The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	0	2882	1791401		Rhizobium_phage(100.0%)	2	NA	NA
WP_002987659.1|235_1591_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011184038.1|1745_2882_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	24.9	9.1e-24
>prophage 2
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	10952	14787	1791401	tRNA,protease	Phaeocystis_globosa_virus(50.0%)	3	NA	NA
WP_014635209.1|10952_12239_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.5	1.0e-15
WP_002981912.1|12243_12786_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014635211.1|12807_14787_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	47.2	8.8e-107
>prophage 3
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	30166	58014	1791401	transposase	Synechococcus_phage(23.08%)	22	NA	NA
WP_109821002.1|30166_30448_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	44.3	1.3e-08
WP_002996017.1|31194_32391_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_002986722.1|32643_33606_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	8.2e-42
WP_030127030.1|33791_34547_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002987696.1|34649_35657_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002993445.1|35649_35892_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080277862.1|36012_36747_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.1	1.8e-44
WP_032463114.1|36870_40596_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	9.2e-41
WP_023080049.1|40756_42211_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.7e-54
WP_032463116.1|42238_43261_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	4.0e-63
WP_009880321.1|43428_43983_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
WP_032463117.1|44166_45714_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002986694.1|45772_46897_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_032463118.1|47149_48415_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_032463145.1|48693_49185_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	8.5e-19
WP_080277864.1|49135_50245_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_030127622.1|51683_52976_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.1e-17
WP_002986681.1|53107_54019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011054100.1|54244_55243_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	8.0e-08
WP_002994668.1|55380_55818_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011017240.1|55840_56242_+	membrane protein	NA	NA	NA	NA	NA
WP_002986669.1|56238_58014_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.5	1.4e-18
>prophage 4
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	61218	62235	1791401		Tupanvirus(100.0%)	1	NA	NA
WP_020833189.1|61218_62235_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.9	1.1e-25
>prophage 5
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	88060	101266	1791401	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_002986585.1|88060_88780_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_002987764.1|88772_89588_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014635225.1|89627_90011_-	HIT family protein	NA	NA	NA	NA	NA
WP_021733278.1|90061_91318_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.8	3.4e-72
WP_002987769.1|91409_93722_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002993467.1|93985_97552_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.0	1.2e-50
WP_011527438.1|97642_101266_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	1.6e-66
>prophage 6
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	108375	113415	1791401	tRNA	Streptococcus_phage(66.67%)	8	NA	NA
WP_002992745.1|108375_109146_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.0	8.0e-32
WP_002992747.1|109193_110261_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002986521.1|110370_110535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992749.1|110725_111010_+	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
WP_002992751.1|111006_111324_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002986511.1|111341_111968_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_002987809.1|112118_112514_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	47.0	5.8e-26
WP_002986504.1|112773_113415_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	49.5	2.4e-53
>prophage 7
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	145194	150448	1791401		Streptococcus_phage(50.0%)	4	NA	NA
WP_032463133.1|145194_146457_-	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	68.1	5.0e-148
WP_014635244.1|146469_147348_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	40.2	1.7e-25
WP_002986406.1|147785_149078_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.5	1.9e-70
WP_080277865.1|149419_150448_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	40.5	2.2e-61
>prophage 8
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	156991	160844	1791401	tRNA	Pandoravirus(50.0%)	2	NA	NA
WP_011017287.1|156991_158131_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	29.5	4.4e-18
WP_023080211.1|158342_160844_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.7	0.0e+00
>prophage 9
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	169671	178871	1791401	tRNA	Bacillus_virus(33.33%)	8	NA	NA
WP_002986345.1|169671_170868_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	4.0e-30
WP_014635250.1|170883_172611_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_030126939.1|172741_175384_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	1.5e-64
WP_002986334.1|175570_176026_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|176077_176545_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_032463137.1|176646_177510_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986321.1|177546_177732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528208.1|177728_178871_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	3.8e-86
>prophage 10
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	189446	197069	1791401		Bacillus_phage(75.0%)	7	NA	NA
WP_002986125.1|189446_190346_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_011284483.1|190378_191395_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002986120.1|191692_192142_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020904881.1|192134_193841_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-36
WP_002986115.1|193843_195628_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.3e-44
WP_002986113.1|195745_196513_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002986111.1|196622_197069_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	52.8	4.5e-35
>prophage 11
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	200219	201665	1791401	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_002993289.1|200219_201665_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	6.8e-08
>prophage 12
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	224007	224847	1791401		Streptococcus_phage(100.0%)	1	NA	NA
WP_002992072.1|224007_224847_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	30.8	1.4e-05
>prophage 13
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	229054	233707	1791401		Streptococcus_phage(50.0%)	4	NA	NA
WP_002986045.1|229054_231133_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	1.6e-63
WP_014635277.1|231472_232483_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_136093666.1|232708_232825_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002991131.1|232966_233707_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.4e-25
>prophage 14
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	240500	247095	1791401		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_002986023.1|240500_241271_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.8e-07
WP_014635280.1|241365_242628_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002991117.1|242658_243885_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.8	3.5e-106
WP_002986018.1|243871_244351_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002986015.1|244343_245762_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002992220.1|245913_247095_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	5.4e-11
>prophage 15
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	253297	255284	1791401		Bacillus_virus(50.0%)	2	NA	NA
WP_002992231.1|253297_254368_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	5.2e-13
WP_002986000.1|254360_255284_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-21
>prophage 16
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	266106	266739	1791401		Bacillus_virus(100.0%)	1	NA	NA
WP_002991091.1|266106_266739_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	34.8	6.2e-22
>prophage 17
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	273521	274586	1791401		Planktothrix_phage(100.0%)	1	NA	NA
WP_032463021.1|273521_274586_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	1.4e-29
>prophage 18
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	281213	293391	1791401	protease	Bacillus_phage(40.0%)	10	NA	NA
WP_002991847.1|281213_281771_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	27.6	8.2e-10
WP_002985953.1|281817_282714_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_021733994.1|282944_283481_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002991052.1|283747_284434_+	two-component system response regulator CovR	NA	W8CYM9	Bacillus_phage	31.8	5.1e-30
WP_002991036.1|284439_285942_+	two-component system sensor histidine kinase CovS	NA	W8CYF6	Bacillus_phage	30.1	1.4e-24
WP_002985941.1|286156_286651_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002991019.1|286634_287810_+	replication initiation and membrane attachment family protein	NA	NA	NA	NA	NA
WP_002991016.1|287810_288713_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.2	3.0e-30
WP_021733991.1|288775_290086_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_080370090.1|290292_293391_+	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	31.0	8.2e-43
>prophage 19
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	308692	320970	1791401	tRNA	Staphylococcus_phage(50.0%)	14	NA	NA
WP_063265972.1|308692_308953_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.0	3.2e-17
WP_002995840.1|309130_309679_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002990963.1|309989_310553_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002985882.1|310554_311208_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002990957.1|311500_312421_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	50.4	2.9e-36
WP_002985878.1|312459_313014_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	41.7	8.6e-36
WP_002990953.1|313146_314481_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010921923.1|314558_315350_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.0	5.9e-22
WP_002990948.1|315480_316416_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_002985869.1|316491_317145_+	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002985867.1|317189_318227_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	30.0	4.3e-20
WP_050436492.1|318187_319219_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032463015.1|319229_320162_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009880858.1|320187_320970_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.6	5.7e-17
>prophage 20
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	325403	426730	1791401	protease,bacteriocin,tRNA,integrase,transposase	Streptococcus_phage(18.75%)	107	384455:384472	396038:396055
WP_002985850.1|325403_325994_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
WP_002985847.1|326485_326761_+	YlbG family protein	NA	NA	NA	NA	NA
WP_032463013.1|327009_327645_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_010921931.1|327662_328538_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_002985838.1|329200_329524_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_032463012.1|329528_330392_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	2.5e-114
WP_002985833.1|330418_330811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054223.1|330857_331487_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|331784_332141_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_032463011.1|332214_333042_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	1.1e-127
WP_080370091.1|333270_334458_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_032463010.1|334723_339661_+|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_011527485.1|340150_340330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032463009.1|340432_341140_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_080277848.1|341379_343380_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	34.9	7.8e-87
WP_002985814.1|343874_344888_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.0	1.6e-96
WP_002985812.1|344891_345380_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_032463007.1|345346_347527_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.1	8.0e-170
WP_032463006.1|347731_348484_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_053301456.1|348942_349569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080277868.1|349659_349878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002995935.1|349843_350095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032463150.1|350189_350822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032463149.1|351500_351833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032463148.1|352134_352833_-	streptococcal pyrogenic exotoxin SpeJ	NA	NA	NA	NA	NA
WP_032463005.1|353171_353702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990844.1|354061_354298_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011054234.1|354290_354989_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	9.3e-11
WP_032463004.1|355064_356024_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002985796.1|356356_357694_+	MFS transporter	NA	NA	NA	NA	NA
WP_032463003.1|357866_359249_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	6.5e-32
WP_002990829.1|359279_359834_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002993069.1|359833_360085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010921957.1|360104_360800_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_032463002.1|360949_361291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985785.1|361389_362037_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011017446.1|362182_363115_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002985780.1|363178_363904_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_011017448.1|363904_364759_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985776.1|364906_365713_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_014635327.1|365929_368335_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_030126115.1|368404_368758_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002990800.1|369001_369427_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002985768.1|369532_370222_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002985765.1|370542_371271_+	UMP kinase	NA	NA	NA	NA	NA
WP_002985763.1|371299_371857_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_032463001.1|371965_372823_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032463000.1|372895_373405_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002985757.1|373401_373617_+	YozE family protein	NA	NA	NA	NA	NA
WP_023080216.1|373772_374921_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.4e-16
WP_014635330.1|375236_377009_+	oleate hydratase	NA	NA	NA	NA	NA
WP_010921967.1|377167_378220_+	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_011284574.1|378265_378841_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002985748.1|378999_379497_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985746.1|379477_379885_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985743.1|380004_380901_+	GTPase Era	NA	NA	NA	NA	NA
WP_002993018.1|380921_381398_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014407373.1|381703_381958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014635333.1|382559_383006_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	36.0	4.1e-12
WP_011528336.1|383228_383939_-|bacteriocin	bacteriocin ABC transporter	bacteriocin	NA	NA	NA	NA
WP_002994577.1|384043_384280_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
384455:384472	attL	CATTTCATGATGAAAAAA	NA	NA	NA	NA
WP_002994580.1|384577_384802_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_072135613.1|385199_385562_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_028797129.1|386172_386400_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002994587.1|386448_386766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136298434.1|386831_387113_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011528341.1|387145_387442_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.0	6.5e-06
WP_079891374.1|387517_387715_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	49.2	3.7e-10
WP_002987929.1|387754_387970_+|transposase	transposase	transposase	U5P429	Shigella_phage	45.5	7.0e-10
WP_002992578.1|389912_390662_+	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	28.0	2.1e-21
WP_023079851.1|390662_391997_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011017462.1|392144_392270_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014635340.1|392346_393711_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_020833322.1|393721_395875_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	5.7e-43
WP_002994504.1|397200_397446_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
396038:396055	attR	CATTTCATGATGAAAAAA	NA	NA	NA	NA
WP_002987564.1|397460_397643_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_012560514.1|398837_399065_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003060803.1|399077_399278_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_028797130.1|399602_399767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054252.1|399816_400098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032462998.1|400942_402013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023079866.1|402057_402504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023605037.1|402851_403121_-	quorum-sensing system protein StcA	NA	NA	NA	NA	NA
WP_002985713.1|403642_403885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128650799.1|404034_404103_-	peptide pheromone SHP2	NA	NA	NA	NA	NA
WP_002990747.1|404191_405058_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023079857.1|405229_406057_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.5	3.9e-16
WP_002994141.1|406053_406647_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_032462997.1|406836_408339_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.2	6.7e-75
WP_080277847.1|408460_409654_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002990729.1|409650_409797_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002985700.1|409842_410079_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_080277846.1|410172_412506_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	5.2e-90
WP_002994152.1|412508_412976_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	5.7e-41
WP_010921981.1|412981_413701_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_002994169.1|413816_414464_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_002985692.1|414513_415440_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_014635345.1|415439_416123_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_002994177.1|416333_417260_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.5	2.6e-77
WP_002985686.1|417404_417782_-	VOC family protein	NA	NA	NA	NA	NA
WP_002985684.1|417792_418458_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011054264.1|418506_419592_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002985680.1|419765_420767_+	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	6.1e-24
WP_002994184.1|420897_421896_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002994187.1|421897_423232_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985672.1|423653_425597_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	1.0e-120
WP_011054266.1|425737_426730_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	8.2e-13
>prophage 21
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	432686	436679	1791401		Bacillus_phage(50.0%)	4	NA	NA
WP_002985645.1|432686_433397_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	3.7e-39
WP_002995609.1|433389_434742_+	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	35.0	4.7e-35
WP_032462994.1|434745_435555_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	37.4	1.6e-35
WP_002990670.1|435986_436679_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	34.7	6.5e-25
>prophage 22
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	448913	451675	1791401		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014635350.1|448913_450071_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	M1GX70	Paramecium_bursaria_Chlorella_virus	41.1	3.6e-76
WP_011106855.1|450155_451364_+	MFS transporter	NA	NA	NA	NA	NA
WP_002985621.1|451465_451675_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	61.5	1.3e-16
>prophage 23
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	477145	480727	1791401	tRNA	Phage_TP(33.33%)	3	NA	NA
WP_020905001.1|477145_478432_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.9	5.4e-41
WP_002985548.1|478642_478855_+	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	46.9	9.0e-10
WP_011054296.1|479233_480727_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.0	8.7e-91
>prophage 24
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	484275	488636	1791401		Bacillus_phage(33.33%)	5	NA	NA
WP_002985536.1|484275_485124_-	glycoside hydrolase family 25 protein	NA	A0A223LJI5	Bacillus_phage	31.3	1.9e-18
WP_011054297.1|485448_485952_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002990551.1|485935_486319_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_002993650.1|486364_486844_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.0	1.6e-22
WP_002985529.1|486836_488636_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.8	2.9e-109
>prophage 25
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	493390	494587	1791401		Hokovirus(100.0%)	1	NA	NA
WP_002990541.1|493390_494587_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.6	2.5e-32
>prophage 26
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	499409	504090	1791401		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_014635365.1|499409_500711_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.3	3.1e-28
WP_002985505.1|500792_501179_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002985501.1|501408_504090_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.3	4.9e-68
>prophage 27
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	511319	515397	1791401		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_002985475.1|511319_512114_+	gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.3e-18
WP_002985472.1|512138_512780_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_032462985.1|512808_513810_+	sugar kinase	NA	NA	NA	NA	NA
WP_032462984.1|513814_514450_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002985463.1|514740_515397_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.7	1.2e-12
>prophage 28
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	518403	531974	1791401	tRNA,transposase	Streptococcus_phage(57.14%)	12	NA	NA
WP_002985455.1|518403_519096_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_010922049.1|519079_520018_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020833376.1|520327_521026_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	63.3	2.7e-79
WP_021733554.1|521193_521958_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000564846.1|522154_523288_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_020833379.1|523292_523382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028797137.1|523391_525893_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.1	1.7e-203
WP_002985439.1|526227_527421_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002990488.1|527441_528788_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	8.2e-56
WP_002985434.1|529201_530092_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_032462982.1|530088_531066_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	73.8	1.6e-138
WP_011054317.1|531062_531974_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
>prophage 29
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	539999	549477	1791401		Streptococcus_phage(75.0%)	7	NA	NA
WP_032462977.1|539999_541262_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.3	3.8e-95
WP_002985298.1|541376_541724_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023612339.1|542747_543308_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002994058.1|543308_545261_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	8.9e-144
WP_032462976.1|545628_547353_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|547484_547943_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|548169_549477_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
>prophage 30
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	555266	556190	1791401		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002990429.1|555266_556190_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
>prophage 31
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	562013	565702	1791401		Pneumococcus_phage(33.33%)	3	NA	NA
WP_002985256.1|562013_562514_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	5.4e-05
WP_011017608.1|562707_564666_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	9.9e-103
WP_002985252.1|564679_565702_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
>prophage 32
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	575735	576779	1791401	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003057440.1|575735_576779_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
>prophage 33
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	581418	583091	1791401		Planktothrix_phage(50.0%)	2	NA	NA
WP_011285473.1|581418_582087_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-30
WP_032462970.1|582188_583091_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	36.5	8.5e-33
>prophage 34
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	586453	600679	1791401		Bacillus_virus(20.0%)	12	NA	NA
WP_032463101.1|586453_590086_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.3	1.6e-21
WP_014635388.1|590225_591038_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000048058.1|591178_591355_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011054340.1|591482_591845_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_032462968.1|591974_593789_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	28.6	2.0e-41
WP_002985187.1|593797_594907_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	35.1	2.0e-36
WP_002990295.1|595142_595481_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_002992705.1|595618_596473_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.3	6.8e-32
WP_002985181.1|596591_597746_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002992707.1|597735_598668_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010922132.1|598712_599474_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985176.1|599473_600679_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.5e-12
>prophage 35
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	606102	606798	1791401		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_002985169.1|606102_606798_+	glycosyltransferase family 2 protein	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	28.2	8.3e-12
>prophage 36
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	613308	636054	1791401	tRNA,protease	Streptococcus_phage(30.77%)	24	NA	NA
WP_002985152.1|613308_613839_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.8	3.5e-10
WP_002985151.1|613880_614078_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002985149.1|614136_614496_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_050436486.1|614786_616997_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_032462964.1|617104_618268_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.6	4.9e-142
WP_002985140.1|618264_618951_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_032462963.1|619044_620211_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002990260.1|620271_620613_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002992646.1|620833_622186_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002992648.1|622265_623543_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011017641.1|623572_624013_-	membrane protein	NA	NA	NA	NA	NA
WP_011017642.1|624247_625390_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	8.3e-25
WP_002985121.1|625401_626616_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_011017643.1|626653_627946_+	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	30.8	2.9e-34
WP_002985116.1|628159_628474_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002985112.1|628485_628812_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985110.1|628839_629133_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002985099.1|629490_630405_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002985097.1|630401_630860_+	signal peptidase II	NA	NA	NA	NA	NA
WP_011054355.1|630849_631740_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	2.7e-07
WP_009881107.1|632135_632657_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_002990245.1|632672_633932_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.2	2.1e-61
WP_032462962.1|633992_634928_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.6	3.0e-25
WP_002985087.1|634971_636054_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.9	4.7e-62
>prophage 37
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	640976	641663	1791401		Planktothrix_phage(100.0%)	1	NA	NA
WP_002993627.1|640976_641663_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.0	2.5e-37
>prophage 38
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	653092	661628	1791401		Streptococcus_phage(25.0%)	8	NA	NA
WP_011054365.1|653092_654085_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.9	8.2e-29
WP_002985048.1|654262_655321_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_002985045.1|655333_656257_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_020833413.1|656512_657226_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.1	1.9e-19
WP_032462957.1|657222_658134_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_011054367.1|658130_660077_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010922159.1|660169_660769_+	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	33.8	3.6e-11
WP_002985031.1|660920_661628_+	glycoside hydrolase family 73 protein	NA	Q332B8	Clostridium_botulinum_C_phage	36.4	6.5e-12
>prophage 39
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	665886	673878	1791401	tRNA	unidentified_phage(25.0%)	7	NA	NA
WP_080277860.1|665886_667080_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.0	5.2e-38
WP_011184403.1|667076_668954_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	6.7e-64
WP_002984997.1|669359_669578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984994.1|669833_670244_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	30.6	6.9e-06
WP_032462955.1|670324_672337_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011054374.1|672556_673207_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002984985.1|673209_673878_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.8	2.3e-19
>prophage 40
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	682076	692300	1791401	protease	Bacillus_phage(33.33%)	11	NA	NA
WP_011017679.1|682076_682916_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	1.7e-83
WP_002984955.1|682995_683493_+	dihydrofolate reductase	NA	W5QU76	Bacillus_phage	34.4	8.6e-11
WP_002984950.1|683512_683683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984948.1|683812_685042_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	7.8e-138
WP_002984945.1|685051_685651_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002984942.1|685798_686542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922175.1|686599_688699_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.4	6.6e-121
WP_021733827.1|689076_689760_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_032462954.1|689836_691048_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_032462953.1|691066_691507_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	55.3	3.4e-35
WP_014635415.1|691490_692300_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.9	3.3e-52
>prophage 41
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	701218	708605	1791401		Bacillus_virus(66.67%)	5	NA	NA
WP_023080158.1|701218_701872_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	40.1	3.1e-40
WP_002984912.1|702003_703272_+	dihydroorotase	NA	NA	NA	NA	NA
WP_002984911.1|703329_703971_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002984909.1|704102_706055_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.7	2.8e-121
WP_032462951.1|706145_708605_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.1	1.1e-98
>prophage 42
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	720308	723963	1791401		Bacillus_phage(33.33%)	3	NA	NA
WP_032462949.1|720308_722519_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002990109.1|722680_723199_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002984890.1|723279_723963_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
>prophage 43
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	727355	730102	1791401		Escherichia_phage(66.67%)	3	NA	NA
WP_010922195.1|727355_728225_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	3.2e-101
WP_002990099.1|728224_728818_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_014635423.1|729061_730102_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.6	5.5e-68
>prophage 44
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	733333	738307	1791401		Only_Syngen_Nebraska_virus(50.0%)	5	NA	NA
WP_032462947.1|733333_734986_-	Rqc2 family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_032462946.1|735339_736338_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109821051.1|736396_736507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002991975.1|736682_737552_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009880825.1|737548_738307_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.0	1.3e-10
>prophage 45
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	741491	743399	1791401		Tupanvirus(100.0%)	1	NA	NA
WP_032462944.1|741491_743399_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.8	6.8e-56
>prophage 46
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	747633	749397	1791401		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032462943.1|747633_749397_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	2.0e-33
>prophage 47
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	752721	753711	1791401		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002984861.1|752721_753711_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	4.1e-12
>prophage 48
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	770876	772709	1791401		Tupanvirus(100.0%)	1	NA	NA
WP_002989943.1|770876_772709_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
>prophage 49
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	779009	780659	1791401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_021733391.1|779009_780659_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
>prophage 50
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	791167	808294	1791401		Stx2-converting_phage(14.29%)	17	NA	NA
WP_080277838.1|791167_792403_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.0	2.4e-14
WP_023605105.1|792518_793481_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032462929.1|793809_795087_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002984765.1|795097_795706_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.8	1.3e-45
WP_011528620.1|795714_796506_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	8.0e-27
WP_032462928.1|796521_796881_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_002995337.1|796877_797378_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_002995339.1|797527_798415_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_032462927.1|798460_799615_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.7	6.8e-35
WP_002984743.1|799598_800393_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011285520.1|800389_801166_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002984738.1|801158_802232_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002995342.1|802286_802952_-	response regulator	NA	W8CYM9	Bacillus_phage	29.1	7.2e-05
WP_020833466.1|802932_804474_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011054474.1|804634_805966_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	55.4	7.4e-17
WP_002984724.1|805996_807163_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_011054475.1|807244_808294_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	24.8	8.7e-13
>prophage 51
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	813103	846544	1791401		Bacillus_phage(17.65%)	33	NA	NA
WP_002984709.1|813103_813784_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	24.2	2.5e-13
WP_002989835.1|813785_814481_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002984705.1|814490_815135_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002984704.1|815387_815735_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_002989829.1|815724_816852_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.8	2.1e-36
WP_002989827.1|816848_817829_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.0	6.2e-37
WP_002989824.1|817968_818547_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002984696.1|818634_819306_+	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	28.9	2.4e-08
WP_002993124.1|819280_820117_+	NAD kinase	NA	NA	NA	NA	NA
WP_032462925.1|820113_821019_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.4	6.2e-07
WP_002984691.1|821022_822018_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002993126.1|822144_822900_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	4.7e-08
WP_002993128.1|823092_823782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023080255.1|824204_824933_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.1	1.0e-15
WP_080277836.1|824919_826452_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_002989808.1|826729_827713_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.1	8.1e-138
WP_002984677.1|828017_828599_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014635461.1|828598_829882_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.0	1.0e-31
WP_011054484.1|829945_830884_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002984671.1|830936_831122_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002989802.1|831259_831829_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	57.0	1.8e-52
WP_011054486.1|831863_832943_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_011054487.1|832942_833782_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011054488.1|833765_834356_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.1	4.0e-15
WP_002994974.1|834373_834826_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032462922.1|834815_836072_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.1e-94
WP_032462921.1|836078_837056_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002984653.1|837056_837656_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.6	1.1e-20
WP_032462920.1|837665_839390_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	2.1e-35
WP_032462919.1|839386_841114_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	8.1e-48
WP_002984646.1|841354_842725_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	1.1e-10
WP_002984645.1|842883_843867_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_011054496.1|844057_846544_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.7e-104
>prophage 52
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	852084	856013	1791401		Cafeteria_roenbergensis_virus(66.67%)	3	NA	NA
WP_002995007.1|852084_852876_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	2.8e-24
WP_002995009.1|852940_853777_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.1	4.2e-34
WP_002984618.1|853883_856013_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.3	1.5e-99
>prophage 53
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	875411	876110	1791401		Streptococcus_phage(100.0%)	1	NA	NA
WP_002993300.1|875411_876110_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	48.1	2.7e-58
>prophage 54
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	880632	888262	1791401		Hokovirus(33.33%)	6	NA	NA
WP_002993734.1|880632_882195_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.9	8.4e-20
WP_020905214.1|882236_883460_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_010922338.1|883824_885390_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.2e-50
WP_002989733.1|885502_886060_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002992577.1|886037_886904_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_011054517.1|886993_888262_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	52.8	7.1e-102
>prophage 55
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	892869	895622	1791401		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_032462910.1|892869_893889_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.6	1.5e-09
WP_002992884.1|893935_894817_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_021733447.1|894809_895622_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.5	6.5e-32
>prophage 56
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	899896	1016495	1791401	tail,holin,terminase,portal,tRNA,integrase,transposase,head,capsid	Streptococcus_phage(25.93%)	133	958610:958669	1005202:1005297
WP_002984544.1|899896_900442_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	35.2	9.1e-22
WP_002984543.1|900499_901069_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_032462908.1|901244_902963_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	84.6	3.7e-279
WP_002989705.1|903177_904134_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032462907.1|904135_905200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002992952.1|905192_906725_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	4.0e-14
WP_002992954.1|906863_907916_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	38.8	1.9e-55
WP_002984531.1|908009_908399_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002989699.1|909049_909643_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010922353.1|909910_910831_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.0	3.5e-34
WP_002989695.1|910899_911133_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_032462905.1|911257_912568_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	21.7	4.9e-05
WP_002984519.1|912560_913235_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032462903.1|913581_916119_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.0	6.7e-75
WP_002984514.1|916323_916977_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002993892.1|917044_917803_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.8e-15
WP_032462902.1|917815_918619_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	5.5e-15
WP_014635486.1|918634_919522_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_053301461.1|919511_920447_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011054531.1|920457_921324_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	M1U9L0	Synechococcus_phage	24.5	4.5e-07
WP_032462900.1|921462_922773_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002984499.1|922775_923564_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_002984497.1|923553_923832_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_002984496.1|923833_924238_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_032462898.1|924280_925213_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	3.7e-07
WP_002989678.1|925241_926126_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_032462896.1|926241_927582_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_032462895.1|927687_928644_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|928654_929251_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032462893.1|929342_931979_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002989664.1|931993_932695_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_032462891.1|932812_933355_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|933497_934139_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984478.1|934301_934793_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|934800_935001_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|935041_935581_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|935593_935782_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|935792_936404_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|936440_936689_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002992405.1|937051_939370_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	4.6e-131
WP_032462890.1|939900_941223_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_032462888.1|941342_942578_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011054540.1|942947_943721_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_002989634.1|944091_944928_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002992415.1|944943_945573_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
WP_002992417.1|945582_946224_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|946330_946666_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002984451.1|946861_948676_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	5.2e-98
WP_002984449.1|948851_949409_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|949626_951129_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|951191_952205_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_032462886.1|952284_955395_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
WP_002989617.1|955579_955951_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|955950_956649_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_032462884.1|956658_957444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989607.1|957574_958189_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
958610:958669	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_011184577.1|958747_958969_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	9.0e-21
WP_011106694.1|959033_959321_-	hypothetical protein	NA	Q938I9	Temperate_phage	100.0	2.4e-29
WP_011054727.1|959314_959890_-	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011054728.1|960365_961145_-	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_023080015.1|962011_962656_-	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	77.2	4.0e-93
WP_002994484.1|962765_963458_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_011184580.1|963690_964248_-	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	87.0	4.1e-94
WP_002988455.1|964359_964815_-|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	5.2e-63
WP_011184581.1|964830_965436_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	92.5	9.3e-84
WP_011184582.1|965438_965867_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	8.6e-68
WP_032462883.1|965878_967765_-	gp58-like family protein	NA	Q938J9	Temperate_phage	82.6	4.0e-210
WP_047236125.1|967779_968784_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	62.7	3.4e-107
WP_032462881.1|968780_970832_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	84.6	0.0e+00
WP_032462880.1|970828_971608_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	53.6	4.7e-64
WP_032462878.1|971639_975275_-	tape measure protein	NA	U6E979	Streptococcus_phage	29.6	5.2e-04
WP_002988428.1|975289_975619_-	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_032462877.1|975660_976014_-|tail	tail assembly chaperone	tail	Q77RZ7	Lactococcus_phage	47.7	4.7e-19
WP_010922221.1|976073_976640_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	53.3	5.7e-43
WP_010922220.1|976736_977126_-	hypothetical protein	NA	Q38611	Lactococcus_phage	68.2	1.0e-43
WP_002984399.1|977122_977488_-	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	7.7e-17
WP_002984393.1|977468_977777_-	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_010922219.1|977773_978127_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	7.4e-25
WP_002990031.1|978138_978405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990034.1|978416_979466_-|capsid	major capsid protein	capsid	B0YL60	Streptococcus_virus	56.9	2.6e-105
WP_002990036.1|979468_979849_-	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
WP_014635511.1|979858_980392_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	84.2	1.2e-15
WP_032462876.1|980535_980802_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	71.6	6.6e-26
WP_002988389.1|981188_981374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032462875.1|981377_982940_-|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.3	1.6e-47
WP_032462874.1|982920_984423_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	9.2e-141
WP_032462873.1|984434_985724_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.9	1.5e-184
WP_002990047.1|985701_986184_-|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
WP_032461637.1|986428_986863_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
WP_032461638.1|987302_987806_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	99.4	1.5e-92
WP_032461639.1|987802_988096_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	100.0	4.2e-50
WP_011054812.1|988092_988278_-	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
WP_032462872.1|988302_988530_-	hypothetical protein	NA	A3F630	Streptococcus_phage	77.3	1.3e-25
WP_032462871.1|988526_988730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136069459.1|988710_988869_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_032462870.1|988858_989200_-	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	95.5	9.9e-43
WP_032462869.1|989202_989487_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	8.9e-37
WP_020833536.1|989483_989864_-	hypothetical protein	NA	A3F627	Streptococcus_phage	63.5	2.6e-36
WP_020833537.1|989873_990143_-	hypothetical protein	NA	Q938M2	Temperate_phage	88.8	1.8e-39
WP_020833538.1|990139_990415_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	73.6	2.9e-32
WP_032462868.1|990639_990996_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	92.4	3.7e-56
WP_002984338.1|990979_991330_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	89.4	2.6e-46
WP_020833541.1|991283_992153_-	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.2	9.8e-103
WP_002984332.1|992430_993984_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.4	4.3e-210
WP_002984328.1|994001_994484_-	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_075340263.1|994488_995892_-	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984321.1|995927_996611_-	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_002984318.1|996607_996892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984315.1|996888_997083_-	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_002984312.1|997082_997412_-	hypothetical protein	NA	A1EAC2	Streptococcus_phage	41.6	2.7e-13
WP_002984309.1|997492_997630_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	97.8	4.9e-17
WP_011017882.1|997626_997923_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_002995990.1|998000_998177_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023079659.1|998319_998538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|998713_998923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017884.1|999181_999691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017885.1|999821_1000031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992770.1|1000140_1000341_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
WP_011054589.1|1000414_1000801_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_011284881.1|1000789_1000999_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011284882.1|1001052_1001652_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011285583.1|1001681_1001840_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
WP_011285584.1|1002196_1003021_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	91.6	1.2e-131
WP_011285585.1|1003056_1003950_+	P63C domain-containing protein	NA	A0A1I9LJQ0	Stx_converting_phage	47.5	1.2e-68
WP_011054595.1|1004070_1005159_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
WP_002989605.1|1005521_1006142_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1005202:1005297	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
WP_014635534.1|1006398_1008663_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_014635535.1|1008697_1010191_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_002992583.1|1010304_1011324_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.7e-17
WP_002984246.1|1011567_1012815_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_020837251.1|1013088_1014450_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002984240.1|1014449_1015286_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_032462867.1|1015466_1016495_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.1	3.7e-40
>prophage 57
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1020733	1022272	1791401		Tupanvirus(100.0%)	1	NA	NA
WP_002984203.1|1020733_1022272_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	5.0e-41
>prophage 58
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1027047	1027788	1791401		Planktothrix_phage(100.0%)	1	NA	NA
WP_002984187.1|1027047_1027788_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.5e-35
>prophage 59
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1038365	1090462	1791401	tRNA,protease,integrase,transposase	Enterococcus_phage(21.43%)	47	1038199:1038215	1082237:1082253
1038199:1038215	attL	TGAACTGCACCCCAAAA	NA	NA	NA	NA
WP_109821322.1|1038365_1039596_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.4	1.7e-63
WP_002992869.1|1039896_1040769_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_002984130.1|1040992_1042303_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_032462855.1|1042380_1042674_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011528341.1|1042706_1043003_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.0	6.5e-06
WP_080251045.1|1043078_1043276_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	47.5	1.4e-09
WP_014635546.1|1043315_1043429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080277834.1|1043445_1044180_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011017916.1|1044291_1044657_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_014407647.1|1044776_1045997_-	MFS transporter	NA	NA	NA	NA	NA
WP_014635547.1|1046370_1047855_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_002995509.1|1047959_1048361_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_080007606.1|1048445_1049060_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	97.6	1.1e-92
WP_032462861.1|1049375_1050767_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	98.7	4.8e-261
WP_002984109.1|1050815_1052267_-	LCP family protein	NA	NA	NA	NA	NA
WP_002989310.1|1052474_1052966_-	shikimate kinase	NA	NA	NA	NA	NA
WP_011054628.1|1052958_1054251_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002984102.1|1054352_1055318_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002984100.1|1055319_1056180_-	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002989302.1|1056195_1057479_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014635551.1|1057487_1058030_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053301462.1|1058267_1059089_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002989295.1|1059446_1060706_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002989292.1|1060879_1062076_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_032462859.1|1062612_1064991_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011017924.1|1065194_1066136_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_010922412.1|1066110_1066383_-	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_023079397.1|1066408_1068079_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	3.9e-47
WP_023079396.1|1068078_1068576_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002992609.1|1068720_1069530_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002984063.1|1069582_1069846_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002984060.1|1069925_1070552_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989254.1|1070649_1071735_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.6e-33
WP_032462858.1|1071845_1073120_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011284931.1|1073214_1074642_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002984033.1|1074826_1076560_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_002984031.1|1076564_1076828_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_032462857.1|1077220_1077439_+	glutaredoxin-like protein NrdH	NA	A0A249XUR7	Enterococcus_phage	48.0	5.2e-13
WP_032462856.1|1077458_1079618_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.7	1.2e-263
WP_002987365.1|1079950_1080910_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_030127037.1|1080884_1082198_+	chloride channel protein	NA	NA	NA	NA	NA
WP_002984013.1|1083583_1084279_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1082237:1082253	attR	TGAACTGCACCCCAAAA	NA	NA	NA	NA
WP_023080157.1|1084297_1085059_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989220.1|1085055_1085271_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023079943.1|1085631_1088250_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	1.1e-61
WP_020837342.1|1088636_1089692_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_020837344.1|1089754_1090462_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
>prophage 60
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1100492	1112915	1791401	tRNA	Streptococcus_phage(33.33%)	10	NA	NA
WP_032462849.1|1100492_1101098_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	3.0e-58
WP_011054659.1|1101194_1102235_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_032462848.1|1102305_1104549_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.7	9.8e-54
WP_002995626.1|1104529_1105192_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011106715.1|1105391_1106210_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002994360.1|1106249_1107026_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002989164.1|1107015_1107294_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_032462847.1|1107317_1109318_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	1.3e-65
WP_002989158.1|1109444_1111064_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_002989155.1|1111370_1112915_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
>prophage 61
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1121227	1127283	1791401		Hokovirus(25.0%)	6	NA	NA
WP_002989136.1|1121227_1122163_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	4.6e-66
WP_032462844.1|1122462_1124325_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	2.2e-91
WP_002983920.1|1124669_1124945_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
WP_002989129.1|1125043_1125631_-	YpmS family protein	NA	NA	NA	NA	NA
WP_010922483.1|1125608_1126469_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989125.1|1126443_1127283_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
>prophage 62
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1132663	1147008	1791401	tRNA,protease	Klosneuvirus(14.29%)	11	NA	NA
WP_002992349.1|1132663_1134004_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_002989114.1|1134156_1135011_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.4	4.4e-39
WP_002993334.1|1135218_1136913_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_032462842.1|1137090_1138500_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.4e-60
WP_002989107.1|1138648_1139383_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_011054708.1|1139382_1140069_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983885.1|1140195_1140426_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_002983882.1|1140723_1143006_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002993341.1|1143133_1143589_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983878.1|1143639_1143942_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_053301463.1|1144206_1147008_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.8e-68
>prophage 63
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1157676	1159518	1791401		Streptococcus_phage(100.0%)	1	NA	NA
WP_002983847.1|1157676_1159518_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	31.4	2.0e-20
>prophage 64
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1165034	1169587	1791401		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002994809.1|1165034_1166012_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	3.6e-21
WP_032462841.1|1166427_1167465_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_002983821.1|1167451_1167943_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	2.0e-15
WP_002983819.1|1167932_1168472_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_032462840.1|1168594_1169587_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.9	1.8e-52
>prophage 65
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1180311	1182045	1791401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032462839.1|1180311_1182045_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.7	1.3e-26
>prophage 66
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1189574	1192223	1791401	tRNA	Catovirus(100.0%)	1	NA	NA
WP_023079942.1|1189574_1192223_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	7.3e-149
>prophage 67
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1195345	1196419	1791401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014407723.1|1195345_1196419_+	3-dehydroquinate synthase	NA	A9YVT7	Ostreococcus_tauri_virus	32.5	7.3e-31
>prophage 68
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1204483	1206208	1791401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_021733908.1|1204483_1206208_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	2.6e-14
>prophage 69
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1222717	1224073	1791401		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002991789.1|1222717_1224073_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	1.1e-73
>prophage 70
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1234612	1256651	1791401	tRNA	Streptococcus_phage(33.33%)	21	NA	NA
WP_002988971.1|1234612_1235938_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	51.1	2.4e-116
WP_002988970.1|1235992_1236625_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	4.2e-63
WP_002991877.1|1236752_1237694_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.2	1.3e-129
WP_002991882.1|1237711_1238089_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011054832.1|1238088_1239489_-	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	4.1e-26
WP_002983671.1|1239525_1240167_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002991890.1|1240159_1241164_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002983667.1|1241160_1241904_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002994648.1|1241975_1243874_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.7	1.4e-21
WP_002983660.1|1243870_1244611_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_032462825.1|1244648_1245971_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032460195.1|1245960_1246896_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_032462824.1|1246957_1249342_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002983650.1|1249406_1249724_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002983649.1|1249739_1250375_-	guanylate kinase	NA	S4VT50	Pandoravirus	45.3	4.9e-11
WP_014407744.1|1250484_1252092_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_032462823.1|1252221_1253118_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.7	8.5e-09
WP_032462822.1|1253316_1254504_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011018061.1|1254527_1255178_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_032462821.1|1255179_1255839_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_023612962.1|1255871_1256651_+	3-hydroxybutyrate dehydrogenase	NA	A0A0M4JSW6	Mollivirus	24.5	6.3e-08
>prophage 71
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1262877	1276019	1791401		Bacillus_virus(42.86%)	11	NA	NA
WP_002983622.1|1262877_1263486_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.9	3.2e-23
WP_009880659.1|1263472_1265638_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011054844.1|1266104_1267442_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	37.0	1.4e-68
WP_011054845.1|1267626_1268451_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.1	1.5e-71
WP_002994227.1|1268447_1269908_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.0	1.1e-98
WP_032462819.1|1270077_1271457_-	amino acid permease	NA	NA	NA	NA	NA
WP_011018071.1|1271625_1272543_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	3.1e-91
WP_002988906.1|1272606_1272831_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_002983603.1|1272934_1273678_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.0e-28
WP_011888658.1|1273677_1274481_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032462818.1|1274675_1276019_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.1	2.3e-42
>prophage 72
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1281260	1289097	1791401	bacteriocin	Streptococcus_phage(50.0%)	7	NA	NA
WP_032462816.1|1281260_1282511_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.8	3.8e-116
WP_032462815.1|1282503_1283325_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.4	1.4e-37
WP_032462814.1|1283388_1285017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002994254.1|1285021_1285756_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	5.7e-27
WP_002988878.1|1285789_1286056_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011054904.1|1286249_1288235_-	transketolase	NA	NA	NA	NA	NA
WP_002983569.1|1288452_1289097_-	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	44.2	2.2e-43
>prophage 73
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1292166	1292868	1791401		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002988870.1|1292166_1292868_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	37.5	5.2e-30
>prophage 74
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1297540	1370745	1791401	tail,terminase,portal,tRNA,integrase,head,capsid	Streptococcus_phage(72.73%)	84	1326541:1326557	1367341:1367357
WP_032462810.1|1297540_1299580_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002983544.1|1299956_1300874_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002988861.1|1301244_1301799_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_032462809.1|1301909_1302749_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	6.4e-51
WP_021299064.1|1302870_1304019_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002988856.1|1304136_1305768_-	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_014635642.1|1305969_1306692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014635643.1|1306820_1307663_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.5	2.2e-91
WP_002983526.1|1307955_1308513_+	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	3.2e-14
WP_002988848.1|1308549_1309374_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021340062.1|1309375_1309981_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002983521.1|1310189_1311167_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012767469.1|1311676_1312192_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_011184857.1|1312206_1312632_-	galactose-6-phosphate isomerase subunit LacA	NA	A0A222YX14	Synechococcus_phage	29.3	1.7e-07
WP_021340069.1|1312888_1314337_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_011054923.1|1314365_1314671_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002983508.1|1314663_1315137_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_032462806.1|1315373_1316144_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	8.3e-21
WP_011285076.1|1316170_1316341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014635648.1|1316347_1316551_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_080277858.1|1316564_1318766_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	1.8e-113
WP_002988824.1|1318795_1319230_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_021733873.1|1319401_1320388_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003062050.1|1320521_1320878_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002983491.1|1321077_1323939_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
WP_002983488.1|1323958_1324261_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002983486.1|1324253_1324550_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002994325.1|1324565_1325723_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_031499440.1|1325897_1326374_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
1326541:1326557	attL	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002988813.1|1326678_1326858_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	5.6e-21
WP_002988811.1|1327096_1328269_+	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.8	4.7e-76
WP_002988807.1|1328384_1329581_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	82.2	6.1e-196
WP_002988802.1|1329691_1329877_-	hypothetical protein	NA	Q938J5	Temperate_phage	93.4	9.5e-24
WP_002988799.1|1329873_1330173_-	hypothetical protein	NA	Q938J6	Temperate_phage	82.3	3.5e-36
WP_002988797.1|1330183_1330804_-	hypothetical protein	NA	A3F662	Streptococcus_phage	88.8	8.3e-80
WP_002988795.1|1330806_1330968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988792.1|1330976_1332884_-	gp58-like family protein	NA	Q938J9	Temperate_phage	60.9	1.3e-134
WP_002988442.1|1332894_1333530_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	67.6	2.2e-75
WP_002988439.1|1333529_1334585_-	hypothetical protein	NA	A3F657	Streptococcus_phage	73.2	1.2e-126
WP_002988790.1|1334581_1336564_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.5	0.0e+00
WP_002988788.1|1336573_1337416_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	99.6	8.5e-160
WP_002988786.1|1337427_1341810_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.4	3.2e-226
WP_002983445.1|1341824_1342058_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_002983443.1|1342132_1342588_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	100.0	8.3e-77
WP_002988784.1|1342641_1343241_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	98.9	4.1e-92
WP_002988782.1|1343252_1343612_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	97.5	6.8e-58
WP_002988781.1|1343615_1343960_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	99.1	6.1e-56
WP_000639437.1|1343956_1344235_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_002988776.1|1344245_1344602_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	97.5	2.8e-56
WP_002988771.1|1344613_1345501_-	hypothetical protein	NA	A7J297	Streptococcus_phage	99.7	3.6e-161
WP_002988768.1|1345513_1346083_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.9	2.6e-80
WP_002988765.1|1346238_1346505_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	88.6	1.7e-34
WP_002983423.1|1346507_1346696_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_015446273.1|1346726_1348172_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	92.9	3.4e-257
WP_002988758.1|1348131_1349664_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	1.3e-286
WP_002988754.1|1349679_1350957_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	97.6	1.3e-241
WP_011106637.1|1350946_1351399_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1351488_1351905_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1351901_1352093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988740.1|1352082_1352934_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	71.9	1.5e-100
WP_002988738.1|1352942_1353209_-	hypothetical protein	NA	A7J287	Streptococcus_phage	65.2	5.4e-20
WP_002988733.1|1353373_1354696_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	98.4	1.9e-254
WP_002988730.1|1354692_1354968_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
WP_011285674.1|1355354_1357739_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	4.1e-276
WP_002988723.1|1357743_1359666_-	DNA polymerase	NA	A7J280	Streptococcus_phage	96.7	0.0e+00
WP_002988718.1|1359708_1360266_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	2.5e-51
WP_002988715.1|1360276_1360675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988711.1|1360678_1361833_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	91.9	4.5e-204
WP_002988708.1|1361832_1362132_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_002988705.1|1362219_1362423_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	2.3e-31
WP_002988700.1|1362568_1362955_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	3.1e-56
WP_002988697.1|1362951_1363155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988693.1|1363147_1363318_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	6.9e-21
WP_002988687.1|1363314_1363590_-	hypothetical protein	NA	A7J272	Streptococcus_phage	95.6	5.9e-46
WP_002988684.1|1363651_1363867_-	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	76.8	4.2e-23
WP_002988681.1|1363914_1364328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285676.1|1364738_1365140_+	helix-turn-helix transcriptional regulator	NA	A7J269	Streptococcus_phage	72.9	1.1e-40
WP_002988673.1|1365153_1365537_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	5.3e-69
WP_002988670.1|1365547_1366099_+	hypothetical protein	NA	A7J267	Streptococcus_phage	92.3	3.4e-85
WP_002988667.1|1366215_1367295_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	86.9	1.3e-176
WP_002983387.1|1367492_1368128_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
1367341:1367357	attR	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002983385.1|1368127_1368919_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_032462804.1|1368982_1370017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002983379.1|1370019_1370745_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
>prophage 75
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1374105	1375566	1791401		Moraxella_phage(100.0%)	1	NA	NA
WP_032462803.1|1374105_1375566_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	2.1e-36
>prophage 76
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1382002	1383280	1791401	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002988632.1|1382002_1383280_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.0	6.1e-93
>prophage 77
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1388707	1389442	1791401		Bacillus_phage(100.0%)	1	NA	NA
WP_002988615.1|1388707_1389442_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	40.8	1.1e-06
>prophage 78
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1394347	1397591	1791401		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002993772.1|1394347_1395484_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	27.3	2.8e-17
WP_002983316.1|1395764_1397591_-	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.5	1.1e-130
>prophage 79
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1406785	1407340	1791401		Bacillus_virus(100.0%)	1	NA	NA
WP_002992568.1|1406785_1407340_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	1.2e-24
>prophage 80
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1410505	1425518	1791401		Organic_Lake_phycodnavirus(28.57%)	12	NA	NA
WP_009881044.1|1410505_1411894_-	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	2.1e-22
WP_002983258.1|1411965_1412931_+	asparaginase	NA	NA	NA	NA	NA
WP_002988556.1|1413279_1413984_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002991995.1|1413996_1414899_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_032462799.1|1415191_1417207_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_080370092.1|1417581_1418976_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.2e-12
WP_002983239.1|1418972_1419653_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002995377.1|1419649_1420243_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_023079703.1|1420239_1421910_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.6	3.4e-19
WP_032462798.1|1421902_1423666_-	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.3e-21
WP_002983221.1|1423662_1424499_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.9e-17
WP_002983218.1|1424495_1425518_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.0e-14
>prophage 81
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1431761	1434460	1791401		Staphylococcus_phage(50.0%)	2	NA	NA
WP_011106611.1|1431761_1433273_-	CHAP domain-containing protein	NA	W5R8Q8	Staphylococcus_phage	41.7	1.9e-05
WP_010922619.1|1433359_1434460_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	2.0e-31
>prophage 82
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1446579	1472180	1791401		Bacillus_phage(20.0%)	26	NA	NA
WP_014635676.1|1446579_1447545_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
WP_002983167.1|1447685_1448138_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002993228.1|1448130_1448520_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988496.1|1448565_1449123_-	elongation factor P	NA	NA	NA	NA	NA
WP_002988493.1|1449218_1449680_-	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_014635677.1|1449714_1450788_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.8	7.8e-17
WP_011054967.1|1450903_1453732_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	1.0e-305
WP_011888617.1|1453934_1454879_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_010922629.1|1455011_1455668_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983142.1|1455800_1456040_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983122.1|1456204_1456696_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
WP_002983117.1|1456717_1457008_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002983113.1|1457180_1457474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011018188.1|1457671_1458796_+	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	1.3e-22
WP_032462795.1|1458871_1459459_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001162959.1|1459510_1459825_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.3	8.6e-17
WP_076612467.1|1459905_1460409_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032462794.1|1460409_1462749_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	47.7	1.3e-19
WP_002993250.1|1462897_1463443_-	CvpA family protein	NA	NA	NA	NA	NA
WP_002993251.1|1463445_1463754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032462793.1|1463910_1464813_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_032462792.1|1464823_1465417_+	signal peptidase I	NA	NA	NA	NA	NA
WP_032462791.1|1465474_1467928_+	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	28.7	2.2e-59
WP_020837717.1|1468019_1468502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032462790.1|1468549_1469644_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002988233.1|1469852_1472180_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	4.2e-116
>prophage 83
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1475576	1476524	1791401		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_010922640.1|1475576_1476524_-	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.9	7.6e-24
>prophage 84
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1481331	1486077	1791401		Staphylococcus_phage(50.0%)	7	NA	NA
WP_002988211.1|1481331_1481553_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	41.2	4.8e-06
WP_002992262.1|1481722_1482097_+	helix-turn-helix transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	51.6	2.1e-17
WP_002992264.1|1482289_1482589_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002992265.1|1482645_1483383_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020837730.1|1483535_1484162_-	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	28.2	1.7e-11
WP_002982955.1|1484171_1484753_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_021733774.1|1484907_1486077_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.0	5.5e-16
>prophage 85
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1490533	1494875	1791401	tRNA	Moraxella_phage(50.0%)	5	NA	NA
WP_002988178.1|1490533_1491562_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.7	2.5e-57
WP_011106599.1|1491551_1491977_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002992279.1|1491978_1492677_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002982907.1|1492960_1493191_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002982901.1|1493192_1494875_+	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	31.3	1.5e-06
>prophage 86
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1500212	1501103	1791401		Klosneuvirus(100.0%)	1	NA	NA
WP_002982880.1|1500212_1501103_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	37.0	1.5e-37
>prophage 87
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1506412	1508017	1791401		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_032462786.1|1506412_1508017_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	5.4e-139
>prophage 88
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1521995	1527773	1791401		Staphylococcus_phage(66.67%)	3	NA	NA
WP_032463024.1|1521995_1524974_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.9	1.7e-24
WP_014635701.1|1524986_1526180_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.3	9.6e-16
WP_014407840.1|1526192_1527773_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.2	1.2e-119
>prophage 89
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1532420	1534639	1791401		Planktothrix_phage(50.0%)	2	NA	NA
WP_032463026.1|1532420_1533158_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	8.8e-28
WP_080277850.1|1533154_1534639_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.6	1.6e-20
>prophage 90
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1545755	1546529	1791401		Escherichia_phage(100.0%)	1	NA	NA
WP_023605292.1|1545755_1546529_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	2.5e-17
>prophage 91
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1550121	1550328	1791401		Clostridioides_phage(100.0%)	1	NA	NA
WP_002982695.1|1550121_1550328_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
>prophage 92
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1554637	1555981	1791401	tRNA	Catovirus(100.0%)	1	NA	NA
WP_002982667.1|1554637_1555981_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.1	6.5e-53
>prophage 93
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1560465	1561194	1791401		Synechococcus_phage(100.0%)	1	NA	NA
WP_015057277.1|1560465_1561194_-	transaldolase	NA	H8ZNI7	Synechococcus_phage	33.8	3.8e-15
>prophage 94
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1566345	1577798	1791401	tRNA,protease	Synechococcus_phage(25.0%)	8	NA	NA
WP_002982624.1|1566345_1566960_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.3e-13
WP_023611190.1|1566993_1567536_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002982615.1|1567666_1568095_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032463034.1|1568204_1572602_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.7e-17
WP_032463035.1|1572855_1574712_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	24.6	4.1e-05
WP_032463036.1|1574909_1576169_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002982606.1|1576241_1577036_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_032463037.1|1577048_1577798_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.0	2.1e-21
>prophage 95
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1584423	1585557	1791401		Bacillus_virus(100.0%)	1	NA	NA
WP_002993686.1|1584423_1585557_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.9	1.1e-24
>prophage 96
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1588920	1591140	1791401		Vibrio_phage(100.0%)	1	NA	NA
WP_032463041.1|1588920_1591140_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6L1R3	Vibrio_phage	39.5	6.8e-07
>prophage 97
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1594765	1596952	1791401		Vibrio_phage(100.0%)	1	NA	NA
WP_032463044.1|1594765_1596952_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	40.5	9.7e-06
>prophage 98
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1601884	1606815	1791401		Pandoravirus(25.0%)	4	NA	NA
WP_032463049.1|1601884_1603642_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	30.7	2.2e-40
WP_011055042.1|1603674_1604241_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	7.0e-33
WP_023605317.1|1604273_1605542_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	3.4e-96
WP_023080127.1|1606113_1606815_+	streptococcal mitogenic exotoxin SmeZ	NA	A0EX09	Staphylococcus_phage	30.3	2.8e-15
>prophage 99
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1611092	1612788	1791401		Anomala_cuprea_entomopoxvirus(33.33%)	3	NA	NA
WP_023080139.1|1611092_1611896_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	6.5e-08
WP_032463050.1|1611879_1612506_+	ABC transporter ATP-binding protein	NA	A0A2H4P6Z4	Pseudomonas_phage	25.5	1.4e-05
WP_002982507.1|1612587_1612788_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	86.4	1.3e-21
>prophage 100
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1628328	1634092	1791401		Staphylococcus_phage(25.0%)	5	NA	NA
WP_032463058.1|1628328_1629954_-	CHAP domain-containing protein	NA	A0A1P8CMP9	Staphylococcus_phage	44.6	4.5e-08
WP_032463059.1|1630055_1631444_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.7	1.6e-09
WP_002991237.1|1631440_1632094_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.7e-28
WP_002993552.1|1632187_1633405_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053301468.1|1633417_1634092_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.4e-32
>prophage 101
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1642185	1648199	1791401		Streptococcus_phage(25.0%)	5	NA	NA
WP_010922721.1|1642185_1643001_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	6.7e-29
WP_002982381.1|1643364_1643874_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	1.4e-37
WP_002992097.1|1643955_1645044_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_009880865.1|1645100_1645769_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	34.3	9.7e-26
WP_014635759.1|1645781_1648199_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
>prophage 102
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1652535	1653309	1791401		Escherichia_phage(100.0%)	1	NA	NA
WP_002992110.1|1652535_1653309_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
>prophage 103
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1657450	1658269	1791401		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_080277861.1|1657450_1658269_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	3.1e-05
>prophage 104
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1662845	1671382	1791401	protease	uncultured_virus(25.0%)	7	NA	NA
WP_002982320.1|1662845_1664477_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	1.8e-153
WP_002991292.1|1664512_1664803_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_032463064.1|1664980_1667425_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.0	1.8e-122
WP_002982312.1|1667424_1667886_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1668081_1668285_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
WP_002982304.1|1669268_1669829_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032463065.1|1669849_1671382_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.5	1.4e-43
>prophage 105
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1680533	1682075	1791401		Catovirus(100.0%)	1	NA	NA
WP_032463068.1|1680533_1682075_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.4	1.5e-98
>prophage 106
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1688762	1690658	1791401		Klosneuvirus(100.0%)	1	NA	NA
WP_011285757.1|1688762_1690658_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.8e-72
>prophage 107
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1697212	1702740	1791401		Enterococcus_phage(66.67%)	5	NA	NA
WP_032463074.1|1697212_1697944_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.4	1.9e-35
WP_021775544.1|1698117_1698732_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.1e-52
WP_011055085.1|1698746_1699241_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032463075.1|1699249_1700185_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002992831.1|1700541_1702740_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
>prophage 108
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1706613	1740766	1791401	bacteriocin,tRNA,integrase,holin	Streptococcus_phage(45.45%)	40	1713545:1713565	1726951:1726971
WP_002992179.1|1706613_1707750_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.4e-120
WP_002992182.1|1707838_1709110_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_023080288.1|1709178_1709739_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002992186.1|1709748_1710345_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002992187.1|1710346_1711567_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	3.5e-05
WP_032463076.1|1711577_1713560_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.9e-62
1713545:1713565	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_022555250.1|1713642_1714788_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	3.5e-84
WP_011185066.1|1715042_1715186_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003058809.1|1716056_1716824_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1716977_1717184_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_080277853.1|1717217_1717985_+	Bro-N domain-containing protein	NA	A0A0A7S0G2	Clostridium_phage	53.7	5.0e-26
WP_032463077.1|1717994_1718612_+	Bro-N domain-containing protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	43.0	3.8e-40
WP_080277854.1|1718611_1718881_+	phage antirepressor protein	NA	NA	NA	NA	NA
WP_032463079.1|1719136_1719478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058793.1|1719464_1719686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032463080.1|1719688_1719880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|1719891_1720221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|1720223_1720496_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_032463081.1|1720496_1721354_+	primase alpha helix C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.2	2.4e-125
WP_032463082.1|1721322_1723011_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_000694577.1|1723297_1723471_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_032463083.1|1723651_1724161_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	3.2e-29
WP_023080239.1|1724234_1724723_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	5.2e-45
WP_010922770.1|1725126_1725489_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	30.8	3.5e-06
WP_010922771.1|1725463_1725847_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	42.1	3.7e-14
WP_032463084.1|1726047_1726698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032463085.1|1727094_1729650_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	2.8e-44
1726951:1726971	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_002982173.1|1729636_1729843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002993102.1|1729985_1730423_-	arginine repressor	NA	NA	NA	NA	NA
WP_002993104.1|1730713_1732405_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	1.9e-73
WP_002993106.1|1732492_1732801_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002982164.1|1732827_1733700_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.6	2.1e-52
WP_002991372.1|1733742_1734621_-	YitT family protein	NA	NA	NA	NA	NA
WP_002993108.1|1734640_1735582_-	YitT family protein	NA	NA	NA	NA	NA
WP_014635787.1|1735574_1737323_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.6	2.7e-11
WP_032463086.1|1737660_1738941_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.6	1.4e-25
WP_000290414.1|1739160_1739343_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002982147.1|1739358_1739508_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011285293.1|1739789_1740416_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002995294.1|1740427_1740766_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	1.0e-10
>prophage 109
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1752913	1754281	1791401		Streptococcus_phage(100.0%)	1	NA	NA
WP_080277856.1|1752913_1754281_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.5	2.3e-154
>prophage 110
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1763328	1783721	1791401	tRNA	Streptococcus_phage(20.0%)	18	NA	NA
WP_002982071.1|1763328_1763943_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	74.1	4.7e-27
WP_002982068.1|1764313_1765114_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002982066.1|1765106_1765949_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.8e-16
WP_002982063.1|1765924_1766815_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-20
WP_002992390.1|1766765_1767308_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011055110.1|1767321_1768347_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032463092.1|1768396_1769686_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	31.4	3.3e-14
WP_011055112.1|1769687_1770932_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	38.9	1.8e-86
WP_021775371.1|1771369_1772629_+	hyaluronan synthase HasA	NA	NA	NA	NA	NA
WP_002992300.1|1772664_1773873_+	UDP-glucose 6-dehydrogenase HasB	NA	M1HM57	Paramecium_bursaria_Chlorella_virus	46.8	1.5e-96
WP_002982024.1|1774054_1774969_+	UTP--glucose-1-phosphate uridylyltransferase HasC	NA	A0A127AW70	Bacillus_phage	51.5	6.3e-76
WP_010922800.1|1775276_1775690_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	72.0	1.5e-21
WP_014635799.1|1775691_1776798_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002992310.1|1776854_1777718_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_002991454.1|1777920_1779402_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	3.4e-95
WP_002991455.1|1779709_1780732_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002982011.1|1781150_1782023_+	YitT family protein	NA	NA	NA	NA	NA
WP_002981986.1|1782101_1783721_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.2e-45
>prophage 111
NZ_CP010450	Streptococcus pyogenes strain NGAS638, complete genome	1791401	1787250	1790539	1791401	transposase	Staphylococcus_prophage(50.0%)	3	NA	NA
WP_020837855.1|1787250_1788237_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	3.3e-38
WP_002994924.1|1788625_1789105_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002994926.1|1789315_1790539_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	2.6e-16
