The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	0	4677	2255345		Aurantimonas_phage(50.0%)	4	NA	NA
WP_004194536.1|205_1579_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004194538.1|1732_2869_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	24.5	5.3e-24
WP_013730048.1|4004_4208_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_004194339.1|4311_4677_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	48.4	1.6e-06
>prophage 2
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	12205	16016	2255345	tRNA,protease	Acanthocystis_turfacea_chlorella_virus(33.33%)	3	NA	NA
WP_004194320.1|12205_13474_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7K9Y8	Acanthocystis_turfacea_chlorella_virus	24.6	4.1e-09
WP_004194316.1|13481_14024_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	27.6	8.5e-12
WP_004194314.1|14045_16016_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	40.8	7.4e-106
>prophage 3
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	25540	27865	2255345		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002935338.1|25540_26797_+	CHAP domain-containing protein	NA	M4I0L3	Staphylococcus_phage	39.8	5.0e-07
WP_024409289.1|26899_27865_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.8	1.5e-43
>prophage 4
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	31265	42045	2255345		Synechococcus_phage(25.0%)	8	NA	NA
WP_002935328.1|31265_31973_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	42.6	8.1e-47
WP_009908856.1|31985_35705_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	3.0e-39
WP_009908857.1|35707_37162_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.4e-58
WP_009908859.1|37217_38240_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	3.0e-58
WP_009908860.1|38236_38788_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	2.1e-26
WP_002935323.1|38797_40345_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	8.5e-73
WP_002935322.1|40409_41240_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	59.3	7.7e-89
WP_032499218.1|41229_42045_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	33.5	1.1e-26
>prophage 5
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	45262	58144	2255345	protease	Tetraselmis_virus(16.67%)	14	NA	NA
WP_009908864.1|45262_45751_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	3.2e-18
WP_002935314.1|45737_46823_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002935313.1|46809_47733_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_013730055.1|47767_49060_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.2	2.2e-18
WP_002935311.1|49571_50396_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	2.6e-20
WP_002935310.1|50388_51123_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935309.1|51457_52186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935308.1|52195_52774_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935307.1|52788_53217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935305.1|53209_54082_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.8	3.0e-27
WP_002935304.1|54087_54858_+	membrane protein	NA	NA	NA	NA	NA
WP_002935303.1|54860_56573_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	3.5e-59
WP_002935301.1|56674_56848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935300.1|57142_58144_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.8e-07
>prophage 6
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	64009	69820	2255345		Wolbachia_phage(50.0%)	5	NA	NA
WP_004194473.1|64009_65947_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.9	3.8e-70
WP_004194470.1|65985_66576_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004194469.1|66829_67399_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024409291.1|67435_68617_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_011922545.1|68668_69820_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.9	1.4e-120
>prophage 7
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	96843	97977	2255345	integrase	Clostridium_phage(100.0%)	1	85434:85448	103700:103714
85434:85448	attL	TACAGTACTATCAAA	NA	NA	NA	NA
WP_012774899.1|96843_97977_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	33.5	2.0e-34
WP_012774899.1|96843_97977_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	33.5	2.0e-34
103700:103714	attR	TTTGATAGTACTGTA	NA	NA	NA	NA
>prophage 8
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	104918	105623	2255345		Bacillus_phage(100.0%)	1	NA	NA
WP_002936595.1|104918_105623_+	metal ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.8e-07
>prophage 9
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	109428	110685	2255345	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_024409298.1|109428_110685_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	4.3e-75
>prophage 10
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	113818	121216	2255345		Tetraselmis_virus(50.0%)	2	NA	NA
WP_009909089.1|113818_117391_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.7	9.8e-40
WP_009909090.1|117568_121216_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	4.8e-66
>prophage 11
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	135301	144797	2255345		Streptococcus_phage(50.0%)	8	NA	NA
WP_002936524.1|135301_135697_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	45.5	8.0e-28
WP_002936522.1|135810_136056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936521.1|136253_136535_+	co-chaperone GroES	NA	NA	NA	NA	NA
WP_013730081.1|136546_138169_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	1.3e-153
WP_002940030.1|138400_138814_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_002940031.1|138830_139301_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002938501.1|139742_141824_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	2.2e-63
WP_024394711.1|142805_144797_+	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	26.5	1.1e-59
>prophage 12
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	154339	155347	2255345	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_002938526.1|154339_155347_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A291ATS8	Pandoravirus	36.6	2.8e-40
>prophage 13
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	165975	168863	2255345		Staphylococcus_phage(100.0%)	3	NA	NA
WP_002939155.1|165975_166674_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	3.5e-18
WP_002939149.1|166754_167447_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024390450.1|167687_168863_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.4	2.9e-17
>prophage 14
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	177177	178938	2255345		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009909153.1|177177_178938_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	25.8	2.8e-11
>prophage 15
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	188293	191613	2255345		Arthrobacter_phage(50.0%)	2	NA	NA
WP_009909160.1|188293_189085_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A286N2U4	Arthrobacter_phage	41.9	2.0e-09
WP_009909161.1|189267_191613_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.3	3.7e-120
>prophage 16
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	205922	206714	2255345		Bacillus_virus(100.0%)	1	NA	NA
WP_002935969.1|205922_206714_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	4.8e-32
>prophage 17
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	209968	213438	2255345		Streptococcus_phage(50.0%)	2	NA	NA
WP_053338564.1|209968_210910_+	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	1.5e-40
WP_053338565.1|210948_213438_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.4	8.3e-54
>prophage 18
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	216447	217623	2255345		Gordonia_phage(100.0%)	1	NA	NA
WP_013730102.1|216447_217623_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	42.3	3.6e-15
>prophage 19
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	224146	226480	2255345		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002935942.1|224146_226480_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	51.8	4.9e-24
>prophage 20
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	233193	233508	2255345		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002935923.1|233193_233508_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	40.6	2.5e-16
>prophage 21
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	244335	249473	2255345		Bacillus_virus(66.67%)	4	NA	NA
WP_009909198.1|244335_244968_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-20
WP_009909199.1|245390_246725_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_024409304.1|246806_248441_-	recombinase family protein	NA	A0A2H4J6X5	uncultured_Caudovirales_phage	23.8	2.3e-20
WP_024409305.1|248675_249473_-	replication-relaxation family protein	NA	G3MBL2	Bacillus_virus	25.1	1.8e-10
>prophage 22
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	255312	255975	2255345		Clostridium_phage(100.0%)	1	NA	NA
WP_024409312.1|255312_255975_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	26.3	3.9e-11
>prophage 23
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	261151	269466	2255345	transposase	Hokovirus(25.0%)	8	NA	NA
WP_013730107.1|261151_262090_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	4.8e-63
WP_024409267.1|262422_263655_+	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	30.7	7.8e-29
WP_009909208.1|263666_264494_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_053338566.1|264543_265326_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_009909210.1|265327_266107_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_009909211.1|266099_267083_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	3.2e-17
WP_013730109.1|267167_267701_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099425904.1|268618_269466_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	4.7e-09
>prophage 24
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	276589	278122	2255345		Klebsiella_phage(100.0%)	1	NA	NA
WP_013730112.1|276589_278122_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
>prophage 25
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	286182	287208	2255345		Tupanvirus(100.0%)	1	NA	NA
WP_009909260.1|286182_287208_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.2	1.2e-27
>prophage 26
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	292529	298090	2255345	transposase	Streptococcus_phage(33.33%)	3	NA	NA
WP_086558053.1|292529_293822_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_013730119.1|295714_297376_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.1	7.8e-16
WP_024409183.1|297376_298090_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	25.5	1.3e-07
>prophage 27
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	303964	307445	2255345		Bacillus_phage(100.0%)	2	NA	NA
WP_009909279.1|303964_305713_-	ABC transporter ATP-binding protein	NA	W8CYT2	Bacillus_phage	52.7	3.8e-05
WP_013730124.1|305702_307445_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	1.5e-46
>prophage 28
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	312081	315575	2255345		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_053338567.1|312081_313905_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.6	5.6e-132
WP_002937503.1|314438_315575_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.6	1.9e-21
>prophage 29
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	320924	397651	2255345	tRNA,protease,holin,transposase	Streptococcus_phage(28.57%)	64	NA	NA
WP_002937476.1|320924_321140_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	29.9	8.0e-06
WP_013730132.1|321141_321666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002937472.1|321800_323669_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	3.1e-93
WP_013730133.1|323830_324286_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002937468.1|324452_325202_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002937466.1|325191_325953_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002937464.1|325942_326428_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002937462.1|326408_326975_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002937456.1|326974_327589_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_002937454.1|327861_328293_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002937449.1|328372_329374_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002937445.1|329399_330245_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002937439.1|330237_331107_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002937437.1|331099_332311_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_002937436.1|332577_333087_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002937435.1|333229_334348_+	pectin acetylesterase	NA	NA	NA	NA	NA
WP_013730135.1|334357_335377_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002937432.1|335598_336882_+	trigger factor	NA	NA	NA	NA	NA
WP_002937351.1|337926_338847_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002937350.1|338880_342036_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_099425909.1|342116_343467_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	9.7e-65
WP_011921912.1|344566_345148_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_009909339.1|345340_346945_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.6	4.4e-141
WP_024409215.1|347556_348438_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001140948.1|348832_349021_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004194311.1|355109_357128_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_053338568.1|357300_358605_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	72.5	2.9e-167
WP_014636805.1|358669_359629_-	asparaginase	NA	NA	NA	NA	NA
WP_004194297.1|359698_360544_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004194296.1|360545_361064_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	35.5	8.9e-19
WP_004194294.1|361079_361532_-	universal stress protein	NA	NA	NA	NA	NA
WP_002937606.1|361686_362901_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013730143.1|363371_364160_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_024376330.1|364161_364713_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.7	9.5e-27
WP_053338569.1|364995_366198_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.5	1.1e-224
WP_011921928.1|366755_367103_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013730145.1|367284_367959_+	hydrolase	NA	NA	NA	NA	NA
WP_002939046.1|368176_368479_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002939044.1|368478_369945_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002939042.1|369944_371384_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_074390696.1|371701_371857_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002939037.1|372159_373158_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.7	5.0e-10
WP_002939036.1|373290_374463_+	galactokinase	NA	NA	NA	NA	NA
WP_009909376.1|374472_375954_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002939032.1|376028_376937_+	EamA family transporter	NA	NA	NA	NA	NA
WP_009909358.1|377124_378327_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	97.5	4.2e-221
WP_002935152.1|378609_379239_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002935151.1|379445_379820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935150.1|380003_380531_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_011922650.1|380531_381638_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_024379048.1|381956_382268_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002935147.1|382280_382913_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	33.8	2.0e-20
WP_002935146.1|382909_383497_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_002935141.1|383951_384461_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002935140.1|384462_384822_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_009909388.1|385278_386025_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024390442.1|386025_387807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935136.1|387850_388939_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002935135.1|388940_389321_+	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_053338570.1|389380_390760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194216.1|390779_391190_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	34.2	2.1e-10
WP_013730153.1|391604_393704_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.1	7.4e-120
WP_004194210.1|393885_395394_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004194208.1|395386_397651_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	44.8	3.2e-12
>prophage 30
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	408428	411296	2255345		Planktothrix_phage(50.0%)	2	NA	NA
WP_009909409.1|408428_410102_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	6.2e-21
WP_004194179.1|411092_411296_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	75.4	7.5e-22
>prophage 31
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	421813	422440	2255345		Abalone_herpesvirus(100.0%)	1	NA	NA
WP_004194155.1|421813_422440_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.3	8.8e-21
>prophage 32
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	425642	469318	2255345	tRNA,portal,transposase,integrase	Streptococcus_phage(93.48%)	52	433618:433632	441994:442008
WP_009909423.1|425642_426581_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	27.8	1.2e-08
WP_074412645.1|426567_427881_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_012774983.1|427918_428656_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_009909429.1|428655_430650_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	32.5	3.2e-24
WP_013730162.1|431061_431766_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002937028.1|431762_432779_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002937025.1|432750_433392_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002937018.1|433441_434842_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	2.3e-24
433618:433632	attL	TTTGGTGCCAGAAAT	NA	NA	NA	NA
WP_002937017.1|434843_435215_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002937015.1|435241_436168_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	100.0	9.9e-170
WP_024409220.1|436397_437555_-|integrase	site-specific integrase	integrase	A0A1X9I5C3	Streptococcus_phage	100.0	2.2e-219
WP_013730164.1|437751_438483_-	hypothetical protein	NA	A0A1X9I5E4	Streptococcus_phage	100.0	3.7e-103
WP_013730165.1|438530_438914_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I5R2	Streptococcus_phage	100.0	2.9e-67
WP_002937004.1|438920_439301_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5A1	Streptococcus_phage	100.0	3.9e-64
WP_002937001.1|439485_439686_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	100.0	9.6e-30
WP_013730166.1|439755_440082_+	hypothetical protein	NA	A0A1X9I594	Streptococcus_phage	100.0	8.0e-58
WP_013730167.1|440155_440410_+	hypothetical protein	NA	A0A1X9I581	Streptococcus_phage	100.0	9.7e-43
WP_013730168.1|440450_440699_+	hypothetical protein	NA	A0A1X9I6Q0	Streptococcus_phage	100.0	1.1e-38
WP_022540561.1|440688_440841_+	hypothetical protein	NA	A0A1X9I663	Streptococcus_phage	100.0	2.0e-19
WP_013730169.1|440845_441187_+	hypothetical protein	NA	A0A1X9I5G6	Streptococcus_phage	100.0	2.1e-56
WP_013730170.1|441186_441666_+	siphovirus Gp157 family protein	NA	A0A1X9I5D2	Streptococcus_phage	100.0	4.8e-67
WP_013730171.1|441662_441908_+	hypothetical protein	NA	A0A1X9I5F0	Streptococcus_phage	100.0	4.3e-40
WP_013730172.1|441888_442353_+	hypothetical protein	NA	A0A1X9I5S7	Streptococcus_phage	100.0	7.1e-84
441994:442008	attR	TTTGGTGCCAGAAAT	NA	NA	NA	NA
WP_013730173.1|442321_443494_+	hypothetical protein	NA	M1PF69	Streptococcus_phage	98.7	7.0e-229
WP_013730175.1|443843_444542_+	ERF family protein	NA	A0A1X9I5A9	Streptococcus_phage	100.0	2.2e-113
WP_022540564.1|444541_444838_+	hypothetical protein	NA	A0A1X9I5B1	Streptococcus_phage	100.0	1.6e-52
WP_022540565.1|444834_445233_+	single-stranded DNA-binding protein	NA	A0A1X9I6R5	Streptococcus_phage	100.0	2.7e-68
WP_013730177.1|445243_446071_+	bifunctional DNA primase/polymerase	NA	A0A1X9I684	Streptococcus_phage	100.0	4.6e-158
WP_079253058.1|446054_447434_+	helicase	NA	A0A1X9I5H6	Streptococcus_phage	99.8	3.8e-266
WP_013730179.1|447790_447946_+	hypothetical protein	NA	A0A1X9I5E8	Streptococcus_phage	100.0	9.7e-22
WP_013730180.1|447942_448251_+	DUF1372 family protein	NA	A0A1X9I5G5	Streptococcus_phage	100.0	3.8e-49
WP_013730181.1|448252_448468_+	hypothetical protein	NA	A0A1X9I5W1	Streptococcus_phage	100.0	9.7e-36
WP_013730182.1|448656_448971_+	hypothetical protein	NA	A0A1X9I5C1	Streptococcus_phage	100.0	5.2e-54
WP_002937915.1|449043_449478_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_013730183.1|449574_449922_+	HNH endonuclease	NA	A0A1X9I5C9	Streptococcus_phage	100.0	1.3e-61
WP_024409219.1|450013_450373_+	hypothetical protein	NA	A0A1X9I6S2	Streptococcus_phage	99.2	9.8e-41
WP_013730185.1|450369_451635_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	100.0	5.4e-243
WP_013730186.1|451627_452848_+	hypothetical protein	NA	A0A1X9I5H8	Streptococcus_phage	100.0	2.0e-239
WP_022540567.1|452852_453086_+	hypothetical protein	NA	A0A1X9I5G0	Streptococcus_phage	100.0	1.6e-39
WP_162489882.1|453287_454580_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.5e-213
WP_009909540.1|456204_456843_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	100.0	4.6e-126
WP_024409271.1|456905_459419_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	100.0	0.0e+00
WP_013730270.1|459580_460657_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	100.0	2.1e-195
WP_009909544.1|460721_461960_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	100.0	1.2e-223
WP_009909545.1|461969_462755_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	100.0	1.6e-136
WP_013730271.1|462777_463182_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	100.0	1.1e-64
WP_013730272.1|463308_464160_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	100.0	6.3e-155
WP_024409272.1|464258_465518_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	100.0	7.0e-243
WP_012775019.1|465639_466374_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	99.5	1.5e-120
WP_024409273.1|466478_467924_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	99.8	1.6e-227
WP_011922111.1|467941_468631_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	96.1	1.3e-110
WP_009909562.1|468640_469318_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	100.0	1.6e-121
>prophage 33
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	477025	479021	2255345		Catovirus(100.0%)	2	NA	NA
WP_002936347.1|477025_478024_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.8	4.7e-08
WP_024409276.1|478016_479021_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.6	6.0e-11
>prophage 34
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	491631	492479	2255345	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_099425904.1|491631_492479_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	4.7e-09
>prophage 35
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	500475	503506	2255345		Streptococcus_phage(100.0%)	2	NA	NA
WP_009909614.1|500475_501834_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	98.7	8.1e-253
WP_009909617.1|502393_503506_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	99.2	3.1e-218
>prophage 36
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	506654	513839	2255345	tRNA	Streptococcus_phage(60.0%)	8	NA	NA
WP_013730302.1|506654_508001_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	4.8e-56
WP_002938604.1|508272_508500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011922754.1|508489_508759_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	51.2	1.8e-18
WP_002937278.1|509164_510484_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_013730303.1|510667_511045_+	RidA family protein	NA	NA	NA	NA	NA
WP_002937261.1|511066_511954_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.0	3.9e-06
WP_002937257.1|511950_512925_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.1	1.8e-145
WP_009909630.1|512921_513839_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	67.7	5.1e-110
>prophage 37
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	533045	535819	2255345		Tupanvirus(50.0%)	2	NA	NA
WP_009909649.1|533045_534581_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.6	7.4e-37
WP_009909650.1|534577_535819_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.3	6.0e-21
>prophage 38
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	541936	544702	2255345		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_009909658.1|541936_542962_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.0e-14
WP_009909659.1|542975_543905_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730319.1|543901_544702_-	ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	24.2	7.1e-07
>prophage 39
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	547905	563682	2255345	transposase	Streptococcus_phage(100.0%)	17	NA	NA
WP_009909666.1|547905_550143_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	94.0	1.4e-97
WP_002935351.1|550144_550288_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002935353.1|550466_551123_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	99.1	2.1e-113
WP_002935354.1|551216_552044_+	hypothetical protein	NA	M1PFV6	Streptococcus_phage	97.8	6.6e-133
WP_002935355.1|552049_553321_+	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	100.0	1.7e-212
WP_002935357.1|553357_554224_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	99.7	4.6e-153
WP_002935358.1|554398_555037_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	98.6	2.6e-113
WP_002935359.1|555033_555918_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	98.3	3.6e-153
WP_002935361.1|555937_556255_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	100.0	3.1e-54
WP_002935362.1|556256_557120_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	99.7	2.1e-158
WP_002935363.1|557589_558681_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	98.6	1.5e-204
WP_002935364.1|558680_559238_+	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	98.4	4.5e-93
WP_002935365.1|559611_560793_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	99.7	2.7e-220
WP_002935366.1|560795_561302_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	97.0	1.2e-92
WP_002935368.1|561285_561639_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	100.0	1.9e-60
WP_009909675.1|561655_562555_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	98.3	1.3e-161
WP_002935370.1|562854_563682_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	99.6	8.3e-152
>prophage 40
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	578664	581578	2255345		Streptococcus_phage(50.0%)	3	NA	NA
WP_002935389.1|578664_580383_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	99.0	0.0e+00
WP_002935390.1|580473_581043_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002935392.1|581029_581578_-	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.8	2.8e-23
>prophage 41
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	588076	588694	2255345		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002935402.1|588076_588694_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	51.5	3.8e-48
>prophage 42
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	595394	598522	2255345		Aeromonas_phage(50.0%)	2	NA	NA
WP_002935432.1|595394_597839_+	glycyl radical protein	NA	A0A2H4YEI2	Aeromonas_phage	47.2	4.9e-06
WP_002935438.1|597853_598522_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.0	1.5e-21
>prophage 43
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	603681	607230	2255345	transposase	Streptococcus_phage(100.0%)	3	NA	NA
WP_086558053.1|603681_604974_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_004194123.1|605248_605881_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	97.6	1.3e-109
WP_004194121.1|605937_607230_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	99.1	6.3e-247
>prophage 44
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	615409	616762	2255345		Streptococcus_phage(100.0%)	1	NA	NA
WP_004194110.1|615409_616762_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	34.6	1.6e-75
>prophage 45
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	627127	639205	2255345	tRNA	Oenococcus_phage(25.0%)	10	NA	NA
WP_004194070.1|627127_627517_+	VOC family protein	NA	V5UQY3	Oenococcus_phage	51.6	1.1e-32
WP_004194068.1|627513_628089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194066.1|628252_629026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194064.1|629022_629454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194062.1|629629_632281_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.3	2.9e-153
WP_004194058.1|632367_633630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194056.1|633714_636588_+	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	28.2	3.1e-28
WP_004194051.1|636611_637004_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_024409169.1|637078_638128_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_011922684.1|638212_639205_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.9	2.6e-51
>prophage 46
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	661110	672114	2255345	tRNA,protease,transposase	Klosneuvirus(20.0%)	9	NA	NA
WP_002938831.1|661110_663900_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	1.6e-90
WP_162096930.1|664122_665415_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_002938710.1|665901_666210_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002938708.1|666264_666726_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024409218.1|666911_669140_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.4	4.3e-126
WP_002938704.1|669363_669594_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_002938702.1|669719_670409_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002938699.1|670401_671136_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	7.9e-37
WP_002938697.1|671265_672114_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	42.0	1.0e-40
>prophage 47
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	678447	679734	2255345		Phage_TP(100.0%)	1	NA	NA
WP_015646557.1|678447_679734_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.2	2.7e-40
>prophage 48
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	685782	686478	2255345		Planktothrix_phage(100.0%)	1	NA	NA
WP_004194759.1|685782_686478_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.2	4.1e-35
>prophage 49
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	691624	696854	2255345	tRNA	Catovirus(50.0%)	6	NA	NA
WP_009909483.1|691624_693115_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.9	8.7e-91
WP_002938482.1|693217_693844_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_053338574.1|693846_694329_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_009909486.1|694328_695171_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_002938477.1|695273_695822_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_002938476.1|695999_696854_-	glycoside hydrolase family 25 protein	NA	A0A2K5B2A3	Erysipelothrix_phage	27.9	1.9e-10
>prophage 50
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	703825	712396	2255345		Aureococcus_anophage(33.33%)	7	NA	NA
WP_012775011.1|703825_705022_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.2	2.5e-32
WP_004298713.1|705196_705949_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_009909496.1|706002_706812_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_002936179.1|706801_708115_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.9	8.9e-31
WP_002936180.1|708213_709101_+	anion permease	NA	NA	NA	NA	NA
WP_011922083.1|709112_709499_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002936183.1|709708_712396_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.8	6.2e-71
>prophage 51
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	716549	717242	2255345		Planktothrix_phage(100.0%)	1	NA	NA
WP_002936190.1|716549_717242_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.2	5.2e-30
>prophage 52
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	721777	725244	2255345		Bacillus_phage(100.0%)	2	NA	NA
WP_002937982.1|721777_723505_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	2.4e-39
WP_002937979.1|723504_725244_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.4e-44
>prophage 53
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	732850	740294	2255345		Bacillus_virus(25.0%)	8	NA	NA
WP_009910298.1|732850_733678_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	33.9	2.4e-26
WP_002935763.1|733670_734273_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002935765.1|734259_735465_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_012775228.1|735464_735614_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002935768.1|735660_735894_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002935770.1|736324_738694_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.8	6.0e-94
WP_002935771.1|738696_739164_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	55.7	4.7e-43
WP_024409248.1|739250_740294_-	Zn-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	21.7	5.1e-05
>prophage 54
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	743526	747761	2255345		uncultured_virus(50.0%)	4	NA	NA
WP_002935780.1|743526_745977_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.0	3.9e-96
WP_002935783.1|746055_746541_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_002935785.1|746635_746971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935794.1|747059_747761_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	1.2e-37
>prophage 55
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	751594	752767	2255345	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_002935801.1|751594_752767_-|transposase	IS110 family transposase	transposase	A0A1X9I5G9	Streptococcus_phage	95.9	2.1e-31
>prophage 56
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	766560	767151	2255345	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_002937303.1|766560_767151_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.7	1.5e-54
>prophage 57
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	770892	772367	2255345		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002937291.1|770892_771657_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	2.8e-16
WP_002937288.1|771656_772367_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	2.6e-16
>prophage 58
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	775484	826897	2255345	portal,transposase,holin,terminase,capsid,integrase	Streptococcus_phage(95.0%)	68	778630:778649	815779:815798
WP_013730459.1|775484_776090_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.7	1.0e-58
WP_022540664.1|776351_778376_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
778630:778649	attL	ATTCCTGCAGGGGAGATGAA	NA	NA	NA	NA
WP_014636689.1|778682_779777_-|integrase	site-specific integrase	integrase	A0A1X9I680	Streptococcus_phage	100.0	6.8e-210
WP_014636688.1|779902_780337_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1X9I6T4	Streptococcus_phage	100.0	2.3e-76
WP_044666849.1|780511_781279_-	helix-turn-helix transcriptional regulator	NA	M1NS52	Streptococcus_phage	100.0	1.3e-143
WP_024378011.1|781865_782555_-	hypothetical protein	NA	M1PL51	Streptococcus_phage	100.0	1.7e-126
WP_044666850.1|782634_782820_+	helix-turn-helix transcriptional regulator	NA	M1Q1I0	Streptococcus_phage	100.0	6.4e-28
WP_044666852.1|782945_783206_-	hypothetical protein	NA	M1PS67	Streptococcus_phage	100.0	4.6e-40
WP_044666854.1|783269_783485_+	hypothetical protein	NA	M1NS46	Streptococcus_phage	100.0	2.2e-32
WP_014636681.1|783600_784290_-	DUF4145 domain-containing protein	NA	A0A1X9I6S1	Streptococcus_phage	100.0	4.0e-131
WP_044675588.1|784343_785054_+	phage antirepressor KilAC domain-containing protein	NA	M1PL46	Streptococcus_phage	100.0	1.0e-129
WP_043028972.1|785408_785666_+	hypothetical protein	NA	M1PS62	Streptococcus_phage	100.0	3.5e-40
WP_044677346.1|785646_785847_+	hypothetical protein	NA	M1NS41	Streptococcus_phage	100.0	3.7e-29
WP_079271045.1|786022_786382_+	helix-turn-helix transcriptional regulator	NA	M1PL41	Streptococcus_phage	99.0	1.1e-52
WP_044677351.1|786640_786970_+	hypothetical protein	NA	M1Q1G9	Streptococcus_phage	100.0	5.8e-56
WP_004195117.1|786976_787117_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	100.0	7.0e-19
WP_004195116.1|787255_787435_+	hypothetical protein	NA	A0A1X9I5S5	Streptococcus_phage	100.0	2.4e-24
WP_014636675.1|787431_788202_+	phage recombination protein Bet	NA	M1PFN1	Streptococcus_phage	100.0	4.3e-142
WP_014636674.1|788211_789240_+	DUF1351 domain-containing protein	NA	M1PL36	Streptococcus_phage	100.0	2.0e-134
WP_002937957.1|789242_789512_+	hypothetical protein	NA	M1Q1G3	Streptococcus_phage	100.0	1.6e-48
WP_002937956.1|789521_789848_+	hypothetical protein	NA	M1PS51	Streptococcus_phage	100.0	6.1e-58
WP_002937955.1|789837_790017_+	hypothetical protein	NA	M1NS29	Streptococcus_phage	100.0	1.9e-24
WP_002937951.1|790119_790581_+	single-stranded DNA-binding protein	NA	M1PL31	Streptococcus_phage	100.0	2.0e-70
WP_002937949.1|790608_790983_+	hypothetical protein	NA	M1Q1F9	Streptococcus_phage	100.0	2.8e-70
WP_002937944.1|791295_791628_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	100.0	5.3e-57
WP_002937943.1|791624_792143_+	hypothetical protein	NA	M1PFM2	Streptococcus_phage	100.0	1.7e-89
WP_002937939.1|792152_792455_+	DUF1372 family protein	NA	M1PL25	Streptococcus_phage	100.0	9.4e-53
WP_002937935.1|792470_792704_+	hypothetical protein	NA	M1Q1F5	Streptococcus_phage	100.0	1.9e-37
WP_002937925.1|792703_792880_+	hypothetical protein	NA	M1PS40	Streptococcus_phage	100.0	5.7e-26
WP_002937922.1|792879_793149_+	hypothetical protein	NA	M1NS18	Streptococcus_phage	100.0	1.6e-43
WP_002937919.1|793160_793412_+	hypothetical protein	NA	M1PFL8	Streptococcus_phage	100.0	1.7e-39
WP_002937915.1|793488_793923_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_002937914.1|794019_794367_+	HNH endonuclease	NA	M1Q1E9	Streptococcus_phage	100.0	1.5e-62
WP_002937910.1|794445_794808_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	71.7	9.0e-26
WP_002937907.1|794804_796070_+|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	100.0	7.0e-243
WP_002937903.1|796062_797142_+	hypothetical protein	NA	M1PL14	Streptococcus_phage	100.0	5.7e-209
WP_002937901.1|797138_797351_+	hypothetical protein	NA	M1Q1E3	Streptococcus_phage	100.0	8.1e-35
WP_044677354.1|797695_799111_+|terminase	terminase	terminase	M1PS30	Streptococcus_phage	100.0	1.6e-267
WP_079394996.1|799191_799662_+	DUF4355 domain-containing protein	NA	M1NS07	Streptococcus_phage	100.0	1.6e-78
WP_002937882.1|799676_800579_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	100.0	1.4e-173
WP_002937881.1|800580_800805_+	hypothetical protein	NA	M1PL08	Streptococcus_phage	100.0	1.2e-31
WP_002937880.1|800808_801204_+	phage Gp19/Gp15/Gp42 family protein	NA	M1Q1D8	Streptococcus_phage	100.0	4.4e-66
WP_002937879.1|801190_801529_+	hypothetical protein	NA	M1PS26	Streptococcus_phage	100.0	2.3e-60
WP_002937877.1|801521_801761_+	hypothetical protein	NA	M1NS01	Streptococcus_phage	100.0	6.3e-36
WP_002937874.1|801757_802093_+	hypothetical protein	NA	M1PFK6	Streptococcus_phage	100.0	2.2e-55
WP_044666861.1|802108_802696_+	hypothetical protein	NA	M1PL03	Streptococcus_phage	100.0	2.5e-102
WP_024415622.1|802706_802985_+	hypothetical protein	NA	M1Q1D2	Streptococcus_phage	100.0	3.6e-43
WP_044666863.1|802981_803365_+	DUF5361 domain-containing protein	NA	M1PS20	Streptococcus_phage	100.0	3.6e-65
WP_002937855.1|803354_805937_+	hypothetical protein	NA	M1NRZ6	Streptococcus_phage	100.0	6.2e-262
WP_002937853.1|805936_806632_+	adenylosuccinate synthetase	NA	M1PFK1	Streptococcus_phage	100.0	5.8e-130
WP_053338576.1|806628_811863_+	hypothetical protein	NA	M1NS79	Streptococcus_phage	88.0	0.0e+00
WP_002937846.1|811871_812090_+	hypothetical protein	NA	A0A1X9I6F7	Streptococcus_phage	100.0	1.5e-28
WP_002937844.1|812092_812437_+	hypothetical protein	NA	A0A1X9I644	Streptococcus_phage	100.0	8.7e-63
WP_014636661.1|812440_812740_+	hypothetical protein	NA	A0A1S5SA32	Streptococcus_phage	100.0	7.6e-47
WP_053338577.1|812742_813072_+|holin	phage holin	holin	A0A1X9I630	Streptococcus_phage	100.0	1.5e-51
WP_053338578.1|813074_814481_+	glucosaminidase domain-containing protein	NA	A1EAB6	Streptococcus_phage	73.6	6.3e-176
WP_029176883.1|814865_815381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024390438.1|815814_817029_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	100.0	8.3e-225
815779:815798	attR	ATTCCTGCAGGGGAGATGAA	NA	NA	NA	NA
WP_013730456.1|817018_817297_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002940393.1|817378_817648_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_012775265.1|817787_818249_-	flavodoxin	NA	NA	NA	NA	NA
WP_013730455.1|818343_819288_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013730454.1|819274_820303_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_014636072.1|820382_820664_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_086558053.1|820949_822242_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_009910187.1|822435_823458_+	PhoH family protein	NA	W8D063	Erwinia_phage	48.6	2.5e-49
WP_086558053.1|823669_824962_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_012027267.1|825748_826897_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	33.1	4.0e-43
>prophage 59
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	838176	856207	2255345	tRNA,transposase	Escherichia_phage(30.0%)	17	NA	NA
WP_002937139.1|838176_840390_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.3	1.4e-76
WP_002937137.1|840368_841499_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_002937136.1|841552_842065_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.6	1.2e-31
WP_024409330.1|842271_843216_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.9e-20
WP_053338579.1|843225_844161_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002937132.1|844170_844845_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	43.4	1.8e-11
WP_002937128.1|844846_845530_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002937125.1|845519_846314_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002937123.1|846489_847314_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_002937121.1|847411_848281_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.2	3.0e-99
WP_002937119.1|848280_848874_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	33.1	5.1e-10
WP_002937118.1|848873_849359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937117.1|849546_850593_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.5	1.3e-69
WP_002937114.1|850647_851499_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.4	2.1e-25
WP_002937113.1|851515_852556_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_025310415.1|852593_855701_+	GBS Bsp-like repeat-containing protein	NA	M4ZRP4	Bacillus_phage	33.5	4.4e-20
WP_074390297.1|855778_856207_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	42.1	3.4e-16
>prophage 60
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	861912	863127	2255345		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002937100.1|861912_863127_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.4e-09
>prophage 61
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	868482	869463	2255345		Catovirus(100.0%)	1	NA	NA
WP_009910144.1|868482_869463_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.1	1.6e-05
>prophage 62
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	876970	877492	2255345		Agrobacterium_phage(100.0%)	1	NA	NA
WP_032497583.1|876970_877492_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.1	9.0e-11
>prophage 63
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	881248	918136	2255345	transposase,holin,terminase,capsid,protease	Streptococcus_phage(93.33%)	36	NA	NA
WP_004194722.1|881248_883423_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	60.3	1.1e-230
WP_004194720.1|883538_884702_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.7	2.1e-140
WP_004194719.1|884698_885373_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	64.6	7.7e-79
WP_004194717.1|885376_886543_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	3.5e-39
WP_013730266.1|886550_887654_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002938966.1|887663_888002_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	100.0	1.9e-54
WP_002935153.1|888304_889507_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_024390460.1|889781_890036_+	hypothetical protein	NA	A0A1X9I5Y1	Streptococcus_phage	100.0	1.2e-40
WP_024390459.1|890035_890266_+	hypothetical protein	NA	A0A1X9I6E9	Streptococcus_phage	100.0	4.8e-33
WP_024409245.1|890349_891765_+|terminase	terminase	terminase	A0A1X9I637	Streptococcus_phage	100.0	1.2e-267
WP_024409244.1|891845_892310_+	DUF4355 domain-containing protein	NA	A0A1X9I604	Streptococcus_phage	100.0	5.5e-76
WP_024390456.1|892313_893204_+|capsid	phage major capsid protein	capsid	M1PF50	Streptococcus_phage	100.0	6.8e-168
WP_024409243.1|893205_893424_+	hypothetical protein	NA	A0A1X9I6Q1	Streptococcus_phage	100.0	8.6e-32
WP_024409242.1|893427_893823_+	phage Gp19/Gp15/Gp42 family protein	NA	A0A1X9I730	Streptococcus_phage	100.0	3.7e-65
WP_024409241.1|893809_894148_+	hypothetical protein	NA	A0A1X9I5Z3	Streptococcus_phage	100.0	4.7e-61
WP_024409240.1|894140_894380_+	hypothetical protein	NA	A0A1X9I5Y4	Streptococcus_phage	100.0	4.8e-36
WP_024409239.1|894376_894712_+	hypothetical protein	NA	A0A1X9I5X7	Streptococcus_phage	100.0	6.5e-55
WP_053338580.1|894727_895315_+	hypothetical protein	NA	M1PL03	Streptococcus_phage	99.5	1.2e-101
WP_024415622.1|895325_895604_+	hypothetical protein	NA	M1Q1D2	Streptococcus_phage	100.0	3.6e-43
WP_044666863.1|895600_895984_+	DUF5361 domain-containing protein	NA	M1PS20	Streptococcus_phage	100.0	3.6e-65
WP_002937855.1|895973_898556_+	hypothetical protein	NA	M1NRZ6	Streptococcus_phage	100.0	6.2e-262
WP_002937853.1|898555_899251_+	adenylosuccinate synthetase	NA	M1PFK1	Streptococcus_phage	100.0	5.8e-130
WP_079714052.1|899247_904554_+	hypothetical protein	NA	A0A1X9I6P1	Streptococcus_phage	100.0	0.0e+00
WP_024409234.1|904553_904769_+	hypothetical protein	NA	A0A1X9I729	Streptococcus_phage	100.0	4.3e-28
WP_024409233.1|904771_905116_+	hypothetical protein	NA	A0A1X9I5X6	Streptococcus_phage	100.0	6.7e-63
WP_029743088.1|905161_905548_+|holin	phage holin family protein	holin	A0A1X9I5Y2	Streptococcus_phage	100.0	1.1e-61
WP_024409231.1|905644_906382_+	PlySs2 family phage lysin	NA	A0A1X9I5W6	Streptococcus_phage	100.0	1.9e-139
WP_024394270.1|906446_906824_+	hypothetical protein	NA	A0A1X9I733	Streptococcus_phage	100.0	1.9e-63
WP_162096930.1|907225_908518_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_002935451.1|908732_910523_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	100.0	0.0e+00
WP_002935455.1|910689_911028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935458.1|911212_912580_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009909707.1|912869_915149_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	1.2e-128
WP_009909709.1|915590_916331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730335.1|916609_917293_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_013730336.1|917371_918136_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 64
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	921910	922654	2255345		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009909716.1|921910_922654_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.3e-26
>prophage 65
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	934645	948735	2255345	transposase	Bacillus_virus(75.0%)	10	NA	NA
WP_002935480.1|934645_938299_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.6	5.5e-22
WP_009909724.1|938308_938953_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002935482.1|939095_941045_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.9	9.2e-125
WP_002935485.1|941068_941671_+	Fic family protein	NA	NA	NA	NA	NA
WP_002935487.1|941703_942198_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_002935488.1|942200_942653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909731.1|942853_945307_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.0e-92
WP_002935490.1|945478_946096_+	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_013730342.1|946206_947229_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_086558053.1|947442_948735_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
>prophage 66
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	958217	959132	2255345		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002939454.1|958217_959132_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.5	8.1e-07
>prophage 67
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	962355	964606	2255345		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_053338581.1|962355_963279_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.0	1.5e-24
WP_002939138.1|963526_964606_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.0	3.0e-61
>prophage 68
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	970802	974317	2255345		Bacillus_phage(100.0%)	2	NA	NA
WP_013730350.1|970802_972539_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.6e-35
WP_002938582.1|972547_974317_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	5.5e-60
>prophage 69
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	980328	982267	2255345		Mycoplasma_phage(100.0%)	2	NA	NA
WP_002938664.1|980328_981483_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.7	4.0e-35
WP_002938659.1|981466_982267_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	23.5	1.3e-11
>prophage 70
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	993388	998208	2255345	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_012775084.1|993388_994372_+	GMP reductase	NA	G3MBI2	Bacillus_virus	75.1	9.6e-139
WP_014636922.1|994441_995791_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002934950.1|995888_996407_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002934953.1|996396_997122_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002934954.1|997152_998208_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	25.1	1.1e-10
>prophage 71
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1004016	1024944	2255345	tRNA,protease	Bacillus_phage(25.0%)	24	NA	NA
WP_002934964.1|1004016_1005228_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.1	2.2e-39
WP_002934965.1|1005220_1007089_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.7e-57
WP_002934966.1|1007089_1007425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934967.1|1007520_1008480_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002934968.1|1008606_1008885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934969.1|1008896_1009199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934970.1|1009251_1010091_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	55.7	3.0e-88
WP_002934971.1|1010428_1010941_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	35.4	1.4e-19
WP_002934974.1|1011138_1012365_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.2e-133
WP_002934975.1|1012420_1013008_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002934976.1|1013030_1013444_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	1.5e-24
WP_002934977.1|1013539_1015372_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	4.4e-20
WP_002934978.1|1015421_1015604_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002934980.1|1015738_1017046_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002934981.1|1017107_1017332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934983.1|1017430_1018012_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	53.5	2.1e-48
WP_002934984.1|1018292_1019372_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002934985.1|1019371_1020205_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_009909811.1|1020191_1020800_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	31.5	2.9e-16
WP_009909813.1|1020796_1021228_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002934988.1|1021251_1022511_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	54.5	7.3e-99
WP_002934989.1|1022510_1023485_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002934990.1|1023485_1024085_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	40.4	5.7e-25
WP_002934991.1|1024185_1024944_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	21.5	8.2e-05
>prophage 72
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1028026	1032482	2255345		Acidithiobacillus_phage(50.0%)	3	NA	NA
WP_002934996.1|1028026_1029724_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	29.5	3.4e-22
WP_002934997.1|1029720_1030770_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_002934999.1|1030931_1032482_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	1.4e-19
>prophage 73
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1037837	1038908	2255345		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002935006.1|1037837_1038908_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.7	5.2e-05
>prophage 74
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1042203	1045505	2255345		Streptococcus_phage(50.0%)	4	NA	NA
WP_002935012.1|1042203_1042461_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.7	7.8e-16
WP_002935014.1|1042450_1042690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730363.1|1042781_1044752_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002935019.1|1044752_1045505_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.9e-28
>prophage 75
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1051151	1051988	2255345		Streptococcus_phage(100.0%)	1	NA	NA
WP_002935037.1|1051151_1051988_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	52.1	7.3e-79
>prophage 76
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1074530	1087969	2255345		Streptococcus_phage(71.43%)	9	NA	NA
WP_024383728.1|1074530_1075223_+	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	72.5	1.3e-86
WP_024383729.1|1075365_1076781_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	71.8	1.2e-198
WP_024383730.1|1076777_1077128_+	hypothetical protein	NA	M1PLN9	Streptococcus_phage	51.6	4.3e-25
WP_024383731.1|1077114_1077408_+	hypothetical protein	NA	E4ZFJ0	Streptococcus_phage	64.6	6.3e-30
WP_024383732.1|1077454_1078093_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024406080.1|1078089_1085361_-	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	37.4	4.1e-287
WP_050571928.1|1085379_1085751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024406079.1|1085828_1086788_-	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	49.5	7.3e-75
WP_029742340.1|1086784_1087969_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	58.4	1.4e-123
>prophage 77
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1093973	1098042	2255345		Pseudomonas_phage(50.0%)	3	NA	NA
WP_029174920.1|1093973_1095647_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	46.5	7.1e-126
WP_044763791.1|1096175_1097717_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_024383741.1|1097673_1098042_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	50.8	1.3e-24
>prophage 78
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1104402	1107573	2255345	integrase	Bacillus_phage(33.33%)	4	1090063:1090079	1113392:1113408
1090063:1090079	attL	AACATACCAAGTACATT	NA	NA	NA	NA
WP_024383747.1|1104402_1105362_-	hypothetical protein	NA	W8CYV0	Bacillus_phage	39.1	1.1e-25
WP_024409315.1|1105622_1106828_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	28.9	1.3e-12
WP_029743105.1|1106830_1107079_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_003108992.1|1107348_1107573_-	helix-turn-helix transcriptional regulator	NA	A0A142LP08	Marinitoga_camini_virus	41.5	9.8e-07
1113392:1113408	attR	AACATACCAAGTACATT	NA	NA	NA	NA
>prophage 79
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1125356	1127846	2255345	transposase	unidentified_phage(50.0%)	3	NA	NA
WP_024409330.1|1125356_1126301_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.9e-20
WP_024409332.1|1126575_1127370_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_024409333.1|1127369_1127846_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	33.3	1.0e-05
>prophage 80
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1132400	1135761	2255345		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_025310411.1|1132400_1134284_-	recombinase family protein	NA	A0A2H4J3Q1	uncultured_Caudovirales_phage	23.7	1.0e-24
WP_000503424.1|1134337_1134529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659121.1|1134599_1134830_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	48.5	4.2e-13
WP_000743701.1|1134906_1135761_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	30.2	9.9e-07
>prophage 81
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1140434	1153980	2255345		Streptococcus_phage(50.0%)	9	NA	NA
WP_011528024.1|1140434_1140608_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	98.2	1.7e-27
WP_000691759.1|1140659_1142579_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	99.7	0.0e+00
WP_001129922.1|1142945_1143320_-	TnpV protein	NA	D0R0F4	Streptococcus_phage	96.8	6.6e-64
WP_024412117.1|1143259_1143991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024400601.1|1144086_1144377_-	membrane protein	NA	NA	NA	NA	NA
WP_024401832.1|1144390_1144690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024401833.1|1144760_1146104_-	hypothetical protein	NA	H2DE57	Erwinia_phage	32.0	2.8e-56
WP_024402041.1|1146241_1148020_-	reverse transcriptase/maturase family protein	NA	A0A0U4J920	Pseudomonas_phage	28.3	4.4e-25
WP_053338587.1|1148517_1153980_-	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	31.3	8.5e-152
>prophage 82
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1165195	1166869	2255345		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029174920.1|1165195_1166869_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	46.5	7.1e-126
>prophage 83
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1174413	1187733	2255345		Streptococcus_phage(28.57%)	15	NA	NA
WP_053338595.1|1174413_1175769_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	56.3	4.7e-128
WP_053338596.1|1175917_1176736_-	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	35.5	4.9e-11
WP_032499127.1|1176738_1176906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936483.1|1177106_1177472_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002936486.1|1177537_1178032_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_024409355.1|1178608_1180702_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	3.1e-102
WP_009909860.1|1180794_1181637_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	44.3	4.7e-33
WP_009909862.1|1181695_1182253_-	sugar O-acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	38.6	4.9e-07
WP_009909865.1|1182263_1182524_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_002936495.1|1182642_1182966_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002936496.1|1182962_1184615_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.3	6.2e-13
WP_002936497.1|1184722_1185274_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002936498.1|1185263_1185914_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002936500.1|1185946_1186957_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002936501.1|1186953_1187733_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	38.3	4.5e-22
>prophage 84
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1193465	1195796	2255345		Beluga_whale_alphaherpesvirus(33.33%)	3	NA	NA
WP_002936509.1|1193465_1194119_-	uracil-DNA glycosylase	NA	A0A286RUF9	Beluga_whale_alphaherpesvirus	45.4	1.0e-35
WP_024409356.1|1194128_1195055_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.0	2.1e-74
WP_013730367.1|1195163_1195796_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	34.1	4.0e-05
>prophage 85
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1199050	1199962	2255345		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_025310413.1|1199050_1199962_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.6	4.4e-05
>prophage 86
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1214365	1215212	2255345	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_099425904.1|1214365_1215212_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	4.7e-09
>prophage 87
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1223007	1226127	2255345		Planktothrix_phage(50.0%)	3	NA	NA
WP_013730379.1|1223007_1223748_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	4.5e-32
WP_013730380.1|1223803_1224295_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053338599.1|1224594_1226127_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	22.6	6.5e-25
>prophage 88
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1240140	1249261	2255345	integrase	Bacillus_phage(50.0%)	8	1231335:1231348	1249270:1249283
1231335:1231348	attL	TGCTCCAAAGCCTG	NA	NA	NA	NA
WP_002935231.1|1240140_1241172_+|integrase	tyrosine-type recombinase/integrase	integrase	E3W8I1	Leuconostoc_phage	27.3	5.9e-30
WP_002935232.1|1241397_1241940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935233.1|1241959_1242430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935234.1|1242561_1243362_+	helix-turn-helix transcriptional regulator	NA	E8ZD74	Streptococcus_phage	50.9	2.6e-65
WP_013730386.1|1244024_1245185_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_029694144.1|1245419_1245812_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_002935237.1|1245795_1247538_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	3.2e-52
WP_002935238.1|1247524_1249261_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-39
1249270:1249283	attR	TGCTCCAAAGCCTG	NA	NA	NA	NA
>prophage 89
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1253418	1255522	2255345		Tupanvirus(50.0%)	2	NA	NA
WP_009909926.1|1253418_1254396_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.4	3.2e-41
WP_002935247.1|1254406_1255522_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.4	2.2e-30
>prophage 90
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1259088	1272416	2255345	transposase	Bacillus_virus(25.0%)	12	NA	NA
WP_002935255.1|1259088_1261533_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.7	6.6e-104
WP_002935259.1|1261721_1262705_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012028211.1|1262747_1262981_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_162487886.1|1263302_1264595_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_038425739.1|1264637_1265066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935269.1|1265197_1266151_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935270.1|1266152_1267214_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935272.1|1267206_1268742_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	5.7e-21
WP_002935274.1|1268936_1270004_-	BMP family protein	NA	NA	NA	NA	NA
WP_002935275.1|1270084_1270474_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002935276.1|1270460_1271123_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_002935277.1|1271138_1272416_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	53.3	2.5e-115
>prophage 91
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1276153	1282818	2255345	transposase	Bacillus_phage(40.0%)	7	NA	NA
WP_053338600.1|1276153_1277533_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.4	9.1e-10
WP_009909965.1|1277525_1278197_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	2.8e-25
WP_002935294.1|1278390_1278771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086558053.1|1279065_1280358_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_002937611.1|1280559_1281216_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002937614.1|1281244_1282003_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	5.9e-19
WP_002937615.1|1282014_1282818_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.8e-11
>prophage 92
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1288463	1289210	2255345		Streptomyces_phage(100.0%)	1	NA	NA
WP_002937637.1|1288463_1289210_-	potassium channel family protein	NA	A0A2L1IVV9	Streptomyces_phage	34.5	3.9e-07
>prophage 93
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1309103	1309667	2255345		Pneumococcus_phage(100.0%)	1	NA	NA
WP_053338601.1|1309103_1309667_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.2	6.7e-44
>prophage 94
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1316059	1317103	2255345	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_002938060.1|1316059_1317103_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	32.0	2.8e-27
>prophage 95
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1326795	1328595	2255345		Vaccinia_virus(100.0%)	1	NA	NA
WP_002938035.1|1326795_1328595_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	45.3	5.0e-141
>prophage 96
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1340499	1347066	2255345		Catovirus(33.33%)	6	NA	NA
WP_002936023.1|1340499_1341543_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.9	3.2e-15
WP_009910033.1|1341553_1343512_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	35.1	1.4e-96
WP_002936026.1|1343634_1343781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002936027.1|1343782_1344688_+	permease	NA	NA	NA	NA	NA
WP_002936028.1|1344684_1345500_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002936030.1|1345578_1347066_+	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	36.3	5.8e-71
>prophage 97
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1354884	1355571	2255345		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_002936041.1|1354884_1355571_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	31.4	1.9e-24
>prophage 98
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1368564	1372064	2255345		Enterococcus_phage(66.67%)	3	NA	NA
WP_002936054.1|1368564_1368783_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.8	1.7e-11
WP_002936055.1|1368815_1370975_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.5	9.2e-259
WP_002936057.1|1371104_1372064_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.9	1.1e-126
>prophage 99
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1375960	1426570	2255345	tRNA,protease,transposase	Streptococcus_phage(30.0%)	48	NA	NA
WP_002935153.1|1375960_1377163_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_009910073.1|1377455_1380950_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_009910076.1|1381046_1381355_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002936073.1|1381361_1382177_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002936077.1|1382163_1382940_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002936080.1|1382959_1383451_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_002936082.1|1383460_1384651_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_032505201.1|1384662_1385097_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_022540650.1|1385382_1386024_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002936090.1|1386034_1387036_-	sugar kinase	NA	NA	NA	NA	NA
WP_002936092.1|1387052_1387694_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_002936093.1|1387745_1388561_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002936094.1|1389471_1390566_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002936095.1|1390673_1391348_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002936096.1|1391357_1391675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012775187.1|1391684_1392374_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009910094.1|1392399_1392606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730414.1|1392627_1393386_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_009910096.1|1393382_1393598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013730415.1|1393610_1394177_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_002938096.1|1394327_1394522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938097.1|1394725_1395178_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_009910105.1|1395252_1397871_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	1.5e-61
WP_002938099.1|1398150_1398636_-	LURP-one-related family protein	NA	NA	NA	NA	NA
WP_002938100.1|1398901_1399903_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_009910106.1|1399963_1400683_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_002938103.1|1400757_1401306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938105.1|1401321_1401762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910108.1|1401763_1403566_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002938107.1|1403797_1404739_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_074390814.1|1404802_1406860_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.1	5.8e-85
WP_002938116.1|1406959_1407553_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_002938119.1|1407853_1408891_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	34.3	2.2e-45
WP_002938121.1|1408900_1409926_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.2	3.2e-44
WP_002938123.1|1409971_1410841_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002938125.1|1410853_1411921_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002938126.1|1412124_1412925_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	9.0e-10
WP_013730419.1|1412934_1413828_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013730420.1|1413882_1414857_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730421.1|1414880_1415840_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730422.1|1416580_1417582_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013730423.1|1417605_1418751_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002935153.1|1419130_1420333_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_024390310.1|1420881_1421712_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009909533.1|1421738_1422371_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	6.6e-32
WP_013730426.1|1422380_1423022_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013730427.1|1423195_1425007_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	37.6	9.5e-100
WP_013730428.1|1425313_1426570_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.4	7.5e-128
>prophage 100
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1436075	1451086	2255345		Streptomyces_phage(16.67%)	11	NA	NA
WP_009909512.1|1436075_1439186_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	29.3	2.4e-119
WP_002935537.1|1439343_1439718_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002935539.1|1439710_1440418_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	2.1e-18
WP_002935541.1|1440434_1441217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935542.1|1441260_1442262_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002935545.1|1442967_1443561_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	100.0	3.8e-106
WP_002935553.1|1445674_1445998_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_009910370.1|1446382_1447501_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	34.1	7.3e-34
WP_002935556.1|1447503_1449294_-	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	32.7	9.2e-47
WP_002935562.1|1449474_1449840_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_002935565.1|1450072_1451086_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.5	1.6e-91
>prophage 101
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1456375	1458643	2255345		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_009910385.1|1456375_1458643_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.2	2.2e-08
>prophage 102
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1481273	1482818	2255345		Tupanvirus(100.0%)	1	NA	NA
WP_009910410.1|1481273_1482818_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	3.5e-50
>prophage 103
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1489395	1491294	2255345		Tupanvirus(100.0%)	1	NA	NA
WP_002935669.1|1489395_1491294_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.7	7.7e-52
>prophage 104
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1496317	1497076	2255345		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002935681.1|1496317_1497076_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	5.3e-12
>prophage 105
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1510148	1524688	2255345	integrase	Streptococcus_phage(100.0%)	25	1511968:1511984	1521424:1521440
WP_002935693.1|1510148_1510334_+	hypothetical protein	NA	W6LMT3	Streptococcus_phage	68.9	2.3e-17
WP_002935700.1|1510366_1511008_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_009910443.1|1511174_1511435_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	55.8	3.9e-23
WP_012775256.1|1511436_1511658_-	hypothetical protein	NA	A0A1X9I609	Streptococcus_phage	100.0	1.2e-33
1511968:1511984	attL	TTATTTTTTCAAGTTGT	NA	NA	NA	NA
WP_009910447.1|1512764_1512974_-	hypothetical protein	NA	A0A1X9I6N3	Streptococcus_phage	100.0	1.0e-34
WP_009910448.1|1513085_1513538_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1X9I727	Streptococcus_phage	100.0	1.7e-82
WP_009910449.1|1513577_1513760_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5W4	Streptococcus_phage	100.0	3.7e-28
WP_009910450.1|1513943_1514330_-	hypothetical protein	NA	A0A1X9I5X3	Streptococcus_phage	100.0	4.6e-60
WP_024409209.1|1514469_1514970_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	100.0	1.3e-94
WP_024409208.1|1515039_1515480_-	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	100.0	2.0e-75
WP_024409207.1|1515947_1516793_-	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	100.0	2.6e-156
WP_079269917.1|1516808_1517603_-	DnaD domain protein	NA	A0A1X9I617	Streptococcus_phage	100.0	1.3e-149
WP_024409205.1|1517616_1517832_-	hypothetical protein	NA	A0A1X9I5W7	Streptococcus_phage	100.0	2.4e-34
WP_162841287.1|1517836_1517995_-	hypothetical protein	NA	A0A1X9I5Z1	Streptococcus_phage	100.0	3.1e-23
WP_024409204.1|1518005_1518272_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	100.0	5.6e-41
WP_024409203.1|1518282_1518486_-	hypothetical protein	NA	A0A1X9I725	Streptococcus_phage	100.0	2.8e-29
WP_024409202.1|1518478_1518682_-	hypothetical protein	NA	A0A1X9I5V6	Streptococcus_phage	100.0	4.4e-30
WP_024409201.1|1518671_1518947_-	hypothetical protein	NA	A0A1X9I5W5	Streptococcus_phage	100.0	8.0e-43
WP_024409200.1|1519125_1519314_-	hypothetical protein	NA	A0A1X9I5U7	Streptococcus_phage	100.0	7.2e-27
WP_024409199.1|1519471_1520017_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U6	Streptococcus_phage	100.0	9.5e-96
WP_024415669.1|1520100_1521264_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	99.7	9.7e-223
WP_002935704.1|1521423_1522731_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	100.0	8.3e-247
1521424:1521440	attR	TTATTTTTTCAAGTTGT	NA	NA	NA	NA
WP_013730449.1|1522880_1523333_+	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
WP_002935708.1|1523342_1523570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935718.1|1523560_1524688_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	58.0	5.7e-87
>prophage 106
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1527976	1533680	2255345	transposase	Bacillus_virus(50.0%)	4	NA	NA
WP_002939427.1|1527976_1529929_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	2.2e-142
WP_002939430.1|1530110_1530650_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012027447.1|1530663_1531893_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_086558053.1|1532387_1533680_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
>prophage 107
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1543604	1545974	2255345		Mycobacterium_phage(100.0%)	1	NA	NA
WP_009910216.1|1543604_1545974_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	52.0	7.8e-86
>prophage 108
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1553907	1563781	2255345	transposase	Streptococcus_phage(40.0%)	7	NA	NA
WP_002935869.1|1553907_1554711_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.2	9.0e-26
WP_053338620.1|1554841_1556146_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	72.1	3.2e-166
WP_002935863.1|1556445_1557990_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.3	2.2e-36
WP_024409252.1|1558226_1560563_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	23.3	7.3e-36
WP_012775213.1|1560593_1561292_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_002935858.1|1561382_1562744_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002935856.1|1563112_1563781_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	9.1e-32
>prophage 109
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1569259	1579962	2255345	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_002935846.1|1569259_1569715_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	31.9	2.6e-14
WP_009910233.1|1571892_1572696_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.2	4.7e-35
WP_009910235.1|1572702_1574052_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.5	3.6e-35
WP_004298854.1|1574044_1574749_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	1.1e-38
WP_002935839.1|1574942_1575704_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	5.0e-34
WP_002935837.1|1575714_1576554_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013730248.1|1576568_1577267_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009910247.1|1577281_1577941_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009910248.1|1578012_1579962_-|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	34.6	1.8e-67
>prophage 110
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1588609	1603424	2255345	tRNA,transposase	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_002935810.1|1588609_1589752_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	3.5e-84
WP_002935807.1|1590205_1591048_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935805.1|1591342_1591780_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_009910268.1|1591899_1592682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935803.1|1592668_1595305_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.0	1.9e-56
WP_009910275.1|1595380_1596706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935801.1|1596980_1598153_+|transposase	IS110 family transposase	transposase	A0A1X9I5G9	Streptococcus_phage	95.9	2.1e-31
WP_002937337.1|1598551_1599301_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009910507.1|1599290_1599563_+	GIY-YIG nuclease family protein	NA	S5MQN3	Choristoneura_occidentalis_alphabaculovirus	40.0	8.6e-05
WP_002936208.1|1599578_1600190_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002936207.1|1600312_1600720_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002936206.1|1600831_1601434_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_002936205.1|1601420_1601699_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002936204.1|1601843_1603424_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.1	5.8e-61
>prophage 111
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1610913	1615191	2255345	transposase	Streptococcus_phage(50.0%)	5	NA	NA
WP_053338607.1|1610913_1612170_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	1.5e-173
WP_002936699.1|1612225_1612915_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002936700.1|1612923_1613244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936703.1|1613254_1613800_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_009910530.1|1613808_1615191_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	37.8	7.2e-31
>prophage 112
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1620857	1623382	2255345		Planktothrix_phage(33.33%)	3	NA	NA
WP_022540669.1|1620857_1621616_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	5.0e-26
WP_002936726.1|1621713_1622706_-	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.9	7.2e-09
WP_002936735.1|1622698_1623382_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	3.1e-27
>prophage 113
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1628289	1629021	2255345		Bacillus_virus(100.0%)	1	NA	NA
WP_009910543.1|1628289_1629021_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	2.8e-26
>prophage 114
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1643616	1645090	2255345		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002936792.1|1643616_1644459_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.3	1.7e-51
WP_002936797.1|1644574_1645090_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	1.2e-07
>prophage 115
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1650368	1652749	2255345		Staphylococcus_phage(50.0%)	2	NA	NA
WP_013730485.1|1650368_1651559_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.6	2.3e-139
WP_013730486.1|1652281_1652749_-	cytidine/deoxycytidylate deaminase family protein	NA	A7KUY9	Bacillus_phage	60.0	1.8e-34
>prophage 116
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1659049	1664946	2255345		Streptococcus_virus(33.33%)	6	NA	NA
WP_024409360.1|1659049_1660717_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.9	7.0e-49
WP_013730492.1|1660716_1661214_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002940218.1|1661278_1661548_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002936217.1|1662175_1662805_-	uridine kinase	NA	A0A2K9L178	Tupanvirus	38.5	4.5e-33
WP_002936219.1|1662887_1663874_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002936220.1|1663863_1664946_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.3	1.2e-28
>prophage 117
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1672953	1674578	2255345	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_002936184.1|1672953_1674210_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002936247.1|1674302_1674578_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.4	1.1e-23
>prophage 118
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1680943	1686605	2255345		Acanthamoeba_polyphaga_moumouvirus(33.33%)	5	NA	NA
WP_013730498.1|1680943_1682287_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.2	1.1e-36
WP_024409166.1|1682454_1683363_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	33.7	2.0e-34
WP_009910560.1|1683571_1684123_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_053338608.1|1684564_1685953_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002936279.1|1685954_1686605_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	4.7e-33
>prophage 119
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1699307	1703837	2255345		Bacillus_virus(50.0%)	5	NA	NA
WP_004194629.1|1699307_1700087_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.5e-09
WP_004194627.1|1700102_1700657_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	40.8	8.9e-33
WP_004194621.1|1700787_1701432_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_004194619.1|1701539_1703000_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.6	3.2e-98
WP_004194617.1|1703012_1703837_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.4	4.1e-74
>prophage 120
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1708220	1708709	2255345		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002939048.1|1708220_1708709_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.2	1.2e-17
>prophage 121
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1713649	1726486	2255345	tRNA	uncultured_Mediterranean_phage(28.57%)	17	NA	NA
WP_014637121.1|1713649_1714528_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	30.1	1.9e-16
WP_004194743.1|1714782_1715301_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_013730504.1|1715505_1715718_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	55.6	2.1e-11
WP_013730505.1|1715887_1716322_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_013730506.1|1716453_1716876_+	membrane protein	NA	NA	NA	NA	NA
WP_053338609.1|1716865_1718665_+	acyltransferase	NA	C6ZR20	Salmonella_phage	22.7	2.5e-15
WP_002939437.1|1718888_1719542_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_009910581.1|1719566_1720124_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002939238.1|1720447_1720993_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009910583.1|1721560_1721800_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	48.7	2.8e-15
WP_002939235.1|1721799_1722531_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002939233.1|1722520_1723090_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.5	5.0e-15
WP_002939230.1|1723073_1723793_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.9	2.9e-07
WP_002939226.1|1723792_1724524_-	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_002939222.1|1724520_1724979_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002939213.1|1724975_1725503_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002939211.1|1725475_1726486_-	nucleoside-triphosphate diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.5	4.9e-13
>prophage 122
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1739034	1745921	2255345		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_009910597.1|1739034_1742127_-	SNF2 helicase associated domain-containing protein	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.4	6.3e-43
WP_002938333.1|1742266_1742575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938335.1|1742982_1744293_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_009910601.1|1744311_1745025_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002938337.1|1745021_1745921_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.5	2.8e-28
>prophage 123
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1749612	1756046	2255345	transposase	Ostreococcus_lucimarinus_virus(25.0%)	7	NA	NA
WP_002942698.1|1749612_1751040_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.7	3.8e-43
WP_013730515.1|1751136_1751676_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002942687.1|1751685_1752603_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	50.7	1.1e-83
WP_002936682.1|1752616_1752841_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_002936685.1|1752858_1754202_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.1	2.6e-46
WP_014637131.1|1754281_1754545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162489884.1|1754753_1756046_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	2.0e-213
>prophage 124
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1763089	1763936	2255345	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_099425949.1|1763089_1763936_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.1	6.8e-08
>prophage 125
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1782244	1783309	2255345		Planktothrix_phage(100.0%)	1	NA	NA
WP_002939276.1|1782244_1783309_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	1.4e-29
>prophage 126
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1796608	1801462	2255345	tRNA	uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_012775316.1|1796608_1797883_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.6	2.0e-91
WP_009910694.1|1797933_1799523_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.5	2.2e-132
WP_004194690.1|1800793_1801462_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	26.6	2.0e-10
>prophage 127
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1806074	1807001	2255345	integrase	Listeria_phage(100.0%)	1	1793211:1793223	1808503:1808515
1793211:1793223	attL	TCATTATTGCAAG	NA	NA	NA	NA
WP_012028462.1|1806074_1807001_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	46.5	1.9e-75
WP_012028462.1|1806074_1807001_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	46.5	1.9e-75
1808503:1808515	attR	CTTGCAATAATGA	NA	NA	NA	NA
>prophage 128
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1814931	1815666	2255345		Bacillus_phage(100.0%)	1	NA	NA
WP_009910707.1|1814931_1815666_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	39.8	4.5e-08
>prophage 129
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1820735	1821377	2255345		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009910719.1|1820735_1821377_-	HAD family phosphatase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.7	2.6e-07
>prophage 130
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1836036	1842516	2255345		Enterobacteria_phage(33.33%)	6	NA	NA
WP_002938271.1|1836036_1837002_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	4.7e-21
WP_002938276.1|1837080_1837500_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002938280.1|1837489_1837882_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002942436.1|1837909_1838467_-	elongation factor P	NA	NA	NA	NA	NA
WP_013730532.1|1838530_1839592_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	30.6	7.0e-18
WP_024409181.1|1839690_1842516_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	1.4e-304
>prophage 131
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1845633	1850342	2255345		Lactococcus_phage(66.67%)	6	NA	NA
WP_002942409.1|1845633_1846128_-	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	72.5	4.5e-60
WP_002942403.1|1846139_1846430_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_024386694.1|1846601_1847591_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_002937719.1|1847674_1849114_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002937720.1|1849110_1849728_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	43.7	2.9e-32
WP_002937724.1|1849739_1850342_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.2	2.1e-27
>prophage 132
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1860187	1861669	2255345		Pandoravirus(100.0%)	1	NA	NA
WP_013730542.1|1860187_1861669_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	25.2	3.3e-26
>prophage 133
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1877146	1879969	2255345		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_024409178.1|1877146_1879969_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	22.6	2.4e-17
>prophage 134
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1885053	1886264	2255345		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002939204.1|1885053_1885788_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	1.1e-27
WP_002939203.1|1885850_1886264_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	29.7	2.6e-05
>prophage 135
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1891293	1896521	2255345	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_002935153.1|1891293_1892496_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_002938141.1|1892704_1893607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009910775.1|1893620_1894577_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002938145.1|1894578_1895520_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	3.0e-20
WP_009910778.1|1895522_1896521_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.9e-19
>prophage 136
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1902607	1905888	2255345		environmental_halophage(50.0%)	3	NA	NA
WP_024390431.1|1902607_1903831_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.4	7.3e-104
WP_002938159.1|1903835_1905098_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002938165.1|1905114_1905888_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	26.5	2.8e-08
>prophage 137
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1910907	1912971	2255345		Planktothrix_phage(50.0%)	3	NA	NA
WP_009910795.1|1910907_1911651_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	7.3e-30
WP_009910800.1|1911773_1911983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002942264.1|1912068_1912971_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	32.7	7.2e-32
>prophage 138
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1916137	1917841	2255345		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_013730563.1|1916137_1917841_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	3.6e-64
>prophage 139
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1927046	1928480	2255345		Gordonia_phage(100.0%)	1	NA	NA
WP_002937373.1|1927046_1928480_-	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	36.6	6.2e-70
>prophage 140
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1933005	1944739	2255345	transposase	Streptococcus_phage(50.0%)	11	NA	NA
WP_000711078.1|1933005_1933344_-	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	1.7e-10
WP_024394925.1|1933355_1933970_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_024394924.1|1934815_1935634_-	aminoglycoside nucleotidyltransferase ANT(9)	NA	NA	NA	NA	NA
WP_024399350.1|1935706_1936927_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	1.5e-11
WP_019543803.1|1937992_1938487_-	lincosamide nucleotidyltransferase Lnu(C)	NA	A0A2K5B286	Erysipelothrix_phage	54.9	1.0e-48
WP_002837184.1|1938510_1939548_-|transposase	IS1595-like element ISSag10 family transposase	transposase	NA	NA	NA	NA
WP_002321849.1|1939847_1940585_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	100.0	3.7e-135
WP_013641314.1|1940709_1940793_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_053338614.1|1941006_1941960_+|transposase	IS481-like element ISSsu8 family transposase	transposase	NA	NA	NA	NA
WP_002941306.1|1942060_1942231_-	hypothetical protein	NA	A0A1X9I6E4	Streptococcus_phage	100.0	5.7e-23
WP_024383347.1|1943848_1944739_-	cation transporter	NA	A0A1V0SED0	Indivirus	27.0	1.2e-10
>prophage 141
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1949047	1950783	2255345	integrase	Streptococcus_phage(50.0%)	2	1945882:1945894	1956596:1956608
1945882:1945894	attL	AAGTTTGACAAAG	NA	NA	NA	NA
WP_024383343.1|1949047_1949566_+	helix-turn-helix domain-containing protein	NA	W6LMS6	Streptococcus_phage	38.7	9.6e-05
WP_024383342.1|1949619_1950783_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	32.6	1.4e-43
1956596:1956608	attR	AAGTTTGACAAAG	NA	NA	NA	NA
>prophage 142
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1955961	1959792	2255345	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_002938838.1|1955961_1957092_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.6	3.6e-20
WP_002938840.1|1957201_1958056_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002938842.1|1958057_1958456_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_009910838.1|1958448_1959792_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	35.8	8.5e-53
>prophage 143
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1964486	1975453	2255345	transposase	Staphylococcus_phage(25.0%)	11	NA	NA
WP_002938850.1|1964486_1965128_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.1	2.7e-33
WP_002938851.1|1965120_1965852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938853.1|1966615_1967380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730575.1|1967464_1967875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938352.1|1968108_1969386_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.7	3.0e-60
WP_002938355.1|1969808_1970318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099425909.1|1970729_1972081_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	9.7e-65
WP_002938364.1|1972163_1972892_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_009910851.1|1972882_1973332_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053338616.1|1973545_1974709_-	MFS transporter	NA	NA	NA	NA	NA
WP_013730579.1|1974838_1975453_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.5	7.9e-14
>prophage 144
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1979531	1981094	2255345		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_009910861.1|1979531_1981094_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.9	3.9e-09
>prophage 145
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1989043	1993435	2255345		Clostridium_phage(100.0%)	1	NA	NA
WP_009910865.1|1989043_1993435_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.2	1.3e-17
>prophage 146
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	1997207	1997918	2255345		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002938756.1|1997207_1997918_+	aquaporin family protein	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	34.9	1.0e-28
>prophage 147
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2002486	2005081	2255345		Flavobacterium_phage(50.0%)	3	NA	NA
WP_013730586.1|2002486_2003242_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.3	2.8e-21
WP_013730587.1|2003355_2003679_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002937782.1|2003788_2005081_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	2.8e-69
>prophage 148
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2013396	2016459	2255345	protease	Lactobacillus_phage(50.0%)	2	NA	NA
WP_009910880.1|2013396_2013888_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A291I9M1	Lactobacillus_phage	38.8	1.9e-23
WP_009910884.1|2014005_2016459_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.1	2.2e-123
>prophage 149
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2019836	2021129	2255345	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_086558053.1|2019836_2021129_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
>prophage 150
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2030163	2034519	2255345		Bacillus_virus(50.0%)	5	NA	NA
WP_002940254.1|2030163_2030703_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	28.2	3.5e-10
WP_002940255.1|2030812_2030989_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_053338617.1|2030998_2031151_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_009910891.1|2031184_2033398_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_013730595.1|2033550_2034519_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	68.5	9.4e-46
>prophage 151
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2051855	2056256	2255345		Mycobacterium_phage(100.0%)	1	NA	NA
WP_053338619.1|2051855_2056256_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.5	1.9e-37
>prophage 152
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2062054	2062867	2255345		Klosneuvirus(100.0%)	1	NA	NA
WP_002938438.1|2062054_2062867_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	24.7	1.4e-05
>prophage 153
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2068651	2070229	2255345		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_024390464.1|2068651_2070229_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.8	8.5e-20
>prophage 154
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2095189	2112025	2255345	integrase	Streptococcus_phage(66.67%)	19	2087435:2087449	2098337:2098351
2087435:2087449	attL	TGTTTTTAAAAAGCT	NA	NA	NA	NA
WP_004298354.1|2095189_2095633_-	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	48.0	1.3e-31
WP_044666645.1|2095730_2096876_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	50.5	4.0e-96
WP_013730692.1|2097046_2097877_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	62.1	1.2e-89
WP_044674473.1|2098239_2098824_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	43.0	1.7e-21
2098337:2098351	attR	AGCTTTTTAAAAACA	NA	NA	NA	NA
WP_044666638.1|2099030_2099231_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_044674475.1|2099727_2100156_+	hypothetical protein	NA	A0A1X9I5T7	Streptococcus_phage	96.5	8.0e-74
WP_044686673.1|2100363_2100549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044674480.1|2100545_2100881_+	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	88.9	4.9e-42
WP_044674482.1|2100873_2101155_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	76.4	1.3e-32
WP_044674484.1|2101141_2101960_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A2I6QQV2	Streptococcus_phage	55.0	3.1e-50
WP_024417153.1|2101974_2102835_+	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	57.1	5.4e-85
WP_024417152.1|2102831_2103290_+	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	41.7	7.6e-22
WP_024417151.1|2103349_2103751_+	hypothetical protein	NA	A0A1X9I622	Streptococcus_phage	70.8	4.2e-48
WP_024417149.1|2104696_2105128_+	DUF1492 domain-containing protein	NA	A0A1S5SFS8	Streptococcus_phage	29.0	5.9e-08
WP_004298352.1|2105908_2107693_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	4.4e-41
WP_004298350.1|2107693_2109400_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	4.4e-38
WP_004298348.1|2109392_2109842_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004298347.1|2110063_2111080_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004298345.1|2111125_2112025_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	1.6e-76
>prophage 155
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2116128	2116857	2255345		Enterococcus_phage(100.0%)	1	NA	NA
WP_013730636.1|2116128_2116857_-	serine/threonine protein phosphatase	NA	A0A0C5JZB3	Enterococcus_phage	32.1	2.3e-28
>prophage 156
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2138597	2139344	2255345		Planktothrix_phage(100.0%)	1	NA	NA
WP_013730643.1|2138597_2139344_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	2.6e-35
>prophage 157
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2150669	2157677	2255345	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_014637219.1|2150669_2153171_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	64.9	0.0e+00
WP_013730646.1|2153273_2155166_-	endopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	8.2e-70
WP_013730647.1|2155221_2156061_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_013730648.1|2156053_2156914_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_009910969.1|2156906_2157677_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	5.4e-12
>prophage 158
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2161060	2163262	2255345		Orpheovirus(100.0%)	1	NA	NA
WP_024409262.1|2161060_2163262_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.5	1.1e-09
>prophage 159
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2172130	2179933	2255345		Enterococcus_phage(50.0%)	6	NA	NA
WP_002939120.1|2172130_2173417_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	44.7	1.0e-92
WP_002939123.1|2173897_2174455_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	57.8	6.0e-53
WP_002939125.1|2174641_2175136_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009910991.1|2175137_2176484_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002939131.1|2176712_2178884_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.5	1.7e-281
WP_013730659.1|2179189_2179933_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.5e-30
>prophage 160
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2183031	2188916	2255345	tRNA	Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_009910996.1|2183031_2185572_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	1.1e-37
WP_002937036.1|2185586_2186027_-	arginine repressor	NA	NA	NA	NA	NA
WP_009910998.1|2186133_2187822_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	2.1e-77
WP_009911000.1|2188001_2188916_+	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	44.3	1.2e-05
>prophage 161
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2196112	2197096	2255345		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002936122.1|2196112_2197096_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	4.1e-12
>prophage 162
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2200778	2202530	2255345	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_002936129.1|2200778_2202530_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	26.1	2.9e-13
>prophage 163
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2206694	2211293	2255345		Lactobacillus_phage(50.0%)	5	NA	NA
WP_013730672.1|2206694_2208212_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.3	8.1e-52
WP_002936148.1|2208344_2208794_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_002938227.1|2208860_2209472_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002938218.1|2209682_2209934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938217.1|2209937_2211293_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	59.0	2.0e-142
>prophage 164
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2220607	2248679	2255345	tRNA,integrase,transposase	Streptococcus_phage(59.09%)	31	2228639:2228698	2241395:2243022
WP_009911037.1|2220607_2221162_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	48.8	1.0e-28
WP_002938197.1|2221293_2222088_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_009911039.1|2222080_2222923_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	8.3e-14
WP_002938187.1|2222898_2223735_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_013730677.1|2223731_2224271_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002939074.1|2224280_2225138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002939071.1|2225219_2226503_-	insulinase family protein	NA	NA	NA	NA	NA
WP_009911054.1|2226499_2227753_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	99.0	4.2e-232
WP_024381289.1|2228170_2228512_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
2228639:2228698	attL	TTTTCTACTATTTGTCAAGTCCATCAAGGTATTTGACGAAAAATATTTTGAGTTCAATAG	NA	NA	NA	NA
WP_086558053.1|2228817_2230110_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_013730680.1|2230798_2231347_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	58.1	4.7e-50
WP_013730681.1|2231424_2231883_-	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	42.0	7.6e-22
WP_013730682.1|2231895_2232711_-	DnaD domain protein	NA	A0A2I6QQV2	Streptococcus_phage	66.0	2.0e-81
WP_013730683.1|2232697_2232982_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	83.9	8.9e-37
WP_024409270.1|2232971_2233310_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	97.8	5.1e-47
WP_013730685.1|2233306_2233456_-	hypothetical protein	NA	A0A1X9I6A8	Streptococcus_phage	89.8	2.4e-17
WP_013730686.1|2233467_2233671_-	hypothetical protein	NA	A0A1X9I5T6	Streptococcus_phage	79.1	7.2e-25
WP_013730687.1|2233658_2234048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730688.1|2234486_2235113_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	32.8	9.5e-15
WP_013730689.1|2235125_2235872_-	Bro-N domain-containing protein	NA	A0A0A7RW33	Clostridium_phage	50.7	2.1e-24
WP_013730690.1|2235890_2236118_-	helix-turn-helix transcriptional regulator	NA	Q38329	Lactococcus_phage	51.6	2.8e-09
WP_013730691.1|2236271_2236985_+	helix-turn-helix transcriptional regulator	NA	Q708R9	Streptococcus_phage	50.6	3.7e-15
WP_013730692.1|2237348_2238179_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	62.1	1.2e-89
WP_013730693.1|2238343_2239516_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	96.9	3.1e-216
WP_002936175.1|2239653_2240037_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	94.5	4.6e-36
WP_002936177.1|2240039_2241134_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_086558053.1|2241573_2242866_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_014637236.1|2243026_2244508_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	3.6e-97
2241395:2243022	attR	TTTTCTACTATTTGTCAAGTCCATCAAGGTATTTGACGAAAAATATTTTGAGTTCAATAGTCAAAATAAGGAAATTGTTTTATTTTGGACTAAAGTTTAGTGTAAAAAGTGCATACAAAACCAACACCTTATGTTGAAATTTTTTGATAAGGTGTTACAATGATAGAGCATAAACAGTTTTACCGATTTTGGGTTGAAGCGTAATCGTAAAGTTTGTTATGCATAATGAGGTAATACATTGTCCGAATGAGACGATGTATGGAGGCAATCGTGTGCGGCTTGGTTGAAGTCGTTTGCGATTGTCTTTTTCGTTTCTCATAAAAGTCTGCGATATGGCAAGGATTGGTATGACTAGCTGAAGCGATATTGTGGATACACTTGAACAGAATCTTTCTAGCGTAGGGATTACCACGCTTGGTAATGTGTTCCTTAGCGAGGAAGTTACCAGATTCATAGTGTCTCAGGTCAATACCGATAAAGGCATTGATTTGATTGGCTGACTGAAAACGGCGAATATCTCCCAGTTCACCAATAATACTTGTTGCAGTAGTCTCAGCTATTCCAGGAATAGAGAGCAGAATGTCATATTCAGGTAATGGCTGAGCTAGTTCCACCATTTCGTCTAGGATAGTTTGTCTCTGTTCAGAAAGCCGAAACAATTCTTTTGCATAGTAACGGACCTCTTCCAGCATTGGAGAGGTTTTCTTGACAGCACAATACGATTGATTAGCTAGTGCTATCAACTTCTCAGCTAAATACGCCACACGCTTGTCCGAAATACGTTTTGAGGTGGACTGACGAATGCTCTCTGAGAGTTCGTCCTTGCTTAAATCAAGCACGAAGTCCTTGCAAGGAAAAGCTATAACTAAGTTCCAGTATTGTTCGCCAGATGGTGTTGATAAGATATTTTCCAATTCAGGAAAAGTGACCTGTAAGGCCTTGTGCAGGCGGTTTTTAGCTCGAACGATGTCCTCGGTCAGATTCTGATAGAAACGGCTGAGATCCCGCAAGTTTTGGTAGATTTCTTCTTGGACATACGTCGTTTTACGATTCAGTACAAACTGAGATTGAGCTAGTTTTTCGGCGTCAATTTGATCTGTTTTTCTCACACGCAAGCTATCCAGTTGCTTCTTGGCTTCTAAGGGATTGAGTCGTGTATAAGCGTAGCCATGTTCATCCAGAAAAGATTGAAGACGACGAGAATAGACGCCTGTTGCTTCAAAGATGATTTCTGGCTTGTGGACGGTTTTCAAATCGCCAAGTAGCCGAGAAAAGCCAATGGCATCATTGGACATGGTGTAGTTATGAACCTTCTCGCCGTTGACTAGAATGGCTACTTCTGAACTTACTTTACTCACGTCAATCCCAAATACTACTCGCATGATATTACCTCTTTGTCTTGAATGATTCCTTGTTTTAGTGATGTCATTTTCAATACTCGACGTCTGGCGTCCCACATACTTTGATAACATTCTTTCTAAAACAGGTGTCTTGCCAGTTTTTGTTGCGACGTCTAGCGTCAAAAAGCCCTACGACTTAACAAGACACCTCTACTTTATCATAAAGAAAAAGTAGTGAGTACTTTCTCCCGTCGGAGATTTCCTCACTACTAATCTTAGTATGTTTTT	NA	NA	NA	NA
WP_013730696.1|2244739_2245765_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013730698.1|2246119_2246992_+	YitT family protein	NA	NA	NA	NA	NA
WP_004194522.1|2247056_2248679_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.0	2.0e-48
>prophage 165
NZ_CP011419	Streptococcus suis strain NSUI002 chromosome, complete genome	2255345	2253326	2254523	2255345		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_009911075.1|2253326_2254523_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	8.7e-17
