The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	0	2883	1950469		Rhizobium_phage(100.0%)	2	NA	NA
WP_002987659.1|236_1592_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_002987661.1|1746_2883_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	24.9	1.2e-23
>prophage 2
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	10954	14789	1950469	tRNA	Phaeocystis_globosa_virus(50.0%)	3	NA	NA
WP_010921767.1|10954_12241_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.8	1.6e-16
WP_002981912.1|12245_12788_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002981901.1|12809_14789_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	47.2	8.8e-107
>prophage 3
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	29807	58018	1950469		Synechococcus_phage(23.08%)	23	NA	NA
WP_110002949.1|29807_30011_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	52.2	2.3e-07
WP_053308131.1|31196_32396_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_002986722.1|32648_33611_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	8.2e-42
WP_002986719.1|33796_34552_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_053308132.1|34654_35662_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_014407187.1|35654_35897_+	putative acyl carrier protein	NA	NA	NA	NA	NA
WP_011017229.1|36017_36752_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.1	5.1e-44
WP_053308133.1|36875_40601_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	7.8e-40
WP_053308134.1|40761_42216_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.4e-53
WP_053308135.1|42243_43266_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	40.8	2.0e-62
WP_002986700.1|43433_43988_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_023612109.1|44171_45719_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_053308136.1|45776_46901_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	1.3e-06
WP_053308137.1|47153_48419_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_041174354.1|48696_49188_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
WP_080370122.1|49138_50248_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011888524.1|50249_51668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407197.1|51688_52981_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	8.5e-18
WP_002986681.1|53111_54023_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053308139.1|54248_55247_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.8	2.8e-08
WP_002994668.1|55384_55822_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012560369.1|55844_56246_+	membrane protein	NA	NA	NA	NA	NA
WP_053308140.1|56242_58018_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.2	4.0e-18
>prophage 4
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	61220	62237	1950469		Tupanvirus(100.0%)	1	NA	NA
WP_014407201.1|61220_62237_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.9	8.7e-26
>prophage 5
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	88063	101287	1950469	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_010921791.1|88063_88783_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_010921792.1|88775_89591_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053308144.1|89630_90014_-	HIT family protein	NA	NA	NA	NA	NA
WP_053308145.1|90064_91321_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.8	1.5e-72
WP_020904829.1|91412_93725_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_053308146.1|93988_97555_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.0	1.2e-50
WP_030126920.1|97645_101287_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	1.6e-66
>prophage 6
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	108396	113436	1950469	tRNA	Streptococcus_phage(66.67%)	8	NA	NA
WP_011284426.1|108396_109167_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.0	1.0e-31
WP_011284427.1|109214_110282_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002986521.1|110391_110556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024623420.1|110746_111028_+	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
WP_053308151.1|111027_111345_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002986511.1|111362_111989_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_046177419.1|112139_112535_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	46.2	1.7e-25
WP_002986504.1|112794_113436_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	49.5	2.4e-53
>prophage 7
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	148426	153683	1950469		Streptococcus_phage(50.0%)	4	NA	NA
WP_053308163.1|148426_149689_-	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	68.1	2.2e-148
WP_014635244.1|149701_150580_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	40.2	1.7e-25
WP_002986406.1|151018_152311_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.5	1.9e-70
WP_075340190.1|152654_153683_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	40.5	1.3e-61
>prophage 8
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	161034	164886	1950469	tRNA	Pandoravirus(50.0%)	2	NA	NA
WP_011017287.1|161034_162174_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	29.5	4.4e-18
WP_053308166.1|162384_164886_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.7	0.0e+00
>prophage 9
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	173712	183122	1950469		Bacillus_virus(25.0%)	8	NA	NA
WP_002986345.1|173712_174909_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	4.0e-30
WP_053308170.1|174926_176654_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_053308171.1|176784_179427_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	1.5e-64
WP_002986334.1|179613_180069_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|180120_180588_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_009880534.1|180743_181043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053308172.1|181264_182599_+	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	39.5	1.2e-86
WP_002987925.1|182591_183122_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	68.6	7.1e-64
>prophage 10
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	187383	191036	1950469	transposase,tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_136275321.1|187383_188615_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.8	2.0e-64
WP_014407270.1|188811_189675_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986321.1|189711_189897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528208.1|189893_191036_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	3.8e-86
>prophage 11
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	202937	210560	1950469		Bacillus_phage(75.0%)	7	NA	NA
WP_002986125.1|202937_203837_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_002986123.1|203869_204886_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002986120.1|205183_205633_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053308177.1|205625_207332_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-36
WP_002992923.1|207334_209119_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.3e-44
WP_032460443.1|209236_210004_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002986111.1|210113_210560_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	52.8	4.5e-35
>prophage 12
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	213711	215157	1950469	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_053308179.1|213711_215157_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	5.2e-08
>prophage 13
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	237861	238701	1950469		Streptococcus_phage(100.0%)	1	NA	NA
WP_002992072.1|237861_238701_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	30.8	1.4e-05
>prophage 14
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	242791	247452	1950469		Streptococcus_phage(50.0%)	4	NA	NA
WP_002986045.1|242791_244870_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	1.6e-63
WP_002986042.1|245217_246228_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000818733.1|246453_246570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002991131.1|246711_247452_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.4e-25
>prophage 15
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	254245	260840	1950469		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_002986023.1|254245_255016_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.8e-07
WP_053308190.1|255110_256373_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011054183.1|256403_257630_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.8	7.9e-106
WP_002986018.1|257616_258096_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002986015.1|258088_259507_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_053308191.1|259658_260840_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	7.0e-11
>prophage 16
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	267042	269029	1950469		Bacillus_virus(50.0%)	2	NA	NA
WP_010921893.1|267042_268113_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	4.0e-13
WP_002986000.1|268105_269029_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-21
>prophage 17
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	282204	283809	1950469		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_053308195.1|282204_283809_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	9.2e-139
>prophage 18
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	289116	290007	1950469		Klosneuvirus(100.0%)	1	NA	NA
WP_053308198.1|289116_290007_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.6	3.0e-38
>prophage 19
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	295332	299674	1950469	tRNA	Cellulophaga_phage(50.0%)	5	NA	NA
WP_002982901.1|295332_297015_-	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	31.3	1.5e-06
WP_002982907.1|297016_297247_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002992279.1|297530_298229_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002992278.1|298230_298656_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002988178.1|298645_299674_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.7	2.5e-57
>prophage 20
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	304130	312620	1950469		Staphylococcus_phage(40.0%)	11	NA	NA
WP_009880895.1|304130_305300_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.0	5.5e-16
WP_030126283.1|305560_305899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053308202.1|305966_307949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020905458.1|307945_308569_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	7.2e-23
WP_023611607.1|308565_309057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080370123.1|309209_309791_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_080370124.1|309800_310427_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	28.7	2.6e-12
WP_032460457.1|310578_311307_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002988205.1|311362_311662_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002992262.1|311854_312229_-	helix-turn-helix transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	51.6	2.1e-17
WP_002988211.1|312398_312620_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	41.2	4.8e-06
>prophage 21
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	317427	318375	1950469		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_076707668.1|317427_318375_+	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.6	9.9e-24
>prophage 22
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	321770	347411	1950469		Bacillus_phage(20.0%)	26	NA	NA
WP_053308208.1|321770_324098_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	3.2e-116
WP_020905451.1|324306_325401_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_023611615.1|325493_325976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308209.1|326066_328520_-	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	28.5	7.2e-58
WP_002983074.1|328577_329171_-	signal peptidase I	NA	NA	NA	NA	NA
WP_053308210.1|329181_330084_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002993251.1|330240_330549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983087.1|330551_331097_+	CvpA family protein	NA	NA	NA	NA	NA
WP_053308211.1|331245_333585_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	3.3e-20
WP_010922632.1|333585_334089_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_001162959.1|334169_334484_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.3	8.6e-17
WP_010922631.1|334535_335123_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011018188.1|335198_336323_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	1.3e-22
WP_002983113.1|336520_336814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053308212.1|336986_337277_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002983122.1|337298_337790_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
WP_002983142.1|337954_338194_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983144.1|338324_338981_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983147.1|339112_340057_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_053308213.1|340259_343088_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	2.2e-305
WP_053308214.1|343202_344276_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	1.7e-16
WP_002988493.1|344310_344772_+	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_002988496.1|344867_345425_+	elongation factor P	NA	NA	NA	NA	NA
WP_002983163.1|345470_345860_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988501.1|345852_346305_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_014635676.1|346445_347411_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
>prophage 23
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	360780	363479	1950469		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_010922619.1|360780_361881_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	2.0e-31
WP_053308219.1|361967_363479_+	CHAP domain-containing protein	NA	W5R8Q8	Staphylococcus_phage	41.7	1.9e-05
>prophage 24
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	369757	384768	1950469		Organic_Lake_phycodnavirus(28.57%)	12	NA	NA
WP_053308222.1|369757_370780_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.5	1.2e-14
WP_053308223.1|370776_371613_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	6.1e-17
WP_053308224.1|371609_373373_+	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.3e-21
WP_053308225.1|373365_375036_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.9	6.4e-18
WP_002983234.1|375032_375626_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_053308226.1|375622_376303_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_080370127.1|376299_377694_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	3.4e-12
WP_002983248.1|378067_380083_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_002991995.1|380374_381277_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_002988556.1|381289_381994_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002983258.1|382342_383308_-	asparaginase	NA	NA	NA	NA	NA
WP_009881044.1|383379_384768_+	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	2.1e-22
>prophage 25
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	387934	388489	1950469		Bacillus_virus(100.0%)	1	NA	NA
WP_002992568.1|387934_388489_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	1.2e-24
>prophage 26
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	397695	400939	1950469		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_002983316.1|397695_399522_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.5	1.1e-130
WP_002993772.1|399802_400939_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	27.3	2.8e-17
>prophage 27
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	405845	406580	1950469		Bacillus_phage(100.0%)	1	NA	NA
WP_002988615.1|405845_406580_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	40.8	1.1e-06
>prophage 28
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	412017	413295	1950469	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032460226.1|412017_413295_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.5	3.0e-92
>prophage 29
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	418406	419867	1950469		Moraxella_phage(100.0%)	1	NA	NA
WP_032461169.1|418406_419867_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.8	4.1e-37
>prophage 30
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	423227	423953	1950469		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002983379.1|423227_423953_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
>prophage 31
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	429233	437727	1950469		Cafeteria_roenbergensis_virus(33.33%)	9	NA	NA
WP_030126326.1|429233_432095_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
WP_053308234.1|432113_432308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880813.1|432294_432651_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_009880812.1|432703_433705_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032460219.1|433867_434305_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_080370167.1|434334_436536_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.3	9.1e-113
WP_032460217.1|436549_436753_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011285670.1|436759_436930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032460216.1|436956_437727_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	4.9e-21
>prophage 32
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	444587	451191	1950469		Streptococcus_phage(50.0%)	6	NA	NA
WP_010922569.1|444587_445145_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	3.2e-14
WP_002988852.1|445437_446280_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.9	1.3e-91
WP_053308236.1|446408_447131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032460211.1|447332_448964_+	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_011054915.1|449081_450230_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002994275.1|450351_451191_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.9e-51
>prophage 33
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	460233	460935	1950469		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_053308239.1|460233_460935_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	37.5	3.1e-30
>prophage 34
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	464004	471841	1950469	bacteriocin	Streptococcus_phage(50.0%)	7	NA	NA
WP_002983569.1|464004_464649_+	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	44.2	2.2e-43
WP_053308693.1|464866_466852_+	transketolase	NA	NA	NA	NA	NA
WP_002988878.1|467044_467311_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002988881.1|467344_468079_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	3.3e-27
WP_053308241.1|468083_469712_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023611731.1|469776_470598_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.8	4.7e-38
WP_002983580.1|470590_471841_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.8	1.3e-116
>prophage 35
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	477087	490228	1950469		Bacillus_virus(42.86%)	11	NA	NA
WP_053308242.1|477087_478431_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.7	6.1e-43
WP_053308243.1|478625_479429_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023079948.1|479428_480172_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	8.0e-29
WP_002988906.1|480275_480500_+	DUF4059 family protein	NA	NA	NA	NA	NA
WP_053308244.1|480563_481481_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	2.9e-89
WP_053308245.1|481649_483029_+	amino acid permease	NA	NA	NA	NA	NA
WP_053308246.1|483199_484660_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.0	1.9e-98
WP_053308247.1|484656_485481_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.8	1.2e-70
WP_002983616.1|485665_487003_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	37.0	1.4e-68
WP_031488498.1|487467_489633_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002983622.1|489619_490228_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.9	3.2e-23
>prophage 36
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	496453	518492	1950469	tRNA	Streptococcus_phage(33.33%)	21	NA	NA
WP_023611644.1|496453_497233_-	3-hydroxybutyrate dehydrogenase	NA	G8EDD5	Acanthamoeba_castellanii_mamavirus	26.7	3.1e-07
WP_053308251.1|497265_497925_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_014407746.1|497926_498577_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_002992509.1|498600_499788_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_010922543.1|499986_500883_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	2.5e-08
WP_014407744.1|501012_502620_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_002983649.1|502729_503365_+	guanylate kinase	NA	S4VT50	Pandoravirus	45.3	4.9e-11
WP_002983650.1|503380_503698_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_053308252.1|503762_506147_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_053308253.1|506208_507144_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_053308254.1|507133_508456_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032460192.1|508493_509234_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002994648.1|509230_511129_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.7	1.4e-21
WP_002983667.1|511200_511944_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002991890.1|511940_512945_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002983671.1|512937_513579_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053308255.1|513615_515016_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	42.9	3.5e-25
WP_032464495.1|515015_515393_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011528853.1|515410_516352_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.6	6.0e-130
WP_002983676.1|516479_517112_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	5.5e-63
WP_053308256.1|517166_518492_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	51.3	2.4e-116
>prophage 37
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	528951	530307	1950469		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_053308259.1|528951_530307_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	2.0e-73
>prophage 38
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	546814	548539	1950469		Enterobacteria_phage(100.0%)	1	NA	NA
WP_053308267.1|546814_548539_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	4.5e-14
>prophage 39
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	556598	557672	1950469		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_053308271.1|556598_557672_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.6	7.3e-31
>prophage 40
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	560817	566981	1950469		Streptococcus_phage(66.67%)	4	NA	NA
WP_002994058.1|560817_562770_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	8.9e-144
WP_002990455.1|563126_564851_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|564982_565441_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|565673_566981_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
>prophage 41
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	583249	584173	1950469		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002990429.1|583249_584173_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
>prophage 42
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	590004	593693	1950469		Pneumococcus_phage(33.33%)	3	NA	NA
WP_023613067.1|590004_590505_+	QueT transporter	NA	E7DN70	Pneumococcus_phage	31.8	4.2e-05
WP_011284658.1|590698_592657_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	7.6e-103
WP_002985252.1|592670_593693_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
>prophage 43
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	603401	604445	1950469	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003057440.1|603401_604445_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
>prophage 44
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	609084	610774	1950469		Planktothrix_phage(50.0%)	2	NA	NA
WP_023610402.1|609084_609753_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-30
WP_053308279.1|609856_610774_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-33
>prophage 45
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	614136	628362	1950469		Bacillus_virus(20.0%)	12	NA	NA
WP_053308695.1|614136_617769_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.3	1.6e-21
WP_014635388.1|617908_618721_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000048058.1|618861_619038_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002990299.1|619165_619528_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_080370131.1|619684_621472_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	28.6	4.4e-41
WP_002985187.1|621480_622590_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	35.1	2.0e-36
WP_002990295.1|622825_623164_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_002990293.1|623301_624156_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.3	6.8e-32
WP_032464281.1|624274_625429_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_053308281.1|625418_626351_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010922132.1|626395_627157_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985176.1|627156_628362_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.5e-12
>prophage 46
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	633785	634481	1950469		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_002985169.1|633785_634481_+	glycosyltransferase family 2 protein	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	28.2	8.3e-12
>prophage 47
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	640991	663726	1950469	tRNA,protease	Streptococcus_phage(30.77%)	24	NA	NA
WP_002985152.1|640991_641522_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.8	3.5e-10
WP_002985151.1|641563_641761_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002985149.1|641819_642179_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_052117641.1|642469_644680_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	5.0e-268
WP_053308287.1|644787_645951_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	1.3e-142
WP_023610850.1|645947_646634_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	5.4e-88
WP_002990262.1|646727_647894_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_011054350.1|647954_648296_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	1.3e-18
WP_053308288.1|648516_649869_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	2.4e-31
WP_053308289.1|649956_651225_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|651254_651695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308290.1|651929_653072_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	6.3e-25
WP_053308291.1|653083_654298_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002985117.1|654335_655628_+	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	30.8	2.9e-34
WP_002985116.1|655841_656156_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002985112.1|656167_656494_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985110.1|656521_656815_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002985099.1|657162_658077_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012560604.1|658073_658532_+	signal peptidase II	NA	NA	NA	NA	NA
WP_002985094.1|658521_659412_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	3.6e-07
WP_002985093.1|659807_660329_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_004218945.1|660344_661604_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.2	2.7e-61
WP_004218947.1|661664_662600_+	aspartate carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.6	3.0e-25
WP_002985087.1|662643_663726_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.9	4.7e-62
>prophage 48
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	668648	669335	1950469		Planktothrix_phage(100.0%)	1	NA	NA
WP_002993627.1|668648_669335_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.0	2.5e-37
>prophage 49
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	680763	689299	1950469		Streptococcus_phage(25.0%)	8	NA	NA
WP_053308295.1|680763_681756_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.9	8.2e-29
WP_014407495.1|681933_682992_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_002990217.1|683004_683928_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002990215.1|684183_684897_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.1	3.2e-19
WP_002992553.1|684893_685805_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_010922158.1|685801_687748_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002990208.1|687840_688440_+	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	33.8	3.6e-11
WP_002990206.1|688591_689299_+	glycoside hydrolase family 73 protein	NA	Q332B8	Clostridium_botulinum_C_phage	36.4	1.9e-11
>prophage 50
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	693555	701560	1950469	tRNA	unidentified_phage(25.0%)	7	NA	NA
WP_074375308.1|693555_694749_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.0	4.0e-38
WP_053308298.1|694745_696623_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.3e-64
WP_014407501.1|697040_697259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984994.1|697514_697925_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	30.6	6.9e-06
WP_053308299.1|698006_700019_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_053308300.1|700238_700889_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002984985.1|700891_701560_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.8	2.3e-19
>prophage 51
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	709757	716380	1950469	protease	Bacillus_phage(50.0%)	7	NA	NA
WP_011017679.1|709757_710597_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	1.7e-83
WP_053308303.1|710676_711174_+	dihydrofolate reductase	NA	W5QU76	Bacillus_phage	31.6	1.1e-10
WP_002990165.1|711193_711364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984948.1|711493_712723_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	7.8e-138
WP_053308304.1|712732_713332_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002984942.1|713479_714223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053308305.1|714280_716380_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.4	4.3e-120
>prophage 52
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	720070	721304	1950469		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_053308307.1|720070_720511_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.0	3.2e-33
WP_053308308.1|720494_721304_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	42.6	3.9e-53
>prophage 53
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	730307	737694	1950469		Bacillus_virus(66.67%)	5	NA	NA
WP_009880722.1|730307_730961_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	40.5	8.0e-41
WP_011285490.1|731092_732361_+	dihydroorotase	NA	NA	NA	NA	NA
WP_002984911.1|732418_733060_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_011527591.1|733191_735144_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.0	4.3e-122
WP_023611132.1|735234_737694_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.1	1.4e-98
>prophage 54
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	749609	753252	1950469		Bacillus_phage(33.33%)	3	NA	NA
WP_053308317.1|749609_751820_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	5.1e-71
WP_002990109.1|751969_752488_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_053308318.1|752568_753252_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	1.3e-09
>prophage 55
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	756645	759392	1950469		Escherichia_phage(66.67%)	3	NA	NA
WP_014407521.1|756645_757515_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
WP_002990099.1|757514_758108_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_053308323.1|758351_759392_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	8.5e-69
>prophage 56
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	762623	767597	1950469		Only_Syngen_Nebraska_virus(50.0%)	5	NA	NA
WP_014407524.1|762623_764276_-	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_023611161.1|764629_765628_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011888921.1|765632_765797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002991975.1|765972_766842_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989991.1|766838_767597_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
>prophage 57
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	770781	772689	1950469		Tupanvirus(100.0%)	1	NA	NA
WP_014407529.1|770781_772689_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
>prophage 58
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	776919	778683	1950469		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_053308326.1|776919_778683_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	1.3e-32
>prophage 59
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	782011	783001	1950469		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002984861.1|782011_783001_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	4.1e-12
>prophage 60
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	800278	802111	1950469		Tupanvirus(100.0%)	1	NA	NA
WP_023612832.1|800278_802111_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
>prophage 61
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	808246	809896	1950469		Enterobacteria_phage(100.0%)	1	NA	NA
WP_011017726.1|808246_809896_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
>prophage 62
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	823145	827373	1950469		Bacillus_phage(50.0%)	4	NA	NA
WP_002984807.1|823145_823832_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.3	4.5e-18
WP_053308337.1|823824_825171_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002984803.1|825327_825468_+	lantibiotic streptin	NA	NA	NA	NA	NA
WP_038434071.1|825582_827373_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.5	1.1e-18
>prophage 63
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	831591	832281	1950469		Staphylococcus_phage(100.0%)	1	NA	NA
WP_019418719.1|831591_832281_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.2	9.6e-53
>prophage 64
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	836037	853170	1950469		Stx2-converting_phage(14.29%)	17	NA	NA
WP_080370135.1|836037_837273_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.7	2.7e-13
WP_011017736.1|837389_838352_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053308344.1|838683_839961_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_080370136.1|839972_840581_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.8	1.7e-45
WP_053308345.1|840589_841381_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	8.0e-27
WP_002989868.1|841396_841756_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_002984757.1|841752_842253_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_014407559.1|842402_843290_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_053308346.1|843335_844490_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.7	6.8e-35
WP_002984743.1|844473_845268_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014407560.1|845264_846041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053308347.1|846033_847107_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002995342.1|847161_847827_-	response regulator	NA	W8CYM9	Bacillus_phage	29.1	7.2e-05
WP_023610287.1|847807_849349_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011054474.1|849509_850841_+	L-malate permease	NA	A0A140XAH4	Dickeya_phage	55.4	7.4e-17
WP_053308348.1|850872_852039_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_030125942.1|852120_853170_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	24.5	4.3e-12
>prophage 65
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	857979	891416	1950469		Bacillus_phage(17.65%)	33	NA	NA
WP_002984709.1|857979_858660_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	24.2	2.5e-13
WP_002989835.1|858661_859357_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002984705.1|859366_860011_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002989831.1|860262_860610_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_053308351.1|860599_861727_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.6	7.9e-36
WP_002984700.1|861723_862704_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.7	1.1e-36
WP_002984698.1|862843_863422_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002984696.1|863509_864181_+	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	28.9	2.4e-08
WP_053308352.1|864155_864992_+	NAD kinase	NA	NA	NA	NA	NA
WP_053308353.1|864988_865894_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.4	6.2e-07
WP_002984691.1|865897_866893_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_038432964.1|867018_867774_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	4.7e-08
WP_053308354.1|867967_868657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003054030.1|869076_869805_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.1	1.0e-15
WP_080370137.1|869791_871324_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_053308356.1|871601_872585_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.8	5.6e-139
WP_002984677.1|872889_873471_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014635461.1|873470_874754_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.0	1.0e-31
WP_011054484.1|874817_875756_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002984671.1|875808_875994_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002989802.1|876131_876701_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	57.0	1.8e-52
WP_002994969.1|876735_877815_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002989798.1|877814_878654_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011888878.1|878637_879228_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.1	5.2e-15
WP_020833473.1|879245_879698_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053308357.1|879687_880944_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	1.9e-94
WP_002984655.1|880950_881928_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_053308358.1|881928_882528_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	40.9	2.5e-20
WP_023080261.1|882537_884262_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	9.2e-36
WP_053308359.1|884258_885986_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	7.3e-49
WP_002984646.1|886226_887597_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	1.1e-10
WP_002984645.1|887755_888739_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002984643.1|888929_891416_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.7e-104
>prophage 66
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	896890	903365	1950469		Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
WP_053308361.1|896890_897682_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	7.5e-25
WP_014407585.1|897746_898583_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.1	5.5e-34
WP_014407586.1|898690_900820_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	7.3e-99
WP_002989766.1|900894_901377_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_094979375.1|901653_901752_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009880715.1|902372_903365_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	34.5	1.0e-42
>prophage 67
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	922720	923791	1950469		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038432344.1|922720_923791_-	tyrosine recombinase XerS	NA	A0A2D2W391	Mycobacterium_phage	26.7	5.2e-05
>prophage 68
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	929479	937109	1950469		Hokovirus(33.33%)	6	NA	NA
WP_009880616.1|929479_931042_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.9	8.4e-20
WP_002984581.1|931083_932307_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_010922338.1|932671_934237_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.2e-50
WP_002984574.1|934349_934907_-	membrane protein	NA	NA	NA	NA	NA
WP_002992577.1|934884_935751_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_011054517.1|935840_937109_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	52.8	7.1e-102
>prophage 69
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	941717	944470	1950469		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_010922342.1|941717_942737_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.6	5.1e-10
WP_009880443.1|942783_943665_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_053308370.1|943657_944470_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.5	5.0e-32
>prophage 70
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	948744	1058043	1950469	capsid,terminase,holin,tail,portal,head,tRNA,integrase,protease	Streptococcus_phage(46.05%)	121	994149:994165	1057141:1057157
WP_002984544.1|948744_949290_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	35.2	9.1e-22
WP_053308372.1|949347_949917_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_010922348.1|950092_951811_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	84.4	6.3e-279
WP_010922349.1|952023_952980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002984537.1|952981_954046_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989703.1|954038_955571_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	4.0e-14
WP_002989701.1|955709_956762_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	38.8	1.9e-55
WP_011285547.1|956855_957245_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_053308373.1|957897_958491_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014407609.1|958758_959679_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.0	3.5e-34
WP_002989695.1|959747_959981_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011054528.1|960105_961416_-	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	25.3	1.2e-06
WP_002984519.1|961408_962083_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053308374.1|962429_964967_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	7.4e-74
WP_002984514.1|965171_965825_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002993892.1|965892_966651_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.8e-15
WP_002984509.1|966663_967467_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-15
WP_053308375.1|967482_968370_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_053308376.1|968359_969295_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_053308377.1|969305_970172_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	M1U9L0	Synechococcus_phage	24.2	2.9e-06
WP_011284823.1|970310_971621_-	23S rRNA methyltransferase	NA	NA	NA	NA	NA
WP_002984499.1|971623_972412_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_002984497.1|972401_972680_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_002984496.1|972681_973086_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002984494.1|973128_974061_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	6.4e-07
WP_038433366.1|974089_974974_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002989676.1|975089_976430_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002989673.1|976526_977483_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|977493_978090_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_053308378.1|978181_980806_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002989664.1|980820_981522_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_002984482.1|981639_982182_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|982324_982966_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984478.1|983128_983620_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|983627_983828_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|983868_984408_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|984420_984609_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|984619_985231_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|985267_985516_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002989648.1|985878_988197_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
WP_053308379.1|988726_990049_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_053308380.1|990168_991404_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_009880829.1|991773_992547_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_053308381.1|992918_993755_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053308382.1|993770_994400_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
994149:994165	attL	TTGAAAATCTTGGAAAA	NA	NA	NA	NA
WP_053308383.1|994412_995051_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|995157_995493_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_053308384.1|995688_997503_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.5e-97
WP_002984449.1|997679_998237_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|998451_999954_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|1000016_1001030_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_032462886.1|1001109_1004220_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
WP_002989617.1|1004404_1004776_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|1004775_1005474_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_053308385.1|1005483_1006269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053308386.1|1006399_1007014_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	2.8e-51
WP_011054546.1|1007604_1007793_-	hypothetical protein	NA	A3F673	Streptococcus_phage	84.7	1.2e-21
WP_014635496.1|1007907_1008696_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	2.0e-46
WP_053308387.1|1008977_1009676_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	58.3	2.0e-74
WP_014635498.1|1009995_1010862_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.0	4.5e-132
WP_011017840.1|1010849_1011374_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_023080015.1|1011512_1012157_-	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	77.2	4.0e-93
WP_002994484.1|1012266_1012959_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_011184580.1|1013191_1013749_-	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	87.0	4.1e-94
WP_053308388.1|1013860_1014316_-|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	4.0e-63
WP_011184581.1|1014331_1014937_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	92.5	9.3e-84
WP_011184582.1|1014939_1015368_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	8.6e-68
WP_014635500.1|1015379_1017266_-	hypothetical protein	NA	Q938J9	Temperate_phage	84.4	3.8e-216
WP_014635501.1|1017280_1018297_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	95.3	1.3e-175
WP_053308389.1|1018296_1020438_-	peptidase	NA	Q938K1	Temperate_phage	92.1	0.0e+00
WP_053308390.1|1020434_1021142_-	hypothetical protein	NA	Q938K2	Temperate_phage	69.8	9.2e-91
WP_053308391.1|1021141_1025065_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	50.8	3.4e-259
WP_053308392.1|1025274_1025601_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	1.9e-38
WP_053308393.1|1025653_1026262_-|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	70.8	4.8e-72
WP_023080046.1|1026277_1026703_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	1.0e-68
WP_023080034.1|1026699_1027077_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	76.0	6.7e-48
WP_023080042.1|1027073_1027421_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	83.6	1.6e-48
WP_023080032.1|1027417_1027720_-|head,tail	phage gp6-like head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	84.7	9.1e-40
WP_053308394.1|1027855_1029037_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.9	2.9e-158
WP_011017579.1|1029061_1029727_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
WP_011017578.1|1029704_1030925_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_002985363.1|1030958_1031183_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_053308700.1|1031342_1033097_-	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.4	0.0e+00
WP_032465789.1|1033096_1033330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023080043.1|1033332_1033800_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.1	1.1e-81
WP_021340284.1|1033971_1034313_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	2.5e-54
WP_010922071.1|1034616_1035051_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	95.8	4.5e-72
WP_011054751.1|1035491_1035998_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
WP_011054752.1|1035994_1036165_-	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	4.2e-26
WP_011054753.1|1036161_1036566_-	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
WP_002987593.1|1036575_1036845_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017568.1|1036841_1037126_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_011018138.1|1037367_1037724_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_080370142.1|1037707_1038058_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	89.4	5.8e-46
WP_014635521.1|1038011_1038881_-	hypothetical protein	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
WP_011017876.1|1039149_1040703_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	1.5e-210
WP_014635522.1|1040720_1041203_-	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	2.2e-59
WP_080007605.1|1041207_1042611_-	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.5	3.6e-195
WP_014635524.1|1042646_1043330_-	AAA family ATPase	NA	J7KC09	Streptococcus_phage	98.2	4.6e-124
WP_011284877.1|1043326_1043611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984315.1|1043607_1043802_-	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284878.1|1043801_1044131_-	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
WP_011017881.1|1044211_1044349_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011017882.1|1044345_1044642_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011054585.1|1044720_1044906_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1045072_1045312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1045461_1045671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984287.1|1045629_1045875_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	95.1	1.2e-34
WP_014635526.1|1045929_1046439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017885.1|1046569_1046779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992770.1|1046888_1047089_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
WP_014635527.1|1047182_1047854_+	DUF4145 domain-containing protein	NA	A0A1S5S8U0	Streptococcus_phage	39.9	7.0e-40
WP_014635529.1|1047970_1048129_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	1.3e-21
WP_014635530.1|1048187_1048403_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
WP_023080030.1|1048892_1049717_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	87.8	1.9e-124
WP_002984270.1|1049729_1050539_+	MazF family toxin-antitoxin system	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
WP_014635533.1|1050788_1051877_+|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	99.4	7.2e-204
WP_053308395.1|1052239_1052860_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_032465048.1|1053116_1055381_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_053308396.1|1055415_1056909_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_053308397.1|1057023_1058043_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	4.3e-17
1057141:1057157	attR	TTTTCCAAGATTTTCAA	NA	NA	NA	NA
>prophage 71
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1075822	1077361	1950469		Tupanvirus(100.0%)	1	NA	NA
WP_002989572.1|1075822_1077361_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	6.5e-41
>prophage 72
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1082137	1082878	1950469		Planktothrix_phage(100.0%)	1	NA	NA
WP_012560768.1|1082137_1082878_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.2e-35
>prophage 73
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1094780	1096011	1950469	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_136275321.1|1094780_1096011_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.8	2.0e-64
>prophage 74
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1101063	1152253	1950469	integrase,transposase	Streptococcus_phage(66.67%)	51	1106787:1106803	1143069:1143085
WP_080370144.1|1101063_1101678_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	95.9	2.3e-90
WP_053308407.1|1101894_1103682_-	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	52.5	2.4e-151
WP_053308408.1|1104412_1104823_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_053308702.1|1105092_1105500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000852880.1|1105802_1106204_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053308409.1|1106212_1106761_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	40.6	3.7e-15
WP_053308410.1|1106769_1107252_+	hypothetical protein	NA	NA	NA	NA	NA
1106787:1106803	attL	AGGATATATTTTATTAA	NA	NA	NA	NA
WP_053308411.1|1107244_1108327_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	51.5	9.1e-90
WP_000370326.1|1108496_1108853_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_053308703.1|1108854_1110186_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001825268.1|1110438_1110558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420682.1|1110580_1110895_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1110910_1111297_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_050140926.1|1111325_1112711_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	99.8	4.2e-265
WP_000879507.1|1112713_1112866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398284.1|1112888_1114094_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_001009056.1|1114136_1114358_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|1114474_1114972_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|1114946_1115453_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_002379942.1|1117882_1118569_+|transposase	IS6-like element ISEnfa1 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	4.8e-113
WP_000242080.1|1118765_1119596_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000933358.1|1119595_1120345_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002346952.1|1120337_1121255_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.2	4.6e-42
WP_000395511.1|1121437_1122052_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	46.8	5.5e-07
WP_053308412.1|1122041_1122239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001808810.1|1122404_1122569_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002379942.1|1122601_1123288_+|transposase	IS6-like element ISEnfa1 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	4.8e-113
WP_053308414.1|1124007_1126191_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	98.1	0.0e+00
WP_000769868.1|1126187_1127189_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_001224319.1|1127185_1128118_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-171
WP_011058339.1|1128392_1128479_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691727.1|1128494_1130414_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_011058338.1|1130514_1130700_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_001227347.1|1130759_1131113_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_013670292.1|1131317_1131389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005957428.1|1131617_1132043_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	98.6	1.4e-70
WP_001224508.1|1132039_1132270_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	88.2	2.6e-31
WP_148473227.1|1132500_1132728_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000814510.1|1132731_1132935_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	95.5	9.8e-30
WP_053308415.1|1133016_1134234_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	94.6	5.4e-224
WP_153308185.1|1134429_1134603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001176020.1|1135250_1135775_-	phosphotransferase	NA	NA	NA	NA	NA
WP_000810833.1|1135991_1136723_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	46.4	3.3e-51
WP_017771940.1|1136780_1136906_-	ErmCL family antibiotic resistance leader peptide	NA	NA	NA	NA	NA
WP_025194366.1|1137456_1139070_-	tetronasin resistance protein	NA	NA	NA	NA	NA
WP_000129978.1|1139095_1139977_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.3e-22
WP_000587963.1|1140061_1140688_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000455784.1|1141246_1141903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308416.1|1141946_1149587_-	DNA helicase	NA	I3PUW5	Vibrio_phage	37.8	5.9e-276
1143069:1143085	attR	AGGATATATTTTATTAA	NA	NA	NA	NA
WP_053308417.1|1149573_1150539_-	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	49.0	4.6e-77
WP_053308418.1|1150531_1152253_-	DNA topoisomerase III	NA	F2Y201	Organic_Lake_phycodnavirus	26.0	6.6e-18
>prophage 75
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1156705	1162017	1950469		Streptococcus_phage(100.0%)	3	NA	NA
WP_053308422.1|1156705_1159285_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	48.8	3.6e-28
WP_080370145.1|1159292_1161716_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_053308424.1|1161606_1162017_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	64.6	1.4e-38
>prophage 76
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1167252	1175543	1950469		Streptococcus_phage(50.0%)	8	NA	NA
WP_001096887.1|1167252_1168047_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627291.1|1168139_1168682_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	99.4	4.4e-93
WP_009145956.1|1168678_1169299_-	AAA family ATPase	NA	E4ZFP8	Streptococcus_phage	100.0	2.7e-94
WP_023078875.1|1171118_1171853_-	phage antirepressor KilAC domain-containing protein	NA	A0A2K9V3K3	Faecalibacterium_phage	47.7	4.5e-56
WP_053308429.1|1171849_1172335_-	PcfB family protein	NA	NA	NA	NA	NA
WP_053308430.1|1172327_1173155_-	ATP-binding protein	NA	H7BWC4	unidentified_phage	40.5	4.1e-42
WP_053308431.1|1173151_1173925_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_053308432.1|1174154_1175543_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	97.8	1.0e-258
>prophage 77
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1193055	1194846	1950469		Vaccinia_virus(100.0%)	1	NA	NA
WP_053308447.1|1193055_1194846_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.3	2.4e-135
>prophage 78
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1199423	1200620	1950469		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002989292.1|1199423_1200620_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
>prophage 79
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1204951	1210278	1950469	protease	Streptococcus_virus(33.33%)	6	NA	NA
WP_053308450.1|1204951_1206622_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.1	3.0e-47
WP_053308451.1|1206621_1207119_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_014407658.1|1207263_1208073_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002984063.1|1208125_1208389_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002984060.1|1208468_1209095_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_053308452.1|1209192_1210278_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	4.6e-33
>prophage 80
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1215763	1219453	1950469		Enterococcus_phage(100.0%)	3	NA	NA
WP_002989242.1|1215763_1215982_+	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_002984018.1|1216001_1218161_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	8.6e-265
WP_002987365.1|1218493_1219453_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
>prophage 81
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1224170	1229001	1950469	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_012560795.1|1224170_1226789_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.8e-62
WP_053308457.1|1227175_1228231_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_047235770.1|1228293_1229001_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	8.8e-09
>prophage 82
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1239039	1251463	1950469	tRNA	Streptococcus_phage(33.33%)	10	NA	NA
WP_032465084.1|1239039_1239645_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	5.1e-58
WP_011888795.1|1239741_1240782_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_053308461.1|1240852_1243096_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	1.8e-55
WP_053308462.1|1243076_1243739_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_080370148.1|1243938_1244757_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_080370170.1|1244796_1245573_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002989164.1|1245562_1245841_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_023612776.1|1245864_1247865_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	5.8e-66
WP_002989158.1|1247992_1249612_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_002989155.1|1249918_1251463_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
>prophage 83
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1259784	1320615	1950469	capsid,protease,portal,tail,tRNA,integrase,terminase	Streptococcus_phage(57.89%)	73	1263222:1263241	1298284:1298303
WP_032465092.1|1259784_1260720_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.5	3.6e-66
WP_014407683.1|1261019_1262882_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	1.6e-89
1263222:1263241	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_053308468.1|1263410_1263593_-	Paratox	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_053308469.1|1263707_1264496_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	4.1e-47
WP_011017838.1|1264777_1265491_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.8	6.9e-78
WP_023080015.1|1266356_1267001_-	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	77.2	4.0e-93
WP_002994484.1|1267110_1267803_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_053308470.1|1268035_1268593_-	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	88.1	6.3e-95
WP_011184796.1|1268703_1268889_-	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
WP_053308471.1|1268885_1269182_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	8.3e-46
WP_053308472.1|1269178_1269820_-	hypothetical protein	NA	Q938J7	Temperate_phage	51.0	4.0e-45
WP_053308473.1|1269822_1270254_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	90.9	2.0e-64
WP_053308474.1|1270262_1272044_-	hypothetical protein	NA	Q938J9	Temperate_phage	40.5	2.7e-67
WP_053308475.1|1272058_1273168_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	66.1	3.5e-113
WP_053308476.1|1273167_1275126_-	peptidase	NA	M1PKG3	Streptococcus_phage	49.2	5.3e-96
WP_010922452.1|1275122_1275818_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
WP_053308477.1|1275814_1278172_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.9	2.2e-141
WP_011054678.1|1278171_1278543_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
WP_010922455.1|1278557_1278821_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_136098331.1|1278831_1279425_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	61.4	1.0e-58
WP_000573598.1|1279437_1279773_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_053308479.1|1279773_1280010_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	1.9e-21
WP_011054681.1|1280002_1280341_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_053308480.1|1280300_1280723_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	68.6	1.3e-47
WP_053308481.1|1280873_1281767_-|capsid	phage major capsid protein	capsid	A0A126GGI3	Streptococcus_phage	77.4	6.3e-129
WP_053308482.1|1281770_1282235_-	DUF4355 domain-containing protein	NA	A0A141E167	Streptococcus_phage	57.8	6.3e-40
WP_011285619.1|1282315_1283731_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
WP_011888764.1|1283812_1284049_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_002986828.1|1284050_1284317_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_076634198.1|1284309_1284570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|1284538_1284763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017978.1|1284768_1286262_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_053308483.1|1286254_1287523_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.0	1.5e-189
WP_002994106.1|1287519_1287876_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_053308484.1|1288024_1288369_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	4.2e-41
WP_003047501.1|1288476_1288896_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	81.3	6.0e-58
WP_053308485.1|1288971_1289223_-	hypothetical protein	NA	M1PF60	Streptococcus_phage	57.8	4.8e-18
WP_053308486.1|1289676_1290189_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	77.4	1.3e-65
WP_053308487.1|1290185_1290527_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	5.3e-12
WP_053308488.1|1290880_1291678_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	81.9	9.9e-126
WP_053308489.1|1291674_1292604_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_032463369.1|1292606_1292936_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	87.2	1.1e-46
WP_011017565.1|1292991_1293198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1293206_1293347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985387.1|1293343_1293577_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_023079927.1|1293557_1293944_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	1.6e-25
WP_023079923.1|1294462_1294648_-	hypothetical protein	NA	Q938N3	Temperate_phage	85.2	2.6e-21
WP_010922478.1|1294649_1294961_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922479.1|1295230_1295443_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922480.1|1295644_1296400_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922481.1|1296411_1296930_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_053308491.1|1297053_1298196_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.1	5.3e-173
WP_002983920.1|1298285_1298561_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1298284:1298303	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1298659_1299247_-	YpmS family protein	NA	NA	NA	NA	NA
WP_011184743.1|1299224_1300085_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989125.1|1300059_1300899_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
WP_053308492.1|1301126_1302074_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983909.1|1302245_1303907_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002983907.1|1303928_1304399_-	arginine repressor	NA	NA	NA	NA	NA
WP_003056952.1|1304385_1305213_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011284950.1|1305205_1306078_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002983901.1|1306077_1306293_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_053308493.1|1306270_1307611_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_010922486.1|1307763_1308618_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_002989112.1|1308825_1310520_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_030126394.1|1310697_1312107_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	1.5e-60
WP_002989107.1|1312255_1312990_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_053308494.1|1312989_1313676_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983885.1|1313802_1314033_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_053308495.1|1314330_1316613_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_053308496.1|1316740_1317196_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983878.1|1317246_1317549_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_038433496.1|1317813_1320615_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.9	5.5e-70
>prophage 84
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1331284	1333126	1950469		Streptococcus_phage(100.0%)	1	NA	NA
WP_002983847.1|1331284_1333126_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	31.4	2.0e-20
>prophage 85
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1338643	1343195	1950469		Enterobacteria_phage(33.33%)	5	NA	NA
WP_053308500.1|1338643_1339621_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.6	4.0e-20
WP_011284961.1|1340035_1341073_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_002983821.1|1341059_1341551_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	2.0e-15
WP_002983819.1|1341540_1342080_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_053308501.1|1342202_1343195_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.5	6.9e-52
>prophage 86
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1353922	1356393	1950469		Enterobacteria_phage(50.0%)	2	NA	NA
WP_053308505.1|1353922_1355656_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.2	2.3e-26
WP_053308506.1|1355658_1356393_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.4	8.0e-05
>prophage 87
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1365298	1435471	1950469	capsid,transposase,terminase,holin,tail,portal,head,tRNA,protease	Streptococcus_phage(56.9%)	82	NA	NA
WP_053308512.1|1365298_1366486_-	DNA cytosine methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	38.9	2.2e-68
WP_014407718.1|1366709_1367183_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	36.0	1.1e-15
WP_053308513.1|1367320_1369969_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	6.6e-150
WP_053308514.1|1369970_1370534_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072135462.1|1370530_1370731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042759053.1|1371134_1371530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983750.1|1371550_1371805_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_053308515.1|1371974_1373108_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002985298.1|1374169_1374517_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_053308516.1|1374631_1375894_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	7.6e-96
WP_010922101.1|1375886_1376171_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002985303.1|1376346_1376796_-	flavodoxin	NA	NA	NA	NA	NA
WP_011528442.1|1377189_1378131_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985307.1|1378245_1378506_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_053308517.1|1378602_1379802_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_053308518.1|1379821_1380544_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053308519.1|1380691_1382239_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_053308520.1|1382390_1383809_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_002985324.1|1384120_1384879_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002988478.1|1384989_1385697_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.5	1.4e-09
WP_053308521.1|1385764_1386973_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	86.3	6.1e-212
WP_011054444.1|1387088_1387316_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011017397.1|1387312_1387585_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_032461328.1|1387594_1388212_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.7e-77
WP_053308522.1|1388214_1388646_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	97.2	2.9e-71
WP_053308523.1|1388654_1390562_-	hyaluronidase	NA	Q938J9	Temperate_phage	85.3	2.2e-224
WP_010922091.1|1390576_1391590_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	99.7	2.0e-184
WP_053308524.1|1391586_1393731_-	peptidase	NA	Q938K1	Temperate_phage	99.4	0.0e+00
WP_011527559.1|1393727_1394435_-	hypothetical protein	NA	Q938K2	Temperate_phage	71.9	6.8e-94
WP_011527558.1|1394434_1398358_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
WP_011017586.1|1398567_1398894_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_011017585.1|1398946_1399555_-	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017584.1|1399570_1399996_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011527557.1|1399992_1400370_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.8e-45
WP_011017582.1|1400366_1400714_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	88.2	2.9e-50
WP_011017581.1|1400710_1401013_-	hypothetical protein	NA	J7KC36	Streptococcus_phage	88.8	1.3e-41
WP_011017580.1|1401157_1402345_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
WP_011017579.1|1402369_1403035_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
WP_011017578.1|1403012_1404233_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_002985363.1|1404266_1404491_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_024623442.1|1404650_1406405_-	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_002985368.1|1406408_1406639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985371.1|1406641_1407109_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985375.1|1407279_1407618_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
WP_001132273.1|1407853_1408039_+	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002987543.1|1408090_1408468_+	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_053308525.1|1408594_1409542_-	hypothetical protein	NA	A0A126HAU2	Lactococcus_phage	71.1	1.2e-98
WP_011017574.1|1410124_1410562_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	97.9	6.7e-76
WP_011017569.1|1411004_1411418_-	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	6.4e-36
WP_002987593.1|1411427_1411697_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017568.1|1411693_1411978_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002985380.1|1412155_1412668_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	8.4e-62
WP_002985383.1|1412664_1413006_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_002988362.1|1413182_1413980_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	83.8	6.6e-130
WP_000594115.1|1413972_1414173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922474.1|1414169_1415159_-	recombinase RecT	NA	A0A286QMX3	Streptococcus_phage	44.2	5.8e-59
WP_024623464.1|1415158_1415491_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	82.4	1.4e-44
WP_002990074.1|1415546_1415753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988354.1|1415761_1415902_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988350.1|1415898_1416132_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_002985388.1|1416112_1416499_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	2.8e-25
WP_053308526.1|1416981_1417167_-	hypothetical protein	NA	Q938N3	Temperate_phage	82.0	1.3e-20
WP_002985395.1|1417168_1417306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889039.1|1417392_1417575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985404.1|1417715_1418477_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	61.9	1.6e-85
WP_002985407.1|1418525_1418714_-	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	63.3	2.6e-13
WP_001008979.1|1418765_1419407_+	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_021733129.1|1419505_1419664_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	1.7e-21
WP_014635530.1|1419722_1419938_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
WP_002985417.1|1420430_1421195_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.5	2.0e-83
WP_002985420.1|1421204_1421510_+	membrane protein	NA	NA	NA	NA	NA
WP_011017563.1|1421632_1423048_+	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	1.4e-109
WP_011054317.1|1423224_1424136_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
WP_020905024.1|1424132_1425110_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	9.6e-139
WP_002985434.1|1425106_1425997_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_053308527.1|1426411_1427758_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.6	6.9e-55
WP_002985439.1|1427778_1428972_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_030126062.1|1429307_1431809_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.2	1.5e-204
WP_002993974.1|1431916_1432681_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_030126063.1|1432848_1433547_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	1.0e-78
WP_010922049.1|1433856_1434795_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985455.1|1434778_1435471_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
>prophage 88
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1441757	1442552	1950469		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_053308529.1|1441757_1442552_-	gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	2.6e-17
>prophage 89
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1449792	1454474	1950469		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_011054302.1|1449792_1452474_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.1	6.4e-68
WP_002985505.1|1452704_1453091_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002990529.1|1453172_1454474_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.3	3.1e-28
>prophage 90
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1459284	1460481	1950469		Hokovirus(100.0%)	1	NA	NA
WP_002990541.1|1459284_1460481_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.6	2.5e-32
>prophage 91
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1465234	1469595	1950469		Streptococcus_phage(33.33%)	5	NA	NA
WP_023613038.1|1465234_1467034_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	37.0	5.9e-110
WP_020833362.1|1467026_1467506_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.0	7.2e-23
WP_023613050.1|1467551_1467935_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_023610433.1|1467918_1468422_-	ECF-type riboflavin transporter S component	NA	NA	NA	NA	NA
WP_002985536.1|1468746_1469595_+	glycosyl hydrolase 25 family protein	NA	A0A223LJI5	Bacillus_phage	31.3	1.9e-18
>prophage 92
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1473144	1476720	1950469	tRNA	Catovirus(33.33%)	3	NA	NA
WP_002990562.1|1473144_1474638_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.7	2.5e-90
WP_002985548.1|1475010_1475223_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	46.9	9.0e-10
WP_002990566.1|1475433_1476720_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.9	4.2e-41
>prophage 93
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1500860	1503673	1950469	portal	Streptococcus_phage(75.0%)	5	NA	NA
WP_010922009.1|1500860_1501685_-	asparagine ligase A	NA	M1PB22	Moumouvirus	33.1	6.2e-22
WP_076636797.1|1501708_1502050_-	Fic family protein	NA	NA	NA	NA	NA
WP_010922007.1|1502463_1502802_-	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	65.5	6.0e-24
WP_010922006.1|1502843_1503296_-|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	84.9	4.4e-62
WP_053308547.1|1503400_1503673_-	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	46.9	4.5e-06
>prophage 94
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1507301	1510063	1950469		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_002985621.1|1507301_1507511_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	61.5	1.3e-16
WP_014407401.1|1507612_1508821_-	MFS transporter	NA	NA	NA	NA	NA
WP_011184300.1|1508905_1510063_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	M1GX70	Paramecium_bursaria_Chlorella_virus	41.6	8.5e-78
>prophage 95
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1522297	1526302	1950469		Bacillus_phage(50.0%)	4	NA	NA
WP_002990670.1|1522297_1522990_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	34.7	6.5e-25
WP_023612763.1|1523433_1524243_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	37.8	3.7e-35
WP_030126091.1|1524246_1525599_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	35.0	8.0e-35
WP_002985645.1|1525591_1526302_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	3.7e-39
>prophage 96
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1532257	1542654	1950469	tRNA	Brazilian_cedratvirus(25.0%)	9	NA	NA
WP_014407389.1|1532257_1533250_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	8.2e-13
WP_053308556.1|1533390_1535334_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	1.4e-120
WP_053308557.1|1535755_1537090_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985678.1|1537091_1538090_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985680.1|1538220_1539222_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	6.1e-24
WP_053308558.1|1539395_1540481_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002985684.1|1540529_1541195_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002985686.1|1541205_1541583_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_053308559.1|1541727_1542654_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.5	1.2e-77
>prophage 97
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1546013	1553760	1950469		Staphylococcus_phage(25.0%)	8	NA	NA
WP_011528358.1|1546013_1546481_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	7.5e-41
WP_080370153.1|1546483_1548817_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.8	8.8e-90
WP_002985700.1|1548910_1549147_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002990729.1|1549192_1549339_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002994146.1|1549335_1550529_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_053308561.1|1550650_1552153_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.3	1.1e-74
WP_011017469.1|1552342_1552936_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_020904967.1|1552932_1553760_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.5	6.6e-16
>prophage 98
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1559704	1622652	1950469	protease,transposase,bacteriocin,tRNA	Streptococcus_phage(33.33%)	63	NA	NA
WP_003060803.1|1559704_1559905_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_032460066.1|1559917_1560145_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1561368_1561551_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_053308565.1|1561565_1561763_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_080370154.1|1562161_1562416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985741.1|1562721_1563198_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1563217_1564114_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1564233_1564641_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_053308566.1|1564621_1565119_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_009880369.1|1565277_1565853_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_010921967.1|1565898_1566951_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_023612154.1|1567109_1568882_-	oleate hydratase	NA	NA	NA	NA	NA
WP_053308567.1|1569195_1570377_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.6e-16
WP_002985757.1|1570532_1570748_-	YozE family protein	NA	NA	NA	NA	NA
WP_053308568.1|1570744_1571254_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_032460984.1|1571326_1572184_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1572292_1572850_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1572878_1573607_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1573927_1574617_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1574722_1575148_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_010921962.1|1575391_1575745_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_011285414.1|1575814_1578220_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002990808.1|1578435_1579242_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011017448.1|1579390_1580245_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_053308569.1|1580245_1580971_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.1e-17
WP_004218965.1|1581034_1581967_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053308570.1|1582112_1582760_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_053308571.1|1582858_1583200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308572.1|1583350_1584046_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023078625.1|1584065_1584317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308573.1|1584316_1584871_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_053308574.1|1584901_1586284_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.9	7.7e-33
WP_002993065.1|1586456_1587794_-	MFS transporter	NA	NA	NA	NA	NA
WP_053308575.1|1588126_1589086_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_021340581.1|1589161_1589860_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.2e-10
WP_002990844.1|1589852_1590089_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_053308576.1|1590449_1591151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154458312.1|1591244_1591496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308577.1|1593160_1593568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308580.1|1595671_1596076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154458303.1|1596421_1596550_-	exfoliative toxin	NA	NA	NA	NA	NA
WP_000564846.1|1596554_1597688_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_053308581.1|1597845_1598328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154458305.1|1598752_1599106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308583.1|1599551_1600304_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_053308584.1|1600506_1602687_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	4.7e-170
WP_002985812.1|1602653_1603142_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_010921941.1|1603145_1604159_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_080281948.1|1604655_1606656_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.0	7.8e-87
WP_038434353.1|1606895_1607603_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_080370155.1|1607704_1607902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308585.1|1608391_1613329_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_011527483.1|1613593_1614781_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002990895.1|1615008_1615836_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_002995120.1|1615909_1616266_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
WP_009880724.1|1616565_1617195_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023609786.1|1617241_1617634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053308586.1|1617660_1618524_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.3e-115
WP_053308587.1|1618528_1618852_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.7e-28
WP_010921931.1|1619514_1620390_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_010921930.1|1620407_1621043_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
WP_002985847.1|1621291_1621567_-	YlbG family protein	NA	NA	NA	NA	NA
WP_053308588.1|1622061_1622652_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.2	3.7e-53
>prophage 99
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1627085	1639362	1950469	tRNA	Staphylococcus_phage(50.0%)	14	NA	NA
WP_002985861.1|1627085_1627868_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.1	7.4e-17
WP_002985862.1|1627893_1628826_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050336152.1|1628836_1629868_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002985867.1|1629828_1630866_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	30.0	4.3e-20
WP_053308590.1|1630910_1631564_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002990948.1|1631639_1632575_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_010921923.1|1632705_1633497_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.0	5.9e-22
WP_002990953.1|1633574_1634909_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002985878.1|1635041_1635596_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	41.7	8.6e-36
WP_002990957.1|1635634_1636555_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	50.4	2.9e-36
WP_002990960.1|1636846_1637500_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002990963.1|1637501_1638065_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002995840.1|1638375_1638924_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010921920.1|1639101_1639362_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.0	1.9e-17
>prophage 100
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1654663	1666841	1950469	protease	Bacillus_phage(40.0%)	10	NA	NA
WP_080370157.1|1654663_1657762_-	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	31.1	2.2e-43
WP_002991013.1|1657968_1659279_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_020904907.1|1659341_1660244_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.2	2.3e-30
WP_009880401.1|1660244_1661420_-	Replication initiation/membrane attachment protein	NA	NA	NA	NA	NA
WP_002985941.1|1661403_1661898_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002991036.1|1662112_1663615_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.4e-24
WP_002991052.1|1663620_1664307_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	5.1e-30
WP_002985951.1|1664573_1665110_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_014407315.1|1665340_1666237_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_002985956.1|1666283_1666841_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	27.6	6.2e-10
>prophage 101
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1673468	1674533	1950469		Planktothrix_phage(100.0%)	1	NA	NA
WP_032460014.1|1673468_1674533_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	1.4e-29
>prophage 102
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1681315	1681948	1950469		Bacillus_virus(100.0%)	1	NA	NA
WP_031488555.1|1681315_1681948_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	34.8	1.1e-21
>prophage 103
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1692247	1698007	1950469		Staphylococcus_phage(66.67%)	3	NA	NA
WP_053308602.1|1692247_1695226_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.8	2.4e-23
WP_053308603.1|1695238_1696414_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.8	1.8e-14
WP_053308604.1|1696426_1698007_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	48.8	2.7e-119
>prophage 104
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1702656	1703924	1950469		Planktothrix_phage(50.0%)	2	NA	NA
WP_053308607.1|1702656_1703394_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.3e-27
WP_076639987.1|1703390_1703924_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.8	2.2e-12
>prophage 105
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1713214	1713988	1950469		Escherichia_phage(100.0%)	1	NA	NA
WP_011285171.1|1713214_1713988_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	4.3e-17
>prophage 106
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1717451	1717658	1950469		Clostridioides_phage(100.0%)	1	NA	NA
WP_002982695.1|1717451_1717658_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
>prophage 107
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1722159	1723503	1950469	tRNA	Catovirus(100.0%)	1	NA	NA
WP_053308619.1|1722159_1723503_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.1	5.0e-53
>prophage 108
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1727986	1728718	1950469		Synechococcus_phage(100.0%)	1	NA	NA
WP_080370159.1|1727986_1728718_-	transaldolase	NA	H8ZNI7	Synechococcus_phage	33.0	6.5e-15
>prophage 109
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1733977	1745430	1950469	tRNA,protease	Synechococcus_phage(25.0%)	8	NA	NA
WP_002982624.1|1733977_1734592_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.3e-13
WP_023610950.1|1734625_1735168_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002982615.1|1735298_1735727_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053308623.1|1735836_1740234_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	35.3	9.9e-18
WP_002993667.1|1740487_1742344_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	24.6	4.1e-05
WP_002993670.1|1742541_1743801_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_009881158.1|1743873_1744668_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_053308624.1|1744680_1745430_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.7	7.3e-22
>prophage 110
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1752241	1753375	1950469		Bacillus_virus(100.0%)	1	NA	NA
WP_002993686.1|1752241_1753375_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.9	1.1e-24
>prophage 111
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1756715	1758935	1950469		Vibrio_phage(100.0%)	1	NA	NA
WP_047235504.1|1756715_1758935_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6L1R3	Vibrio_phage	39.5	8.9e-07
>prophage 112
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1762612	1772530	1950469		Vibrio_phage(20.0%)	8	NA	NA
WP_053308630.1|1762612_1764799_-	PTS glucose/maltose transporter subunit IIBCA	NA	A0A2I7SAJ6	Vibrio_phage	43.0	1.9e-06
WP_053308631.1|1765156_1765906_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_053308632.1|1765905_1766859_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002987990.1|1766929_1767400_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_053308633.1|1767599_1769357_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	30.1	8.2e-40
WP_012561034.1|1769389_1769956_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	1.2e-32
WP_002982538.1|1769988_1771257_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	2.0e-96
WP_032465535.1|1771825_1772530_+	exotoxin	NA	A0EX09	Staphylococcus_phage	36.2	7.4e-16
>prophage 113
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1776807	1778503	1950469		Anomala_cuprea_entomopoxvirus(33.33%)	3	NA	NA
WP_053308634.1|1776807_1777611_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	1.9e-07
WP_003059477.1|1777594_1778221_+	ABC transporter ATP-binding protein	NA	A0A2H4P6Z4	Pseudomonas_phage	26.6	3.3e-07
WP_002982507.1|1778302_1778503_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	86.4	1.3e-21
>prophage 114
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1794134	1799901	1950469		Staphylococcus_phage(25.0%)	5	NA	NA
WP_053308642.1|1794134_1795763_-	CHAP domain-containing protein	NA	A0A1P8CMP9	Staphylococcus_phage	44.6	4.5e-08
WP_010922717.1|1795864_1797253_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.7	1.6e-09
WP_023612192.1|1797249_1797903_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	3.5e-28
WP_002993552.1|1797996_1799214_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002982458.1|1799226_1799901_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.4e-32
>prophage 115
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1813322	1819331	1950469		Streptococcus_phage(25.0%)	5	NA	NA
WP_053308648.1|1813322_1814138_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	5.2e-29
WP_053308649.1|1814500_1815010_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.3	1.6e-36
WP_053308650.1|1815087_1816176_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_023611204.1|1816232_1816901_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	33.8	3.7e-25
WP_053308651.1|1816913_1819331_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
>prophage 116
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1823668	1824442	1950469		Escherichia_phage(100.0%)	1	NA	NA
WP_053308653.1|1823668_1824442_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
>prophage 117
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1828582	1829401	1950469		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_011018290.1|1828582_1829401_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	3.1e-05
>prophage 118
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1834088	1842627	1950469	protease	uncultured_virus(25.0%)	7	NA	NA
WP_002982320.1|1834088_1835720_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	1.8e-153
WP_002991292.1|1835755_1836046_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_053308657.1|1836223_1838668_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.0	2.4e-122
WP_023610213.1|1838667_1839129_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1839324_1839528_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
WP_053308658.1|1840513_1841074_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_053308659.1|1841094_1842627_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.1	4.1e-43
>prophage 119
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1851778	1853320	1950469		Catovirus(100.0%)	1	NA	NA
WP_053308666.1|1851778_1853320_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.6	9.0e-99
>prophage 120
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1860007	1861903	1950469		Klosneuvirus(100.0%)	1	NA	NA
WP_022555232.1|1860007_1861903_-	oligoendopeptidase O	NA	A0A1V0SHG2	Klosneuvirus	28.6	3.9e-72
>prophage 121
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1868455	1873983	1950469		Enterococcus_phage(66.67%)	5	NA	NA
WP_053308672.1|1868455_1869187_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.0	5.6e-35
WP_002982219.1|1869360_1869975_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.5e-52
WP_011018311.1|1869974_1870484_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053308673.1|1870492_1871428_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002982204.1|1871784_1873983_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
>prophage 122
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1877857	1898602	1950469	tRNA,bacteriocin	Streptococcus_phage(22.22%)	19	NA	NA
WP_023612576.1|1877857_1878994_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.8e-120
WP_053308675.1|1879082_1880354_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_053308676.1|1880422_1880983_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_053308677.1|1880992_1881589_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_053308678.1|1881590_1882811_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.3	3.5e-05
WP_053308679.1|1882821_1884804_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.0e-62
WP_053308680.1|1884932_1887488_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.6	8.0e-44
WP_002982171.1|1887822_1888260_-	arginine repressor	NA	NA	NA	NA	NA
WP_053308681.1|1888550_1890242_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.2	2.4e-73
WP_014407952.1|1890329_1890638_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_053308682.1|1890664_1891537_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.6	2.7e-52
WP_021299113.1|1891579_1892458_-	YitT family protein	NA	NA	NA	NA	NA
WP_020905583.1|1892477_1893419_-	YitT family protein	NA	NA	NA	NA	NA
WP_014407953.1|1893411_1895160_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.6	1.2e-11
WP_032467234.1|1895497_1896778_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.6	2.2e-26
WP_000290414.1|1896997_1897180_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002982147.1|1897195_1897345_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011185088.1|1897625_1898252_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_011889243.1|1898263_1898602_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	34.3	4.5e-11
>prophage 123
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1912009	1913377	1950469		Streptococcus_phage(100.0%)	1	NA	NA
WP_080011054.1|1912009_1913377_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	7.8e-155
>prophage 124
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1922423	1942789	1950469	tRNA	Streptococcus_phage(20.0%)	18	NA	NA
WP_053308687.1|1922423_1923038_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	74.1	4.7e-27
WP_002982068.1|1923408_1924209_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002982066.1|1924201_1925044_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.8e-16
WP_002982063.1|1925019_1925910_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-20
WP_011185104.1|1925860_1926403_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_053308688.1|1926416_1927442_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010922796.1|1927491_1928781_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	30.8	1.7e-13
WP_011285334.1|1928782_1930027_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	38.9	4.1e-86
WP_047236069.1|1930467_1931727_+	hyaluronan synthase HasA	NA	NA	NA	NA	NA
WP_009880737.1|1931762_1932971_+	UDP-glucose 6-dehydrogenase HasB	NA	M1HM57	Paramecium_bursaria_Chlorella_virus	47.1	1.1e-96
WP_032465326.1|1933152_1934067_+	UTP--glucose-1-phosphate uridylyltransferase HasC	NA	A0A127AW70	Bacillus_phage	51.2	1.1e-75
WP_002991446.1|1934374_1934788_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	70.7	2.0e-21
WP_053308689.1|1934789_1935896_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_023610738.1|1935952_1936816_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002991454.1|1937018_1938500_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	3.4e-95
WP_002991455.1|1938777_1939800_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002982011.1|1940218_1941091_+	YitT family protein	NA	NA	NA	NA	NA
WP_002981986.1|1941169_1942789_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.2e-45
>prophage 125
NZ_CP010449	Streptococcus pyogenes strain NGAS322, complete genome	1950469	1946317	1949607	1950469	transposase	Staphylococcus_prophage(50.0%)	3	NA	NA
WP_053308690.1|1946317_1947304_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	2.6e-35
WP_002994924.1|1947692_1948172_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002994926.1|1948383_1949607_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	2.6e-16
