The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011512	Paenibacillus peoriae strain HS311 chromosome, complete genome	6006533	910233	921989	6006533		Mollivirus(25.0%)	12	NA	NA
WP_013308794.1|910233_911532_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	9.1e-20
WP_167348612.1|911571_911799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167348616.1|912102_912240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053324650.1|912354_913236_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	1.7e-41
WP_013308797.1|913294_913540_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	37.7	8.2e-07
WP_023987050.1|913544_914234_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_023987051.1|914211_916455_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.2	5.2e-164
WP_023987052.1|916439_917921_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.3	2.3e-51
WP_143756774.1|918332_918518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053324651.1|918656_919697_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.2	4.2e-68
WP_053324652.1|919696_920311_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	3.5e-22
WP_013308804.1|920441_921989_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	3.4e-74
>prophage 2
NZ_CP011512	Paenibacillus peoriae strain HS311 chromosome, complete genome	6006533	1306704	1328520	6006533	holin,plate,tail,portal	Bacillus_phage(43.75%)	21	NA	NA
WP_029516155.1|1306704_1307130_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	36.1	5.8e-16
WP_028543151.1|1307141_1307615_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	40.4	9.6e-20
WP_013309118.1|1307947_1308424_+	transcriptional regulator	NA	A0A0C5AJ96	Bacteriophage	61.9	9.0e-42
WP_053324816.1|1308893_1309754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324817.1|1309764_1309983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324818.1|1309985_1311452_+|portal	phage portal protein	portal	A0A0N7AEC6	Bacillus_phage	36.3	1.8e-72
WP_013309122.1|1311574_1311982_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.8	1.1e-40
WP_007429164.1|1312058_1312493_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	42.0	1.8e-20
WP_053324819.1|1312669_1314442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324820.1|1314478_1315123_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	51.3	1.4e-42
WP_053324821.1|1315119_1316097_+	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	47.7	1.1e-78
WP_023987380.1|1316089_1316497_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	33.1	2.3e-09
WP_081047455.1|1316483_1316954_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	38.6	5.8e-25
WP_053324822.1|1316953_1318105_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	34.1	4.6e-39
WP_053324823.1|1318097_1318772_+	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	43.2	2.3e-27
WP_053324824.1|1318773_1321299_+	hypothetical protein	NA	A0A218KDS4	Bacillus_phage	28.6	1.7e-09
WP_053324825.1|1321313_1321925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324826.1|1321984_1322251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324827.1|1322338_1322785_+|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	61.4	1.1e-38
WP_053324828.1|1322943_1323909_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	50.6	4.5e-56
WP_053324829.1|1324026_1328520_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	1.2e-87
>prophage 3
NZ_CP011512	Paenibacillus peoriae strain HS311 chromosome, complete genome	6006533	1665017	1732625	6006533	capsid,terminase,tRNA,protease,integrase,tail,portal,head	Paenibacillus_phage(17.95%)	85	1689651:1689697	1729050:1729096
WP_023987752.1|1665017_1665731_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_025722413.1|1665771_1666944_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_053324959.1|1666956_1667484_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_023987754.1|1668094_1669333_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013309378.1|1669642_1670140_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.6	1.8e-16
WP_013309379.1|1670160_1670361_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_007429517.1|1670413_1670773_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_023987755.1|1671150_1672188_+	BMP family protein	NA	NA	NA	NA	NA
WP_053324960.1|1672328_1673867_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.2	1.4e-11
WP_013309382.1|1673859_1674939_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010349245.1|1674940_1675900_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023987757.1|1676284_1676632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324961.1|1676666_1677107_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023987759.1|1677720_1679466_+	biosynthetic-type acetolactate synthase large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	28.4	3.7e-48
WP_023987760.1|1679467_1679953_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_013309387.1|1680115_1681108_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_023987761.1|1681232_1682774_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	41.2	3.0e-09
WP_023987762.1|1682978_1684055_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_023987763.1|1684377_1684917_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_013309391.1|1685177_1685594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023987764.1|1685931_1687035_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_053324962.1|1687376_1689518_+	EAL domain-containing protein	NA	NA	NA	NA	NA
1689651:1689697	attL	TCAGCCTTCCAAGCTGATAGCGTGGGTTCGATTCCCATCACCCGCTT	NA	NA	NA	NA
WP_053324963.1|1689807_1690992_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	40.1	3.6e-71
WP_053324964.1|1691139_1691511_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	35.2	1.2e-12
WP_053324965.1|1691740_1691980_+	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	51.9	1.4e-14
WP_053324966.1|1691966_1692251_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053324967.1|1692395_1692737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324968.1|1692835_1693255_+	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	52.8	1.1e-30
WP_053324969.1|1693251_1693665_+	hypothetical protein	NA	R9TQ19	Paenibacillus_phage	54.8	1.3e-36
WP_053324970.1|1693698_1694688_+	hypothetical protein	NA	A0A0K2CY85	Paenibacillus_phage	46.8	1.9e-33
WP_155613655.1|1694684_1694885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155613656.1|1694910_1695105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324972.1|1695101_1695623_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	54.7	1.7e-46
WP_053324973.1|1695711_1696119_+	hypothetical protein	NA	M1I9V9	Streptococcus_phage	38.6	3.7e-12
WP_053324974.1|1696150_1696858_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	52.8	6.0e-66
WP_053324975.1|1696908_1697193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324976.1|1697189_1697405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324977.1|1697419_1697815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324978.1|1697846_1698068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324979.1|1698104_1698965_+	DNA (cytosine-5-)-methyltransferase	NA	A0A218MKT0	uncultured_virus	23.7	9.3e-13
WP_155613657.1|1699034_1699235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324981.1|1699276_1699624_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_053324983.1|1700197_1700605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324984.1|1700647_1700926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324985.1|1701016_1701559_+	RNA polymerase subunit sigma-24	NA	S5MAA9	Brevibacillus_phage	51.9	1.5e-37
WP_053324986.1|1701666_1701924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324987.1|1702162_1702525_+	HNH endonuclease	NA	Q38456	Bacillus_phage	54.0	6.4e-32
WP_053324988.1|1702777_1703266_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	37.5	1.6e-17
WP_053324989.1|1703262_1704972_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	60.2	1.9e-195
WP_053326547.1|1705002_1706328_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	46.0	1.7e-101
WP_053324990.1|1706266_1706866_+|head,protease	HK97 family phage prohead protease	head,protease	A0A288WFQ5	Bacillus_phage	70.1	2.1e-75
WP_053324991.1|1706910_1708122_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	39.5	1.2e-66
WP_053324992.1|1708160_1708499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324993.1|1708498_1709053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324994.1|1709052_1709523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324995.1|1709533_1709908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324996.1|1709867_1710341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324997.1|1710346_1711348_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.2	2.2e-69
WP_019686501.1|1711361_1711760_+	DUF3277 family protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	38.6	1.9e-16
WP_053324998.1|1711792_1712104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155613658.1|1712066_1712258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324999.1|1712298_1713057_+|tail	phage tail tape measure protein	tail	M4ZR40	Bacillus_phage	43.2	4.8e-21
WP_053325000.1|1713201_1714983_+	hypothetical protein	NA	A0A0A8WET6	Clostridium_phage	25.6	1.5e-33
WP_053325001.1|1714982_1715522_+	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	37.9	4.5e-13
WP_053325002.1|1715537_1715870_+	hypothetical protein	NA	A0A1L2JY63	Aeribacillus_phage	44.8	4.1e-17
WP_053325003.1|1715862_1716651_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	42.0	1.7e-53
WP_053325004.1|1716647_1717046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053325005.1|1717061_1717430_+	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	41.6	6.1e-14
WP_053325006.1|1717419_1718607_+	hypothetical protein	NA	E5DV64	Deep-sea_thermophilic_phage	44.8	7.9e-87
WP_053325007.1|1718590_1719232_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	51.2	2.1e-54
WP_053325008.1|1719247_1721794_+	hypothetical protein	NA	A0A2D1GQ96	Lysinibacillus_phage	47.5	4.1e-08
WP_053325009.1|1721806_1722322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053325010.1|1722633_1722936_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_053325011.1|1722938_1723202_+	hypothetical protein	NA	A0A0A7RUL4	Clostridium_phage	35.5	4.0e-07
WP_167348647.1|1723639_1723819_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053325013.1|1723986_1724184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155613659.1|1724287_1724500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053325014.1|1724570_1724783_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	62.1	6.4e-16
WP_053325016.1|1725252_1725888_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	29.0	2.4e-10
WP_053325017.1|1726055_1726391_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_053325018.1|1726456_1727170_+	hypothetical protein	NA	S5M638	Brevibacillus_phage	26.9	1.9e-11
WP_081047459.1|1727111_1727645_+	hypothetical protein	NA	S5MBZ7	Brevibacillus_phage	37.1	3.9e-17
WP_053325020.1|1727771_1728494_+	hypothetical protein	NA	A0A0K2CYP4	Paenibacillus_phage	33.6	7.3e-11
WP_053325021.1|1729366_1730407_+	pectate lyase	NA	NA	NA	NA	NA
1729050:1729096	attR	TCAGCCTTCCAAGCTGATAGCGTGGGTTCGATTCCCATCACCCGCTT	NA	NA	NA	NA
WP_053325022.1|1730774_1732625_+	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	28.5	4.9e-51
>prophage 4
NZ_CP011512	Paenibacillus peoriae strain HS311 chromosome, complete genome	6006533	1911454	1920808	6006533		Bacillus_phage(50.0%)	7	NA	NA
WP_023987919.1|1911454_1912324_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.0	4.9e-54
WP_053325099.1|1912444_1914247_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.8	2.5e-39
WP_013309604.1|1914375_1915107_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	9.3e-38
WP_053325100.1|1915266_1916391_+	CBS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.4	5.0e-06
WP_023987922.1|1916518_1917277_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	1.5e-14
WP_023987923.1|1917316_1917976_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_053325101.1|1918153_1920808_+	DNA polymerase I	NA	A0A060AM05	Listeria_phage	29.6	3.1e-46
>prophage 5
NZ_CP011512	Paenibacillus peoriae strain HS311 chromosome, complete genome	6006533	3540424	3547711	6006533		Staphylococcus_phage(50.0%)	9	NA	NA
WP_028540622.1|3540424_3541687_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	30.7	6.6e-07
WP_053325680.1|3541895_3542618_+	protein-glutamine gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_023989202.1|3542709_3543201_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_053325681.1|3543330_3544044_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_013310766.1|3544210_3544822_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.8	5.4e-15
WP_034095057.1|3544790_3545585_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	30.5	3.7e-08
WP_023989205.1|3545757_3546222_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.9	7.4e-41
WP_029517303.1|3546301_3546985_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	55.2	3.1e-59
WP_053325682.1|3547045_3547711_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.5	8.5e-38
