The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	419613	426974	3156839		Lactobacillus_phage(83.33%)	7	NA	NA
WP_003643099.1|419613_420561_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|420904_421519_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_053338837.1|421521_423960_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.3	0.0e+00
WP_003643095.1|424047_424608_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_011101401.1|424678_425119_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|425214_425352_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|425978_426974_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 2
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	932071	1020061	3156839	protease,tRNA,capsid,terminase,portal,integrase,head,tail	Lactobacillus_phage(69.57%)	92	957654:957671	1026995:1027012
WP_027821256.1|932071_932995_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_027821257.1|933479_934001_-	shikimate kinase	NA	NA	NA	NA	NA
WP_015825650.1|934003_935101_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015825651.1|935103_936402_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027821258.1|936415_936943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355607.1|936951_938121_-	chorismate synthase	NA	NA	NA	NA	NA
WP_003645963.1|938113_939568_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|940216_940570_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003645962.1|940592_943169_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|943183_943489_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|943478_943778_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|943822_945040_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|945060_945537_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|945832_950146_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|950639_952349_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|952388_953666_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|953703_954489_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|954504_955284_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|955403_955967_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|955968_956691_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|956891_957770_-	elongation factor Ts	NA	NA	NA	NA	NA
957654:957671	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_003640739.1|957872_958676_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|958900_959623_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|961682_962681_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640742.1|962765_963071_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_053338917.1|963054_963813_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645630.1|963924_964560_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|964616_964853_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|964950_965190_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|965341_965974_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089178220.1|966063_966294_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_053338918.1|966597_967227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338919.1|967276_968446_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|968481_968874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644503.1|969037_969430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338920.1|969875_970817_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	5.3e-78
WP_053338921.1|971568_972141_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088899822.1|972292_973477_-	LCP family protein	NA	NA	NA	NA	NA
WP_088899823.1|973457_974249_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644508.1|976487_977699_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_016058344.1|978939_979470_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
WP_003644510.1|979482_979746_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_053338925.1|979745_980918_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	97.9	1.5e-210
WP_164886062.1|981679_981841_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	2.3e-18
WP_053338926.1|981853_982096_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.0	9.5e-32
WP_053338927.1|982088_984878_-	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	78.8	1.5e-261
WP_088899824.1|984895_987265_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	93.2	0.0e+00
WP_053338929.1|987330_989100_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	92.3	0.0e+00
WP_053338930.1|989172_994578_-|tail	phage tail tape measure protein	tail	A0A2H4PBB0	Lactobacillus_phage	37.1	5.7e-116
WP_027822832.1|994605_994815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822831.1|994832_995213_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	41.2	1.8e-13
WP_053338931.1|995285_995939_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	66.2	7.0e-69
WP_053338932.1|995953_996328_-	DUF806 family protein	NA	Q94MA5	Lactococcus_phage	39.7	1.1e-15
WP_027822828.1|996329_996716_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	38.3	2.6e-15
WP_027822827.1|996721_997063_-|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	39.6	3.7e-13
WP_027822826.1|997025_997388_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	53.2	5.5e-23
WP_053338933.1|997521_998664_-|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	61.1	1.7e-118
WP_157696019.1|998666_999392_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q6J1Y3	Lactobacillus_phage	62.1	9.8e-72
WP_053338935.1|999351_1000500_-|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	65.7	6.2e-145
WP_088899825.1|1000503_1000692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338937.1|1000708_1002595_-|terminase	terminase large subunit	terminase	Q6J1Y6	Lactobacillus_phage	70.2	1.5e-268
WP_053338938.1|1002581_1003049_-|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	49.3	9.2e-39
WP_053338939.1|1003446_1003959_-	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	54.4	4.1e-48
WP_080372337.1|1004019_1004184_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	59.3	6.5e-08
WP_053338940.1|1004386_1004938_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.3	2.7e-21
WP_053338941.1|1005470_1005899_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	85.8	1.4e-65
WP_080372338.1|1005879_1006050_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	89.3	1.9e-18
WP_053338942.1|1006164_1006593_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	66.7	4.3e-51
WP_053338943.1|1006589_1006955_-	hypothetical protein	NA	A0A291I9N7	Lactobacillus_phage	69.3	3.1e-42
WP_053338944.1|1006951_1007299_-	hypothetical protein	NA	O03921	Lactobacillus_phage	93.8	1.4e-55
WP_022638754.1|1007379_1007538_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_053338945.1|1007530_1007839_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	94.1	8.4e-49
WP_053338946.1|1007974_1008760_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	99.2	1.1e-145
WP_053338947.1|1009628_1009886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187331851.1|1009885_1010056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641371.1|1010235_1010436_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_003641370.1|1010438_1010687_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	76.1	2.7e-29
WP_003641369.1|1010699_1010903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003641368.1|1011068_1011359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338948.1|1011952_1012213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338949.1|1012271_1012517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154813462.1|1012503_1012659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339257.1|1012672_1012882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080372369.1|1012893_1013637_-	ORF6C domain-containing protein	NA	A0A1P8BLG8	Lactococcus_phage	46.1	2.2e-50
WP_053338950.1|1013647_1013869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033609542.1|1014665_1015004_+	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	45.1	9.3e-17
WP_015380505.1|1015013_1015292_+	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	59.3	1.3e-21
WP_053338951.1|1015349_1015736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380507.1|1015744_1016443_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	36.8	2.1e-18
WP_053338952.1|1016624_1016825_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	97.0	2.5e-25
WP_064972032.1|1018042_1018681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338955.1|1018897_1020061_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
1026995:1027012	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	1309342	1372237	3156839	holin,capsid,head,terminase,integrase,portal,tail	Lactobacillus_phage(68.63%)	77	1358575:1358596	1372415:1372436
WP_053338992.1|1309342_1311073_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641420.1|1311300_1311693_-	YxeA family protein	NA	NA	NA	NA	NA
WP_053338993.1|1313417_1314296_+	Abi family protein	NA	M1PS09	Streptococcus_phage	21.9	7.8e-07
WP_080372339.1|1314347_1314578_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	64.6	4.0e-11
WP_053338994.1|1314791_1315166_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	66.2	1.5e-15
WP_053338995.1|1315152_1315449_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	1.7e-38
WP_053339288.1|1315449_1316565_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	65.7	1.9e-45
WP_053338996.1|1316627_1316873_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	69.2	1.4e-17
WP_053338997.1|1316869_1317988_-	hypothetical protein	NA	A0A286QPL6	Streptococcus_phage	50.0	1.9e-45
WP_080372341.1|1318002_1318149_-	XkdX family protein	NA	NA	NA	NA	NA
WP_053338998.1|1318145_1318466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338999.1|1318477_1319221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339000.1|1319234_1321076_-	metallophosphoesterase	NA	A0A2P0ZKZ2	Lactobacillus_phage	54.2	8.1e-139
WP_053339001.1|1321076_1321388_-	hypothetical protein	NA	O03939	Lactobacillus_phage	86.8	2.0e-10
WP_080372342.1|1321365_1321659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339003.1|1321651_1322770_-|tail	phage tail protein	tail	O03938	Lactobacillus_phage	90.9	9.8e-188
WP_053339004.1|1322782_1323592_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	41.9	2.5e-52
WP_053339005.1|1323591_1328487_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	63.3	0.0e+00
WP_053339006.1|1328490_1329114_-	hypothetical protein	NA	O03936	Lactobacillus_phage	96.5	4.1e-103
WP_053339007.1|1329119_1329551_-	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	5.2e-73
WP_053339008.1|1329602_1330118_-	hypothetical protein	NA	O03972	Lactobacillus_phage	96.3	3.5e-84
WP_053339009.1|1330150_1330555_-	hypothetical protein	NA	O03934	Lactobacillus_phage	96.3	9.0e-67
WP_053339010.1|1330554_1330902_-|capsid	minor capsid protein	capsid	O03933	Lactobacillus_phage	83.9	1.8e-47
WP_053339011.1|1330901_1331255_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	91.5	1.4e-55
WP_053339012.1|1331251_1331680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339013.1|1331706_1332762_-	hypothetical protein	NA	O03966	Lactobacillus_phage	99.1	9.8e-198
WP_088899828.1|1332778_1333393_-	phage scaffolding protein	NA	O03931	Lactobacillus_phage	92.2	1.4e-66
WP_053339015.1|1333494_1334637_-|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	94.0	5.5e-170
WP_053339016.1|1334633_1336160_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	82.7	2.0e-247
WP_053339017.1|1336168_1337512_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	96.9	1.2e-261
WP_088899829.1|1337492_1338011_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	81.4	5.2e-67
WP_053339019.1|1338069_1338390_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	48.1	9.4e-19
WP_053339020.1|1338613_1338877_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	60.9	8.0e-24
WP_053339021.1|1338996_1339197_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.0	5.1e-07
WP_053339022.1|1339271_1340372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339023.1|1341345_1341795_-	hypothetical protein	NA	B8R690	Lactobacillus_phage	37.0	2.4e-12
WP_053339289.1|1342150_1342384_-	hypothetical protein	NA	E9LUP1	Lactobacillus_phage	85.0	2.7e-23
WP_053339024.1|1342470_1342701_-	hypothetical protein	NA	O03916	Lactobacillus_phage	56.6	2.7e-20
WP_053339025.1|1342700_1343135_-	hypothetical protein	NA	A0A288TZS1	Enterococcus_phage	48.8	1.2e-29
WP_053339026.1|1343131_1343509_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_053339027.1|1343505_1344024_-	hypothetical protein	NA	O03915	Lactobacillus_phage	53.9	5.4e-40
WP_033611991.1|1344020_1344308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339028.1|1344304_1345213_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_187338150.1|1345293_1346046_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.4	5.6e-70
WP_053339030.1|1346077_1346977_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.4	6.7e-62
WP_080372344.1|1346973_1347360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339032.1|1347843_1348356_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	45.3	6.5e-30
WP_053339033.1|1348422_1348728_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_080372345.1|1348739_1348910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101083.1|1348922_1349153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101082.1|1349325_1349688_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_003642784.1|1349699_1350113_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_053339034.1|1350138_1351485_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	52.7	3.9e-82
WP_071242850.1|1351534_1352068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161324305.1|1353069_1353774_+	Ltp family lipoprotein	NA	V9QJ01	Oenococcus_phage	41.0	3.0e-09
WP_003642778.1|1354047_1354224_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_053339035.1|1354409_1355375_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	34.5	1.8e-28
WP_053339036.1|1355367_1355805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339037.1|1355807_1356491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339038.1|1356588_1357710_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	2.9e-46
WP_003642774.1|1358061_1358268_-	hypothetical protein	NA	NA	NA	NA	NA
1358575:1358596	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_045353068.1|1359073_1359445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339040.1|1359600_1359870_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_053339041.1|1360277_1361858_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.5	1.6e-39
WP_053339042.1|1361847_1362954_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.9	1.1e-50
WP_033611503.1|1362954_1363155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339043.1|1363108_1364812_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	4.9e-122
WP_053339044.1|1364808_1365282_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_080372346.1|1366184_1366574_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	6.7e-19
WP_053339045.1|1366566_1366905_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.2e-08
WP_053339046.1|1366891_1367083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339047.1|1367241_1368636_-	virulence protein	NA	D2J048	Enterococcus_phage	35.7	2.5e-68
WP_053339048.1|1368635_1369436_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_053339049.1|1369432_1369687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339050.1|1370124_1370328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339051.1|1370460_1371027_+	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	47.5	1.9e-06
WP_053339052.1|1371079_1372237_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	1.0e-54
1372415:1372436	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 4
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	1566401	1574912	3156839		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|1566401_1566980_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_027821845.1|1566972_1567998_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	9.3e-60
WP_003642591.1|1567994_1569449_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_021356102.1|1569433_1571653_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_011101895.1|1571645_1572326_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|1572325_1572580_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_021356104.1|1572581_1573313_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_053339078.1|1573315_1574446_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|1574429_1574912_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 5
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	2674501	2727413	3156839	protease,bacteriocin	Bacillus_virus(33.33%)	51	NA	NA
WP_053339232.1|2674501_2675065_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_016511451.1|2675258_2675927_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_027821520.1|2676084_2677590_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|2677854_2678223_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|2678335_2678845_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_024521227.1|2678875_2680072_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|2680181_2680652_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100976.1|2680670_2681126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821518.1|2681229_2681802_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_011100977.1|2681967_2682888_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003643768.1|2683024_2683936_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003641939.1|2684823_2685270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641940.1|2685507_2687034_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_027821516.1|2687034_2688006_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_024971425.1|2688083_2689415_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053339233.1|2689880_2691398_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_053339234.1|2691412_2693242_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_080372359.1|2693256_2693979_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.5	1.6e-29
WP_053339236.1|2694565_2698249_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_162993148.1|2699680_2700028_+	hemagglutinin	NA	NA	NA	NA	NA
WP_053339301.1|2700058_2700574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339237.1|2700691_2700970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339238.1|2701108_2701354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157485085.1|2701395_2701620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339239.1|2701748_2702141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339240.1|2703768_2704032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|2704148_2704352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339241.1|2704476_2704716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|2704733_2705120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088899880.1|2705569_2705761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339242.1|2706152_2706428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|2706971_2707391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821509.1|2707682_2708147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821508.1|2708482_2709100_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_053339243.1|2709103_2710258_-	MFS transporter	NA	NA	NA	NA	NA
WP_088899881.1|2710261_2711053_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003643797.1|2711123_2711996_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|2712155_2712971_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_027821507.1|2713496_2714873_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|2714917_2716102_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_027821506.1|2716665_2716845_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_027821505.1|2717775_2718444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153302738.1|2719036_2719204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088899883.1|2719221_2720562_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015825122.1|2720562_2721306_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027821503.1|2721599_2722373_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|2722471_2722630_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|2722654_2722825_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_027821502.1|2723090_2725241_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_053339245.1|2725257_2726634_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_053339246.1|2726723_2727413_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP016270	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome	3156839	2925059	2933684	3156839		Streptococcus_phage(66.67%)	11	NA	NA
WP_053338710.1|2925059_2926757_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.0e-55
WP_003640956.1|2926778_2927087_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|2927102_2927702_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|2927716_2927968_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|2928366_2929032_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|2929028_2929358_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|2929374_2930394_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|2930418_2930766_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_053338711.1|2930864_2931761_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.7e-81
WP_053338712.1|2931764_2932550_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_053338713.1|2932688_2933684_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
>prophage 1
NZ_CP016271	Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence	67395	6567	62667	67395	integrase,transposase	Staphylococcus_phage(25.0%)	53	33397:33418	57721:57742
WP_088899809.1|6567_7367_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024002725.1|7741_8587_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_027822949.1|8623_8953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187338152.1|9144_9483_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_187338153.1|9469_12316_+	MucBP domain-containing protein	NA	F8WPR5	Bacillus_phage	26.7	6.4e-34
WP_027822610.1|12666_13329_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_027822611.1|13464_13749_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_053339260.1|13770_14694_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.5	1.8e-78
WP_053339259.1|14709_15360_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_027822614.1|15514_15829_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	32.7	2.8e-15
WP_027822615.1|15850_17188_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.2e-19
WP_027822616.1|17693_18056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822617.1|18082_18523_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010495033.1|18659_19097_+	OsmC family protein	NA	NA	NA	NA	NA
WP_111443464.1|19114_19531_+	OsmC family protein	NA	NA	NA	NA	NA
WP_027822817.1|19913_20945_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.4	2.3e-42
WP_027822898.1|21573_21897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822897.1|21969_22368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822896.1|22360_22681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822895.1|22673_23975_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	6.4e-82
WP_027822894.1|24088_24400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526748.1|24637_24907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822893.1|24893_25796_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	32.1	4.1e-27
WP_027822892.1|26655_28188_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_088899809.1|28832_29632_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027822890.1|30704_30983_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_010625626.1|30972_31275_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_027822859.1|31619_31919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063546.1|31911_32190_-	DUF2089 family protein	NA	NA	NA	NA	NA
WP_085844568.1|32385_33315_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
33397:33418	attL	TTAATTTTACAATCTACCATAT	NA	NA	NA	NA
WP_088899894.1|34168_34956_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_053339277.1|35576_38381_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.6	2.0e-72
WP_053339276.1|38440_38704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822857.1|38739_39207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162838578.1|39433_39586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339275.1|39569_40739_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001748276.1|42391_42661_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001748275.1|42647_43019_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_072558124.1|43070_43658_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.3	3.7e-21
WP_003586674.1|43734_44013_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_053339273.1|44609_45785_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	3.1e-27
WP_053339272.1|46244_46586_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_053339271.1|47024_50303_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	27.8	8.7e-27
WP_053339270.1|50323_51697_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	30.7	6.2e-27
WP_053339269.1|51797_52691_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053339268.1|52710_53085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053339267.1|53450_54041_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.3	7.5e-22
WP_080372366.1|54386_56720_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_042253884.1|57868_58336_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
57721:57742	attR	TTAATTTTACAATCTACCATAT	NA	NA	NA	NA
WP_027822873.1|58582_59326_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.2e-27
WP_088899895.1|59303_60551_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027822875.1|60555_61227_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027823042.1|61983_62667_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	53.3	1.6e-60
