217_2625372_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_053414530.1|2625368_2626325_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	33.1	1.7e-39
WP_053414531.1|2626321_2627605_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.6	4.1e-73
WP_053414532.1|2627881_2628961_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_053414533.1|2628967_2629963_-	phosphotransferase	NA	NA	NA	NA	NA
WP_013146051.1|2630124_2630427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523186.1|2630605_2630956_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_013146049.1|2631270_2632035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374178.1|2632136_2632856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523189.1|2633010_2633346_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011230350.1|2633703_2633934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523190.1|2633961_2634165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230352.1|2634324_2634531_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_013146045.1|2634628_2635105_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_015374180.1|2635116_2635596_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_013523192.1|2635595_2636609_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_013146042.1|2636610_2636967_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_011230357.1|2636979_2637186_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_013523193.1|2637198_2638059_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013146040.1|2638079_2638250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414534.1|2638389_2638710_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011230361.1|2638839_2639076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230362.1|2639155_2639281_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013146037.1|2639408_2639666_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
2639589:2639603	attR	ATCGTCAAGGCGATC	NA	NA	NA	NA
WP_013146036.1|2639783_2640218_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011230365.1|2640219_2640741_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_013146035.1|2640840_2641569_-	esterase family protein	NA	NA	NA	NA	NA
WP_013523197.1|2642068_2643172_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	27.1	6.8e-16
WP_053414535.1|2643175_2644354_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_053414536.1|2644392_2645892_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_053414537.1|2646572_2647748_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013523201.1|2648350_2648896_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053415027.1|2649080_2652323_+	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_053414538.1|2652325_2653807_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	28.4	1.8e-27
WP_053414539.1|2653803_2655261_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080997826.1|2655302_2656070_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_053414540.1|2658221_2658476_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_013523207.1|2658797_2659211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414541.1|2659767_2660574_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_155467770.1|2660914_2662432_+	glycosyltransferase	NA	S5Z3N0	Mycobacterium_phage	26.8	2.0e-10
WP_013523213.1|2662903_2663215_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_053414542.1|2663230_2665627_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.1	8.1e-123
WP_011230404.1|2665648_2665852_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_047753487.1|2666058_2666334_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_013146009.1|2667368_2668259_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_053413587.1|2668548_2669736_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414543.1|2669921_2671829_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.4	4.2e-29
WP_013523220.1|2673236_2673911_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	67.6	6.7e-83
WP_013523221.1|2674092_2674908_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053414544.1|2674904_2675921_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.6	4.2e-20
WP_080997827.1|2676374_2678732_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	68.9	2.9e-306
WP_053414545.1|2678845_2679886_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	62.0	2.4e-124
WP_167337626.1|2680317_2681202_+	gamma-glutamylcyclotransferase	NA	A0A218KCG9	Bacillus_phage	42.3	8.1e-20
WP_053414546.1|2681488_2682025_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013523226.1|2682154_2682508_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011230416.1|2682644_2683109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523227.1|2683278_2684133_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 19
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2761455	2767940	3654829		Pneumococcus_phage(33.33%)	10	NA	NA
WP_053415036.1|2761455_2762127_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.9	6.1e-68
WP_053414580.1|2762123_2762561_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.0	5.6e-06
WP_013523275.1|2762560_2763295_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	44.6	1.3e-55
WP_013523276.1|2763347_2763845_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.2	1.7e-51
WP_014195299.1|2763898_2764582_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013145942.1|2764613_2764793_-	YkvS family protein	NA	NA	NA	NA	NA
WP_013145941.1|2765094_2765679_-	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	46.8	5.0e-42
WP_011230483.1|2765879_2766074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414581.1|2766246_2766921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523280.1|2767190_2767940_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	5.4e-17
>prophage 20
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2858735	2945416	3654829	protease,integrase,transposase	Liberibacter_phage(18.18%)	62	2892502:2892532	2930100:2930130
WP_012820626.1|2858735_2860109_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_053415039.1|2860298_2861048_+	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_041469222.1|2861149_2861452_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053414615.1|2861694_2863599_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	27.9	6.8e-32
WP_053414616.1|2863762_2865256_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	29.9	2.6e-55
WP_013524701.1|2866099_2867287_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041468197.1|2868334_2868898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012820636.1|2869039_2870290_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_012820635.1|2870282_2871083_+	ExeA family protein	NA	NA	NA	NA	NA
WP_053414618.1|2871585_2872464_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053413732.1|2872553_2873687_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012820620.1|2874709_2875006_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053414621.1|2875140_2875773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053415040.1|2875765_2876632_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	5.7e-26
WP_053414622.1|2876615_2878637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012820624.1|2878750_2879146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414623.1|2879314_2880724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414624.1|2880909_2881005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414625.1|2881175_2882150_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_053414626.1|2882218_2882725_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012820630.1|2882776_2882869_-	stressosome-associated protein Prli42	NA	NA	NA	NA	NA
WP_013144804.1|2883082_2883508_+	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_012820632.1|2883504_2885055_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_155467776.1|2886017_2886389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041468197.1|2886530_2887094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523133.1|2888371_2890039_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_053414628.1|2890409_2891210_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053414629.1|2891407_2891875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467778.1|2891906_2892356_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2892502:2892532	attL	AACCTGAATCCGTGATGGATGGAAATCAACT	NA	NA	NA	NA
WP_012820626.1|2892710_2894084_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_012820637.1|2895380_2895533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414630.1|2895548_2896439_-	permease	NA	NA	NA	NA	NA
WP_053414631.1|2896911_2898099_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012820640.1|2898238_2898700_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053414633.1|2899119_2900556_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	26.2	3.4e-07
WP_013144806.1|2900727_2902002_+	radical SAM protein	NA	NA	NA	NA	NA
WP_013144807.1|2902024_2902324_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013144808.1|2902335_2903559_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_053414634.1|2903600_2904716_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_053414635.1|2904833_2906117_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012820642.1|2906510_2906918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012820643.1|2908030_2909155_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012820644.1|2909271_2909757_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_012820645.1|2909839_2910031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414636.1|2910192_2911602_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.8	7.3e-39
WP_013523048.1|2918979_2919858_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053414637.1|2920044_2921325_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053414638.1|2921719_2922157_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_053414639.1|2922322_2923456_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053414640.1|2925023_2925764_+	immunity 26/phosphotriesterase HocA family protein	NA	NA	NA	NA	NA
WP_053414641.1|2928046_2928799_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.0	4.3e-38
WP_012820652.1|2930326_2932252_-	ABC transporter permease	NA	NA	NA	NA	NA
2930100:2930130	attR	AGTTGATTTCCATCCATCACGGATTCAGGTT	NA	NA	NA	NA
WP_053414643.1|2932248_2933004_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	7.6e-35
WP_012820654.1|2933097_2934102_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013144816.1|2934101_2934788_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013144817.1|2936484_2937852_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.0	2.2e-32
WP_011231817.1|2938466_2939084_-	cyclase family protein	NA	NA	NA	NA	NA
WP_041468300.1|2939183_2940677_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	40.4	4.0e-88
WP_012820660.1|2940906_2941830_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_053414644.1|2941826_2942849_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_053415041.1|2942989_2943829_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.5	3.8e-27
WP_053414645.1|2944282_2945416_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	2971586	2981442	3654829		Staphylococcus_phage(50.0%)	11	NA	NA
WP_012820690.1|2971586_2972729_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	6.9e-56
WP_012820691.1|2972683_2973328_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.3	1.4e-40
WP_014196246.1|2973348_2974542_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	1.5e-117
WP_011231776.1|2974562_2975027_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	1.0e-42
WP_013144843.1|2975148_2975505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012820694.1|2975527_2976067_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_033005256.1|2976262_2977018_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.5	9.4e-09
WP_033005253.1|2977197_2977851_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.3	1.3e-14
WP_012820697.1|2977869_2978271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012820698.1|2978627_2979941_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.1	3.0e-39
WP_167337628.1|2980347_2981442_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	33.6	7.4e-23
>prophage 22
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	3013568	3034323	3654829	protease,coat,transposase	uncultured_Mediterranean_phage(25.0%)	23	NA	NA
WP_053413587.1|3013568_3014756_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155467800.1|3014848_3015370_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_053414668.1|3015347_3016442_+	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_053414669.1|3016727_3017540_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_053414670.1|3017801_3019376_-	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	34.0	1.0e-33
WP_011231730.1|3019597_3020101_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.8	1.0e-27
WP_011231729.1|3020265_3020514_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	53.3	5.6e-19
WP_013144870.1|3020767_3021814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053414671.1|3021801_3023313_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	3.3e-61
WP_053414672.1|3023309_3023894_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053414673.1|3023890_3024418_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_053414674.1|3024527_3024974_+	YpbF family protein	NA	NA	NA	NA	NA
WP_012820738.1|3025001_3025571_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_053414675.1|3025604_3025865_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_012820740.1|3025861_3026092_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_053414676.1|3026199_3026592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413569.1|3027342_3028623_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155467802.1|3028954_3029176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231720.1|3029263_3029854_+	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_011231719.1|3030013_3031285_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_053414678.1|3031374_3032367_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_053414679.1|3032585_3033557_+	asparaginase	NA	NA	NA	NA	NA
WP_012820744.1|3033645_3034323_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
>prophage 23
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	3111085	3217789	3654829	protease,transposase	Wolbachia_phage(22.22%)	77	NA	NA
WP_053414701.1|3111085_3112744_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013524098.1|3113379_3114315_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025949019.1|3114307_3115132_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_053414702.1|3115153_3118195_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.7	1.7e-157
WP_053414703.1|3118682_3119873_+	galactokinase	NA	NA	NA	NA	NA
WP_053414704.1|3119869_3120856_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.1	1.6e-48
WP_053414705.1|3120858_3122385_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_011231632.1|3122441_3123464_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011231631.1|3123480_3123924_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011231630.1|3123988_3124279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523133.1|3131388_3133056_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_012820635.1|3133415_3134216_-	ExeA family protein	NA	NA	NA	NA	NA
WP_041468197.1|3135598_3136162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080997833.1|3136821_3137274_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_053414706.1|3137270_3138929_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_053414707.1|3139119_3141933_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_053414708.1|3142036_3143278_-	aminopeptidase	NA	NA	NA	NA	NA
WP_053414709.1|3143622_3145059_+	sodium/proline symporter	NA	NA	NA	NA	NA
WP_053415047.1|3146980_3148636_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.9	5.6e-38
WP_053414710.1|3148697_3150245_+	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_053414711.1|3150558_3150843_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053414712.1|3150829_3151477_+	SdpI family protein	NA	NA	NA	NA	NA
WP_013524076.1|3151499_3152282_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013524075.1|3152278_3152647_+	VOC family protein	NA	NA	NA	NA	NA
WP_013524074.1|3152739_3152877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231614.1|3152923_3153106_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_013524073.1|3153313_3154504_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	27.5	3.4e-37
WP_013144966.1|3156072_3156633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013524071.1|3156711_3157758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414713.1|3158367_3158823_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_013144969.1|3159359_3159935_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_053414714.1|3160106_3161033_+	glutaminase A	NA	NA	NA	NA	NA
WP_053414715.1|3161046_3161451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231608.1|3161869_3163189_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053414716.1|3163372_3164680_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013144974.1|3164695_3165523_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_053414717.1|3165791_3166238_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013524065.1|3166396_3167692_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_053414718.1|3167748_3168186_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013144979.1|3168604_3169618_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.0	1.5e-33
WP_053414720.1|3169759_3170839_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013524061.1|3170957_3171707_+	trehalose utilization protein ThuA	NA	NA	NA	NA	NA
WP_013524060.1|3171703_3172858_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013524059.1|3172991_3173963_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_053414721.1|3174149_3174626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467780.1|3174778_3174955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413857.1|3175195_3176416_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.4	6.3e-55
WP_053414722.1|3176519_3176993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414723.1|3176989_3179050_-	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	23.7	4.6e-26
WP_053414724.1|3179053_3181882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167337621.1|3182051_3182225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053413587.1|3184236_3185424_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044736685.1|3185620_3186001_+	DndE family protein	NA	NA	NA	NA	NA
WP_053414725.1|3186174_3187833_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_044736684.1|3187969_3189118_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	30.5	1.9e-37
WP_053414726.1|3189114_3189501_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_053414727.1|3189504_3191526_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_053414728.1|3191515_3192898_-	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
WP_013524701.1|3193144_3194332_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414729.1|3194632_3195808_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414730.1|3196008_3197739_-	adenine deaminase	NA	NA	NA	NA	NA
WP_053414731.1|3197933_3198563_+	YhbD family protein	NA	NA	NA	NA	NA
WP_053414732.1|3198568_3199273_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_053415048.1|3199278_3200001_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_155467784.1|3200016_3201537_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_080997836.1|3201725_3201998_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013523133.1|3202322_3203990_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013524036.1|3204706_3206350_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_013524035.1|3206584_3207784_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013524034.1|3207800_3208340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013145006.1|3208354_3209764_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013524032.1|3209835_3210855_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_011231571.1|3210835_3211465_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013524701.1|3211588_3212776_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013145008.1|3213157_3214504_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_053414733.1|3214500_3215529_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_053414735.1|3216580_3217789_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	32.9	8.4e-52
>prophage 24
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	3401831	3537968	3654829	integrase,transposase,bacteriocin	Rhodobacter_phage(11.11%)	117	3403921:3403942	3476714:3476735
WP_012820636.1|3401831_3403082_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_041468197.1|3403223_3403787_-	hypothetical protein	NA	NA	NA	NA	NA
3403921:3403942	attL	GAAATAAAATGATAATTTACAA	NA	NA	NA	NA
WP_013523789.1|3404942_3405368_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011231258.1|3405543_3406137_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_053414830.1|3406165_3407530_+	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053414831.1|3407619_3408195_-	YpmS family protein	NA	NA	NA	NA	NA
WP_053414832.1|3408191_3408974_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_033025416.1|3409048_3409621_-	SCO family protein	NA	NA	NA	NA	NA
WP_013145300.1|3409675_3409885_-	DegV family protein	NA	NA	NA	NA	NA
WP_011231264.1|3410064_3410316_-	YpmP family protein	NA	NA	NA	NA	NA
WP_013145299.1|3410412_3411684_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_053414833.1|3412249_3412696_-	YndM family protein	NA	NA	NA	NA	NA
WP_013523796.1|3412876_3413371_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	47.9	1.1e-37
WP_053414834.1|3413384_3414179_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	96.6	1.5e-153
WP_013145295.1|3414253_3414958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413721.1|3415187_3416552_-|transposase	ISLre2-like element ISGsp5 family transposase	transposase	NA	NA	NA	NA
WP_053414835.1|3416765_3417350_-	YpjP family protein	NA	NA	NA	NA	NA
WP_053414836.1|3417365_3418550_-	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_053414101.1|3419209_3420646_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
WP_011231272.1|3421051_3421183_-	YuzL family protein	NA	NA	NA	NA	NA
WP_013523798.1|3421267_3421705_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_053414837.1|3421982_3422429_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	48.9	3.6e-32
WP_053414838.1|3422652_3423798_-	conserved virulence factor C family protein	NA	NA	NA	NA	NA
WP_013145288.1|3423816_3424293_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.7	9.1e-26
WP_013145287.1|3424353_3424869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414839.1|3424988_3425897_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_013523802.1|3426038_3426134_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_167337622.1|3426319_3426469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523804.1|3426609_3427155_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_013523805.1|3427135_3427906_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_053415054.1|3427902_3428958_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_053414840.1|3429883_3431395_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_053414841.1|3431387_3432752_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_013523809.1|3432697_3433897_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_013523810.1|3433898_3434672_-	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_053414842.1|3434668_3435370_-	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_013523812.1|3435366_3436572_-	bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_053414843.1|3436537_3437656_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_013523814.1|3437662_3438310_-	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_053414844.1|3438472_3439249_-	precorrin-6A reductase	NA	NA	NA	NA	NA
WP_053414845.1|3439264_3440092_-	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_053414846.1|3440131_3441931_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_041469593.1|3442034_3442811_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.9	3.8e-05
WP_013523819.1|3442830_3443559_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_013523820.1|3443542_3443836_-	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013523821.1|3443840_3444584_-	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_053414847.1|3444584_3444983_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053415055.1|3445571_3445976_-	retropepsin-like domain-containing protein	NA	NA	NA	NA	NA
WP_053414848.1|3446079_3447135_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_044742821.1|3447277_3447532_-	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	42.3	4.0e-12
WP_013523823.1|3447583_3448069_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_053414849.1|3448939_3450148_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	32.7	2.4e-51
WP_053414850.1|3450388_3451252_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_053414851.1|3451436_3453593_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	35.0	1.5e-67
WP_053414852.1|3453605_3454496_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_053414853.1|3454589_3456452_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_053413768.1|3456516_3457779_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_013145260.1|3458479_3459949_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.9	2.2e-118
WP_013145259.1|3460035_3460587_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.3	8.0e-34
WP_053414857.1|3463668_3465330_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_053414858.1|3465474_3466839_-|transposase	ISLre2-like element ISGsp5 family transposase	transposase	NA	NA	NA	NA
WP_012820635.1|3468224_3469025_-	ExeA family protein	NA	NA	NA	NA	NA
WP_012820636.1|3469017_3470268_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_041468197.1|3470409_3470973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413857.1|3472140_3473361_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.4	6.3e-55
WP_053414859.1|3473404_3474127_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_053414860.1|3474130_3474448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053413732.1|3474440_3475574_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053414861.1|3475656_3476400_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	1.0e-23
WP_053415056.1|3476866_3477685_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
3476714:3476735	attR	TTGTAAATTATCATTTTATTTC	NA	NA	NA	NA
WP_013145258.1|3479437_3480187_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_011231313.1|3480232_3480499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414862.1|3480584_3484742_-|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_053414863.1|3484886_3485639_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_053414864.1|3485725_3486229_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_053414865.1|3486400_3490087_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_013522881.1|3490743_3492006_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.5e-31
WP_053414866.1|3493484_3494060_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_053414867.1|3494035_3494740_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_013523834.1|3494977_3495772_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013145247.1|3495980_3496226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414868.1|3496385_3498752_-	immune inhibitor A	NA	NA	NA	NA	NA
WP_053415057.1|3499016_3500321_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.4	1.2e-16
WP_053414869.1|3500584_3501334_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_013145243.1|3501484_3501886_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_053414870.1|3501981_3502989_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_053414871.1|3503032_3503881_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_013523839.1|3503896_3504763_-	permease	NA	NA	NA	NA	NA
WP_053414872.1|3504895_3506767_-	PTS fructose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_053414873.1|3506791_3507703_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_013523842.1|3507699_3508452_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_013524701.1|3510286_3511474_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414876.1|3512044_3512641_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_013145234.1|3513428_3513710_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014195947.1|3513730_3514153_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_013145232.1|3514619_3514766_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_053414877.1|3514781_3516776_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_053414878.1|3516776_3516998_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_053414879.1|3517484_3518411_-	endonuclease	NA	NA	NA	NA	NA
WP_053414880.1|3518477_3519983_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_053414881.1|3520154_3521003_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_053414882.1|3521063_3521639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414883.1|3521962_3522268_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041467865.1|3522447_3522663_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_011231352.1|3522622_3522760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053414884.1|3522816_3523236_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_053414885.1|3523309_3523783_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053414886.1|3524059_3525262_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_053414887.1|3525404_3527552_-	nitrate reductase	NA	NA	NA	NA	NA
WP_053415058.1|3527563_3527869_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_053414888.1|3528020_3530447_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013145213.1|3530805_3531210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414889.1|3531228_3531630_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_053414890.1|3531851_3533039_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_041469464.1|3533061_3533910_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_041469596.1|3534325_3536014_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_053414891.1|3536912_3537968_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP008934	Geobacillus stearothermophilus 10 chromosome, complete genome	3654829	3549788	3610171	3654829	integrase,transposase,tRNA	Streptococcus_phage(28.57%)	50	3546441:3546457	3563498:3563514
3546441:3546457	attL	GGAAACTCTTTTGTAAT	NA	NA	NA	NA
WP_053413457.1|3549788_3551225_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	7.5e-07
WP_053413546.1|3552012_3553275_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_053414899.1|3553883_3555344_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_053414900.1|3555364_3556372_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_053414901.1|3556409_3557234_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_053414902.1|3557253_3558180_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_053414903.1|3558198_3560133_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_053414904.1|3560154_3560997_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_053414905.1|3561012_3562017_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_053415060.1|3562035_3563562_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	1.8e-14
3563498:3563514	attR	GGAAACTCTTTTGTAAT	NA	NA	NA	NA
WP_053413587.1|3563654_3564842_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053414906.1|3565098_3566067_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053414907.1|3566209_3567235_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_053414908.1|3567290_3568484_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053414285.1|3568923_3570153_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.7e-84
WP_053414909.1|3570303_3571308_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053414910.1|3571607_3572624_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_053414911.1|3572813_3573578_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_053414912.1|3573768_3575226_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_053414913.1|3575313_3576750_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155467786.1|3576881_3577040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414914.1|3577292_3577943_+	cyclase family protein	NA	NA	NA	NA	NA
WP_013145145.1|3578003_3578168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053414915.1|3578224_3579604_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015731714.1|3579882_3581052_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_053414917.1|3581171_3581651_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053414918.1|3581765_3582389_-	urease accessory protein UreH	NA	NA	NA	NA	NA
WP_053414919.1|3582409_3583225_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_053414920.1|3583221_3583830_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_053414921.1|3584820_3586170_-	GntP family permease	NA	NA	NA	NA	NA
WP_053414922.1|3586284_3587856_-	gluconokinase	NA	NA	NA	NA	NA
WP_053414923.1|3587873_3588890_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012820635.1|3589978_3590779_-	ExeA family protein	NA	NA	NA	NA	NA
WP_012820636.1|3590771_3592022_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_041468197.1|3592163_3592727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523133.1|3593293_3594961_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013523684.1|3595222_3595480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013523683.1|3595646_3596855_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_053414926.1|3597381_3598551_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_053413546.1|3598601_3599864_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	7.2e-30
WP_053414927.1|3600580_3601843_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.0	8.3e-18
WP_053414928.1|3601939_3603307_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011231083.1|3603405_3604299_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_013145428.1|3604441_3604579_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013145429.1|3604612_3604711_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_053414929.1|3604837_3605767_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_013145431.1|3605953_3606058_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013523676.1|3606255_3607212_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_041468424.1|3607449_3608328_-	cation transporter	NA	NA	NA	NA	NA
WP_053414113.1|3608512_3610171_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
