The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	15908	43792	2770411	bacteriocin,protease,transposase,holin	unidentified_phage(20.0%)	27	NA	NA
WP_011673930.1|15908_16127_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003589754.1|16325_17255_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_016366383.1|17358_17574_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_050893445.1|17741_18335_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_016386988.1|18731_19076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003600703.1|19339_19642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893446.1|20112_21357_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.3	5.7e-11
WP_050893447.1|21511_22747_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003596885.1|22950_25524_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|25536_26238_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003592429.1|26534_27086_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050893448.1|27129_27936_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_128518147.1|28592_28979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893449.1|29844_31263_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_050893450.1|31581_32355_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|32532_33138_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|33261_34155_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|34203_34842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|35070_36447_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003596899.1|36669_37014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|37089_37449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467320.1|37729_38892_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	5.6e-29
WP_050893451.1|39029_39692_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|39691_40621_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|40632_41262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003596965.1|41264_42518_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003596967.1|43138_43792_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	64326	131999	2770411	transposase	Faecalibacterium_phage(21.43%)	52	NA	NA
WP_050893464.1|64326_65742_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003597018.1|66418_67333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597020.1|67329_68016_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	3.8e-25
WP_003597022.1|68840_69239_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003597024.1|69201_69471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597025.1|69620_70388_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003600754.1|70384_71290_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003597028.1|71382_72534_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003572973.1|72541_73246_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_050893465.1|73256_74603_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_050893466.1|75316_76696_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003592633.1|76697_77705_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_050893467.1|77708_78767_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003562673.1|78962_79340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893468.1|79553_80570_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	9.3e-36
WP_016378678.1|80906_81110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597037.1|81684_82098_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003600759.1|82090_82957_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096835977.1|83105_84026_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_050893470.1|84686_85703_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016378584.1|87434_87782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562684.1|88480_90487_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003562688.1|90502_90958_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_019728331.1|91571_92588_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016386095.1|92929_94765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080988285.1|94786_96049_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155467323.1|95944_96732_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004559688.1|97148_98108_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_050893471.1|98091_99966_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	35.4	2.4e-98
WP_003586192.1|100174_100567_+	galactokinase	NA	NA	NA	NA	NA
WP_003603285.1|101392_102280_+	EamA family transporter	NA	NA	NA	NA	NA
WP_123031244.1|102487_103275_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003597469.1|105489_106059_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039639870.1|106066_109012_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003597463.1|109102_109327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080988331.1|110271_110715_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096836596.1|111049_111913_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_079322958.1|111909_112206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003597074.1|112322_112580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562690.1|112898_114287_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.6	1.6e-126
WP_050893475.1|114352_115516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562710.1|115755_117051_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.6	3.9e-63
WP_050893476.1|117359_119219_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.0	1.0e-88
WP_003597078.1|119313_119664_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050893477.1|119750_122159_-	plasma-membrane proton-efflux P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.8	6.4e-43
WP_003597080.1|122403_123282_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003597081.1|123718_124840_+	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	43.8	6.5e-06
WP_003562727.1|124906_125122_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_050893478.1|125118_126048_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	2.7e-34
WP_003597082.1|126044_126806_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003597083.1|127119_129303_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.9	6.6e-257
WP_123018126.1|131211_131999_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	299552	336777	2770411	transposase	unidentified_phage(50.0%)	31	NA	NA
WP_050893532.1|299552_300950_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_050893533.1|301792_303037_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.5e-11
WP_050893534.1|303406_305503_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563244.1|305503_305815_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003661526.1|306079_307366_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003604285.1|307382_307805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|307826_308687_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_011674056.1|308800_309442_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563255.1|309728_310559_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011674058.1|310551_311421_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003563259.1|311460_312456_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003574021.1|313196_314117_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050893535.1|314110_314845_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_050893536.1|315582_316599_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	7.1e-36
WP_003563273.1|316967_317366_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011674081.1|317478_317850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893539.1|319875_320718_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003574021.1|320974_321895_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003573470.1|324033_324510_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_050893540.1|324481_324910_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016370701.1|324934_326617_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_011674084.1|326654_327365_-	transaldolase	NA	A0A0E3FGE1	Synechococcus_phage	28.5	3.1e-14
WP_016375051.1|327570_328608_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011674086.1|329163_330492_+	6-phospho-alpha-glucosidase 1	NA	NA	NA	NA	NA
WP_016386743.1|330618_332502_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_050893542.1|332553_333366_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032800979.1|333334_333838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016375850.1|333882_334434_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_016375849.1|334528_335017_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_050893543.1|335082_335751_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003574021.1|335856_336777_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 4
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	383155	456569	2770411	transposase,holin	Staphylococcus_phage(23.08%)	45	NA	NA
WP_071798369.1|383155_383278_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_080988291.1|383519_383657_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016377049.1|383785_384784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_050893559.1|388177_390403_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050893560.1|390627_391827_+	MFS transporter	NA	NA	NA	NA	NA
WP_003659803.1|393517_393706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019897827.1|393812_394679_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003583296.1|394835_395852_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	29.2	5.8e-22
WP_003597423.1|395971_396952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597424.1|397098_398793_-	oleate hydratase	NA	NA	NA	NA	NA
WP_003597426.1|399028_399592_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003563416.1|399676_400045_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_003601234.1|400094_400676_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_003597428.1|400662_401682_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003601236.1|402073_402502_-	OsmC family protein	NA	NA	NA	NA	NA
WP_050893561.1|402536_403973_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_003577801.1|404205_404499_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003597431.1|405923_406535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601242.1|406524_407100_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003563442.1|407171_408053_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003563444.1|408639_410373_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	23.9	2.7e-27
WP_016375723.1|410458_411472_-	hydrolase	NA	X2KYU1	Mycobacterium_phage	26.4	3.3e-17
WP_050893562.1|411627_412695_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_003601249.1|413655_414408_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_050893563.1|414735_416079_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_003601251.1|416208_417336_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_050893564.1|417569_418925_+	APC family permease	NA	NA	NA	NA	NA
WP_003563458.1|418989_419418_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601252.1|419589_420456_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	31.9	2.1e-28
WP_016386034.1|420577_420727_-	Bifunctional protein: zinc-containing alcoholdehydrogenase, quinone oxidoreductase (NADPH:quinonereductase)	NA	NA	NA	NA	NA
WP_050894501.1|420857_422390_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_050893565.1|422515_423100_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.3	1.7e-34
WP_050893566.1|423358_426088_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_050893567.1|426080_426797_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003661615.1|426807_427812_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_050893568.1|427885_428962_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|429152_429887_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_011674128.1|431790_432489_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	5.8e-29
WP_050893569.1|432476_433592_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_050893570.1|433693_434575_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	3.0e-22
WP_050893571.1|434571_435720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003600004.1|439212_440490_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_003574021.1|445012_445933_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050893572.1|452200_454735_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	3.5e-68
WP_003574021.1|455648_456569_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 5
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	465935	510125	2770411	capsid,integrase,holin,head,portal,tail,protease,terminase	Lactobacillus_phage(86.0%)	62	467850:467868	510263:510281
WP_050893580.1|465935_466865_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	5.0e-105
WP_050893581.1|466993_467554_-	hypothetical protein	NA	NA	NA	NA	NA
467850:467868	attL	GGGGACAAAAAGGGGACAA	NA	NA	NA	NA
WP_050893582.1|467874_469044_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	99.2	2.4e-221
WP_050893583.1|469151_470240_-	Abi family protein	NA	A0A2H4JB40	uncultured_Caudovirales_phage	29.0	9.6e-23
WP_050893584.1|470358_470778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893585.1|470955_471735_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	98.1	2.1e-112
WP_050893586.1|471806_472211_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	98.5	3.1e-75
WP_050893587.1|472207_472534_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	98.1	4.9e-55
WP_050893588.1|472791_473004_+	helix-turn-helix transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	95.7	2.1e-30
WP_050893589.1|473006_473765_+	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	92.0	5.5e-126
WP_050893590.1|473862_474189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893591.1|474240_474681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893592.1|474695_475019_+	DUF771 domain-containing protein	NA	A0A0P0IJJ0	Lactobacillus_phage	82.4	8.0e-10
WP_050893593.1|475100_475304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893594.1|475378_475693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893595.1|475685_476519_+	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	97.5	4.8e-155
WP_050893596.1|476515_477778_+	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.1	7.0e-235
WP_003579409.1|477779_478124_+	hypothetical protein	NA	U5U420	Lactobacillus_phage	100.0	1.3e-61
WP_039639614.1|478165_478567_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	70.8	7.6e-50
WP_050893597.1|478576_479278_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	93.1	1.5e-122
WP_050893598.1|479274_479517_+	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	51.2	5.3e-14
WP_050893599.1|479513_480035_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	53.2	8.1e-36
WP_050893600.1|480024_480237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893601.1|480226_480589_+	hypothetical protein	NA	C1KFT4	Lactobacillus_virus	72.2	4.0e-42
WP_050893602.1|480578_480977_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	62.5	4.3e-37
WP_050893603.1|480973_481198_+	hypothetical protein	NA	A0A2D1GPG2	Lactobacillus_phage	91.9	9.4e-34
WP_050893604.1|481194_481596_+	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	57.9	3.6e-36
WP_050893605.1|481592_481802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191980149.1|482178_482337_+	hypothetical protein	NA	A0A0N7IR95	Lactobacillus_phage	92.3	2.7e-19
WP_050893607.1|482750_483185_+	transcriptional regulator	NA	B4XYT9	Lactobacillus_phage	72.7	2.5e-51
WP_032790139.1|483630_484605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032790136.1|484601_485051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893608.1|485445_486663_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.3	3.3e-237
WP_050893609.1|486649_486979_+	ribonucleoside-diphosphate reductase	NA	A0A0P0IJY9	Lactobacillus_phage	84.0	1.1e-46
WP_050893610.1|486981_487305_+	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	95.3	7.2e-51
WP_050893611.1|487317_488043_+	hypothetical protein	NA	Q96200	Lactobacillus_phage	51.9	2.4e-25
WP_191980150.1|488079_488235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893612.1|488247_488532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893613.1|488535_489030_+	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	95.7	1.6e-94
WP_050893614.1|489170_489638_+|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	71.0	7.7e-62
WP_050894502.1|489624_491514_+|terminase	terminase large subunit	terminase	A8YQI8	Lactobacillus_phage	98.6	0.0e+00
WP_191980151.1|491513_491687_+	hypothetical protein	NA	Q6J1Y5	Lactobacillus_phage	93.0	1.9e-21
WP_050893615.1|491693_492845_+|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	97.6	4.2e-210
WP_050893616.1|492841_493528_+|protease	Clp protease ClpP	protease	A8YQJ1	Lactobacillus_phage	98.7	4.8e-121
WP_050893617.1|493527_494697_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	92.8	1.2e-193
WP_050893618.1|494769_495102_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A8YQJ3	Lactobacillus_phage	91.8	1.1e-51
WP_080988293.1|495094_495436_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	94.7	3.9e-55
WP_050893619.1|495438_495858_+	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	92.8	3.2e-67
WP_050893620.1|495854_496226_+	DUF806 family protein	NA	A8YQJ6	Lactobacillus_phage	94.3	2.6e-60
WP_050893621.1|496237_496849_+|tail	phage tail protein	tail	A8YQJ7	Lactobacillus_phage	94.6	4.0e-103
WP_016366130.1|497011_497371_+|tail	phage tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	50.9	1.7e-21
WP_050893622.1|497339_497579_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	50.6	7.2e-16
WP_050893623.1|497575_502261_+	tape measure protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	54.3	8.3e-164
WP_080988337.1|502276_504337_+|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	82.8	0.0e+00
WP_050893625.1|504337_507022_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	79.1	0.0e+00
WP_050893626.1|507031_507361_+	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	83.5	2.4e-46
WP_016373429.1|507357_507501_+	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	97.9	4.6e-18
WP_050893627.1|507531_507918_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	97.7	2.8e-65
WP_021354712.1|507898_508108_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
WP_050893628.1|508100_508547_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	91.9	6.0e-64
WP_050893629.1|508557_509856_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	94.2	2.9e-223
WP_050893630.1|509900_510125_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	94.6	3.4e-31
510263:510281	attR	GGGGACAAAAAGGGGACAA	NA	NA	NA	NA
>prophage 6
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	909771	1029374	2770411	transposase,tRNA,integrase,head,portal,tail,protease,terminase	Staphylococcus_phage(12.9%)	117	921164:921180	960165:960181
WP_003601807.1|909771_910233_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003601809.1|910682_911579_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	6.1e-23
WP_050893723.1|912397_913327_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_003564348.1|914013_914556_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	3.7e-23
WP_004559584.1|914567_915326_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	5.3e-60
WP_155467331.1|915464_916385_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050568875.1|916722_917592_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_050893725.1|917613_919722_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003564356.1|920027_920567_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003564358.1|920580_921669_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.6	9.9e-36
921164:921180	attL	ACCAAGAAGAAGCGTTG	NA	NA	NA	NA
WP_050893727.1|921768_922593_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.9	1.7e-11
WP_003564363.1|922582_923422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569694.1|923405_924479_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003564368.1|924820_925015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564370.1|925084_925279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004559588.1|925497_928290_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	2.1e-74
WP_003584127.1|928393_929038_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050893729.1|929075_930215_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_050893731.1|930204_930939_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.3	7.4e-27
WP_050893732.1|931202_932060_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_050893734.1|932056_933142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564385.1|933163_934528_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_050893736.1|934843_936655_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.3	4.9e-88
WP_003658460.1|936632_936773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893738.1|936862_938668_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_003564394.1|938742_939234_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003564397.1|939304_940036_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_050893740.1|940160_941027_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_050893742.1|941023_941977_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_080988297.1|942426_942723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003578500.1|942918_943359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003578502.1|943403_943640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893746.1|943599_944061_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003569719.1|944479_945490_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050893747.1|945707_946166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893749.1|946304_947693_+	amino acid permease	NA	NA	NA	NA	NA
WP_003564418.1|947892_948657_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003564420.1|948653_949493_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_050893751.1|949493_950450_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003569724.1|950446_951316_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_050893753.1|951593_953885_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_050893755.1|954155_954464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893758.1|954652_955666_+	Abi family protein	NA	NA	NA	NA	NA
WP_050893464.1|956419_957835_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_016373188.1|958707_959856_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.2	2.7e-31
WP_050893766.1|959963_960623_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
960165:960181	attR	CAACGCTTCTTCTTGGT	NA	NA	NA	NA
WP_050893769.1|960791_961061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050893771.1|961128_961518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893773.1|961628_961820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893775.1|961867_962158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893776.1|962154_962343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893778.1|962326_963139_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.9	1.8e-13
WP_050893780.1|963151_964738_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	28.0	4.4e-24
WP_181813971.1|965051_965222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893782.1|965218_965494_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_050893784.1|965558_965744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893786.1|965740_966166_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	43.5	4.6e-21
WP_050893788.1|966747_968451_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.4	2.9e-114
WP_050893789.1|968416_968596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893790.1|968674_969781_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.0	1.7e-59
WP_050893791.1|971365_971659_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003568371.1|972186_972327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568375.1|972342_972591_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003568377.1|972702_973071_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003564434.1|973776_974172_+	SdpI family protein	NA	NA	NA	NA	NA
WP_003564436.1|974187_974916_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	5.1e-36
WP_050893792.1|974912_976388_+	sensor histidine kinase	NA	A0A1X9VNV7	Mimivirus	24.5	4.2e-05
WP_003564441.1|976656_977190_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003564443.1|977251_977461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003578545.1|977908_978343_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003564448.1|978367_978871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574405.1|978951_979272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893794.1|979264_980572_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	38.1	3.4e-83
WP_050893796.1|980706_980883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893798.1|981018_982212_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_050893800.1|982215_983007_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003564461.1|983038_983359_-	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	71.4	2.4e-14
WP_050893802.1|983824_986080_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	6.0e-136
WP_050893804.1|986136_988161_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.8	1.6e-103
WP_003564468.1|988170_989322_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_050893806.1|989373_989670_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_050893808.1|989673_991128_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_050893810.1|991129_992560_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003564476.1|992832_993867_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.1	2.2e-16
WP_003661244.1|993859_995233_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	51.3	1.1e-127
WP_016377111.1|995826_997038_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.1	1.2e-53
WP_050893812.1|997066_997903_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_050893814.1|997982_998858_-	phosphate--nucleotide phosphotransferase	NA	NA	NA	NA	NA
WP_003589754.1|999071_1000001_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_050893816.1|1000106_1001978_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	27.4	3.9e-56
WP_050893817.1|1002097_1003522_+	MFS transporter	NA	NA	NA	NA	NA
WP_050893819.1|1003607_1004060_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050893821.1|1004357_1005230_-	DegV family protein	NA	NA	NA	NA	NA
WP_003578571.1|1005487_1006414_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_003564497.1|1006498_1006693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574445.1|1007199_1007937_+	lysozyme	NA	NA	NA	NA	NA
WP_003564501.1|1008069_1008426_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003564504.1|1008637_1008994_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_050893824.1|1009340_1010294_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_050893825.1|1010307_1011594_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	26.6	2.1e-32
WP_003569787.1|1011593_1011962_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564512.1|1012035_1012458_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_050893827.1|1012756_1013479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050893829.1|1013564_1015343_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.8	3.0e-74
WP_050893831.1|1015496_1016732_-	aminopeptidase	NA	NA	NA	NA	NA
WP_003564519.1|1017056_1017665_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564521.1|1018085_1019459_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_003569796.1|1019599_1020607_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003564526.1|1020692_1021154_-	flavodoxin	NA	NA	NA	NA	NA
WP_003601954.1|1021404_1022229_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003601955.1|1022507_1023569_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003601956.1|1023787_1024045_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_003564534.1|1024060_1024270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050893833.1|1024648_1025725_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_155467334.1|1025740_1026661_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	5.8e-21
WP_003574465.1|1026934_1027849_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.0	2.2e-73
WP_016385819.1|1028075_1029374_+|protease	Zn-dependent protease M10 family	protease	NA	NA	NA	NA
>prophage 7
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	1743640	1814879	2770411	capsid,tRNA,integrase,holin,head,portal,terminase,tail,protease,transposase	Lactobacillus_phage(81.82%)	79	1748415:1748439	1820220:1820244
WP_003574021.1|1743640_1744561_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050894193.1|1744653_1745565_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_003601922.1|1745894_1746722_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003601923.1|1746783_1748250_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.9	1.2e-71
1748415:1748439	attL	GGTCCTTATGTGTAGGTTTCTGGGC	NA	NA	NA	NA
WP_003591104.1|1748602_1750921_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.1	2.8e-35
WP_003566829.1|1751346_1751721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566828.1|1751860_1752283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894194.1|1752845_1754276_+	MFS transporter	NA	NA	NA	NA	NA
WP_019899417.1|1754370_1755507_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_003599119.1|1755615_1755933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601926.1|1756103_1757771_-	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
WP_016378094.1|1757985_1758153_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_003601928.1|1758188_1760300_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003579810.1|1760286_1760778_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_016378558.1|1760977_1761730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894195.1|1762212_1763358_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	52.3	4.0e-88
WP_050894196.1|1763368_1763815_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	6.4e-66
WP_050894197.1|1763807_1764119_-	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	97.6	7.2e-40
WP_151495834.1|1764148_1764280_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_050894198.1|1764272_1764563_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	46.9	1.1e-18
WP_050894199.1|1764564_1767465_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	63.6	0.0e+00
WP_050894200.1|1767465_1769523_-|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	70.9	2.2e-262
WP_050894201.1|1769523_1774386_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	95.8	0.0e+00
WP_003661382.1|1774508_1774922_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_050894202.1|1775094_1775712_-|tail	phage tail protein	tail	B4XYQ1	Lactobacillus_phage	93.1	1.8e-103
WP_003661385.1|1775745_1776132_-	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	95.3	2.3e-67
WP_050894203.1|1776131_1776518_-	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	2.9e-67
WP_050894204.1|1776517_1776847_-|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	97.2	1.2e-56
WP_050894205.1|1776836_1777196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	92.4	2.8e-56
WP_016385826.1|1777206_1777446_-	hypothetical protein	NA	U5U4N8	Lactobacillus_phage	81.0	2.1e-15
WP_050894206.1|1777463_1778666_-|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	97.0	2.5e-213
WP_050894207.1|1778707_1779337_-|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	98.6	3.3e-116
WP_049179722.1|1779290_1780544_-|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.3	3.4e-237
WP_050894208.1|1780549_1780741_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	98.4	5.0e-28
WP_050894209.1|1780752_1782465_-|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	99.3	0.0e+00
WP_016385830.1|1782486_1782942_-|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	98.7	3.0e-79
WP_050894210.1|1783141_1783936_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	98.5	1.1e-148
WP_050894211.1|1783925_1784507_-	hypothetical protein	NA	U5U409	Lactobacillus_phage	93.8	5.2e-100
WP_050894212.1|1784519_1784843_-	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	93.5	8.8e-49
WP_050894213.1|1784845_1785175_-	ribonucleoside-diphosphate reductase	NA	A0A0P0HRM1	Lactobacillus_phage	84.4	1.2e-48
WP_050894214.1|1785161_1786379_-	hypothetical protein	NA	U5U436	Lactobacillus_phage	97.0	2.1e-236
WP_050894215.1|1786800_1787019_+	CsbD family protein	NA	NA	NA	NA	NA
WP_016377049.1|1787163_1788162_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_191980153.1|1788329_1788869_-	hypothetical protein	NA	D2IYV7	Enterococcus_phage	32.3	2.5e-16
WP_016378922.1|1789341_1789785_-	autolysin regulatory protein ArpU	NA	A0A0P0IZI6	Lactobacillus_phage	98.6	8.6e-79
WP_050894217.1|1790270_1790489_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJR0	Lactobacillus_phage	97.2	1.0e-32
WP_050894218.1|1790569_1791016_-	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	94.9	3.0e-39
WP_050894219.1|1791016_1791313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894220.1|1791309_1791534_-	hypothetical protein	NA	A0A2D1GPG2	Lactobacillus_phage	93.2	3.2e-34
WP_050894221.1|1791640_1791832_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	87.0	1.2e-24
WP_050894222.1|1791843_1792104_-	hypothetical protein	NA	C1KFT6	Lactobacillus_virus	91.9	2.8e-37
WP_050894223.1|1792100_1792463_-	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	64.6	1.3e-37
WP_050894224.1|1792452_1792815_-	hypothetical protein	NA	C1KFE7	Lactobacillus_virus	72.6	1.2e-41
WP_050894225.1|1792804_1793341_-	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	74.0	2.9e-65
WP_050894226.1|1793337_1793745_-	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	98.5	8.2e-76
WP_050894227.1|1793741_1794026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894228.1|1794144_1794846_-	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	95.2	3.7e-124
WP_050894229.1|1794857_1795322_-	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	1.3e-13
WP_080988313.1|1795334_1795736_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	70.1	2.2e-49
WP_050894231.1|1795777_1796122_-	hypothetical protein	NA	U5U420	Lactobacillus_phage	98.2	6.3e-61
WP_050894232.1|1796123_1797386_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.3	2.4e-235
WP_050894233.1|1797382_1798210_-	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	76.5	7.4e-116
WP_003661426.1|1798202_1798517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894234.1|1798591_1798795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894235.1|1798876_1799200_-	DUF771 domain-containing protein	NA	A0A0P0IJJ0	Lactobacillus_phage	97.1	1.7e-12
WP_003661429.1|1799266_1799947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661430.1|1799943_1800132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894236.1|1800132_1800894_-	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	99.2	2.2e-138
WP_016366000.1|1800890_1801142_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	98.6	4.2e-30
WP_050894237.1|1801299_1802073_+	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	94.6	2.5e-134
WP_050894238.1|1802127_1802805_+	hypothetical protein	NA	A0A2D1GPN7	Lactobacillus_phage	84.0	1.6e-71
WP_033571010.1|1803044_1803425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894514.1|1803570_1803828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032797648.1|1803925_1804189_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	41.3	1.5e-09
WP_050894239.1|1804301_1805471_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.7	4.0e-216
WP_003601934.1|1805921_1806560_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003566818.1|1806598_1807111_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_050894240.1|1807263_1807788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573322.1|1813595_1814879_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	1.4e-84
1820220:1820244	attR	GCCCAGAAACCTACACATAAGGACC	NA	NA	NA	NA
>prophage 8
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	1858193	1935173	2770411	protease,transposase	unidentified_phage(18.18%)	55	NA	NA
WP_155467331.1|1858193_1859114_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050894252.1|1859568_1860309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894253.1|1860375_1860927_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050894254.1|1860949_1861828_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	23.4	9.6e-05
WP_003599218.1|1861824_1862913_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	4.6e-17
WP_050894255.1|1862962_1863274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579946.1|1863377_1864361_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003599224.1|1865562_1867233_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003570737.1|1867595_1868276_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003566249.1|1868272_1868605_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004469528.1|1868816_1869080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894256.1|1870830_1872432_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.0e-08
WP_003566258.1|1872854_1873253_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_032788034.1|1873344_1873638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894257.1|1873786_1877365_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016384903.1|1877724_1878486_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_050894259.1|1879740_1881336_+	surface protein, LPXTG-anchored	NA	NA	NA	NA	NA
WP_003599241.1|1882036_1882366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003599242.1|1882754_1883399_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_050893464.1|1884161_1885577_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003566280.1|1887155_1887368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1887572_1888493_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_050894261.1|1888722_1889199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894262.1|1891385_1892402_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	1.2e-35
WP_003566290.1|1893096_1893249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566292.1|1893550_1895104_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
WP_003566294.1|1895276_1896203_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
WP_004469548.1|1896358_1896721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003575717.1|1896767_1897058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894264.1|1897121_1898531_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003602824.1|1898863_1899340_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003566303.1|1899344_1901636_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003602825.1|1901846_1902041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566310.1|1905051_1905957_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003602828.1|1906014_1906476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004469557.1|1906587_1907940_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003602830.1|1907926_1908892_-	ferrochelatase	NA	NA	NA	NA	NA
WP_050894266.1|1909049_1909709_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003585113.1|1910059_1911868_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_050894267.1|1911880_1912639_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.9e-33
WP_003602832.1|1912939_1914595_+	amino acid permease	NA	NA	NA	NA	NA
WP_003566327.1|1914730_1915612_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_003595494.1|1915749_1917045_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003602834.1|1917182_1918181_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_003602835.1|1918490_1920815_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003602837.1|1921102_1922152_-	EpsG family protein	NA	NA	NA	NA	NA
WP_003602839.1|1922229_1922865_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003580033.1|1922922_1923615_-	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_003570792.1|1923858_1925298_-	histidine kinase	NA	NA	NA	NA	NA
WP_003580036.1|1925312_1926449_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003566341.1|1926503_1927469_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	3.9e-07
WP_004559524.1|1927879_1929553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894268.1|1929707_1931447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004559522.1|1931642_1933724_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_050893464.1|1933757_1935173_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	2167782	2246811	2770411	capsid,tRNA,integrase,holin,head,portal,tail,protease,terminase	Lactobacillus_phage(76.36%)	95	2207651:2207666	2252488:2252503
WP_003567053.1|2167782_2168427_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003603158.1|2168507_2169566_+	LCP family protein	NA	NA	NA	NA	NA
WP_003603160.1|2169627_2170656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603162.1|2170656_2171544_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003567064.1|2171540_2171906_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567066.1|2172047_2172701_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003580616.1|2172918_2174871_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	7.4e-58
WP_003567071.1|2175147_2175483_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003567073.1|2175578_2176604_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.4e-60
WP_003567075.1|2176637_2177171_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567077.1|2177154_2177877_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003603166.1|2178360_2178966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567081.1|2179197_2179716_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003603167.1|2180186_2181167_+	asparaginase	NA	NA	NA	NA	NA
WP_003567089.1|2181262_2182006_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003603168.1|2182100_2182958_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.4	9.4e-74
WP_003567092.1|2182959_2183298_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
WP_003603169.1|2183302_2184280_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.8	6.4e-26
WP_003567098.1|2184279_2184609_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_016365525.1|2184643_2185288_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	3.1e-53
WP_003567100.1|2185798_2186062_-	YaaL family protein	NA	NA	NA	NA	NA
WP_050894341.1|2186061_2186661_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003567105.1|2186976_2187285_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_050894342.1|2187301_2188999_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	8.7e-55
WP_003567109.1|2189471_2189978_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003567111.1|2190119_2190449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894343.1|2190505_2191102_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050894344.1|2191206_2193816_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003571317.1|2194218_2194632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365710.1|2194781_2195714_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_050894345.1|2195823_2201532_-	PII-type proteinase	NA	NA	NA	NA	NA
WP_003603183.1|2201820_2202720_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_050894346.1|2203037_2204336_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	89.8	4.6e-221
WP_050894347.1|2204346_2204793_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	93.9	9.3e-65
WP_050894348.1|2204789_2204996_-	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	94.9	7.1e-12
WP_050894349.1|2204976_2205363_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	97.7	6.1e-65
WP_050894350.1|2205517_2205808_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	51.1	1.6e-20
WP_050894351.1|2205809_2208479_-|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	54.4	5.2e-296
2207651:2207666	attL	TTAACAAACGTGAATA	NA	NA	NA	NA
WP_050894352.1|2208479_2210609_-|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	68.9	6.9e-259
WP_050894353.1|2210609_2213945_-|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	91.2	1.9e-279
WP_003595195.1|2213937_2214291_-	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	100.0	8.7e-58
WP_050894354.1|2214389_2214725_-|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	96.4	8.8e-52
WP_050894355.1|2214802_2215405_-|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	94.6	1.6e-96
WP_050894356.1|2215416_2215821_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	97.8	2.3e-70
WP_050894357.1|2215821_2216229_-|tail	phage tail protein	tail	A0A0P0I3G7	Lactobacillus_phage	79.3	4.5e-50
WP_050894358.1|2216225_2216528_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	89.0	7.7e-47
WP_016371252.1|2216532_2216907_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	96.0	6.8e-61
WP_050894359.1|2216906_2217785_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	83.6	6.1e-153
WP_003602757.1|2217853_2218900_-|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	97.6	2.9e-186
WP_003602759.1|2218913_2219228_-	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	95.2	2.8e-47
WP_050894360.1|2219240_2219879_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	97.6	9.1e-90
WP_050894361.1|2219996_2220395_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	64.3	1.4e-24
WP_050894362.1|2220411_2220852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894363.1|2220848_2221175_-	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	91.7	7.3e-51
WP_050894364.1|2221184_2222183_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	96.0	6.3e-178
WP_050894518.1|2222148_2223576_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	95.8	1.3e-256
WP_050894365.1|2223580_2224834_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.8	1.2e-247
WP_050894366.1|2224817_2225396_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	79.9	1.7e-63
WP_050894368.1|2225624_2225951_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	86.0	6.1e-50
WP_050894369.1|2225943_2227092_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.6	9.9e-220
WP_050894371.1|2227700_2228129_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_183406565.1|2228404_2228563_-	hypothetical protein	NA	A0A0N7IR95	Lactobacillus_phage	90.4	3.9e-18
WP_050894372.1|2228774_2229005_-	hypothetical protein	NA	U5U426	Lactobacillus_phage	82.9	1.0e-27
WP_016385959.1|2229007_2229253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894373.1|2229249_2229738_-	class I SAM-dependent methyltransferase	NA	Q8LTB0	Lactobacillus_phage	97.5	3.8e-96
WP_050894374.1|2229734_2230142_-	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	60.4	4.0e-38
WP_050894375.1|2230131_2230335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894376.1|2230321_2230849_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	58.1	8.5e-41
WP_050894377.1|2230845_2231253_-	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	95.6	2.0e-74
WP_050894378.1|2231249_2231534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894379.1|2231695_2232160_-	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	95.0	1.7e-13
WP_019892349.1|2232172_2232538_-	hypothetical protein	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	6.9e-66
WP_049181905.1|2232534_2232789_-	hypothetical protein	NA	U5U728	Lactobacillus_phage	91.7	1.1e-35
WP_049181906.1|2232789_2233119_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	79.6	1.7e-39
WP_050894380.1|2233115_2233898_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.1	6.5e-130
WP_050894381.1|2233884_2234742_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	95.5	6.2e-142
WP_016373294.1|2234753_2235518_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	55.2	2.3e-79
WP_050894382.1|2235537_2236404_-	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	53.1	1.9e-58
WP_080772331.1|2236417_2236588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080988321.1|2236562_2236832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894383.1|2236951_2237278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016376223.1|2237268_2237742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080988322.1|2237804_2237963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894384.1|2238050_2238230_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_050894385.1|2238322_2238565_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	55.9	2.7e-10
WP_050894386.1|2238700_2239132_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	38.5	4.7e-21
WP_050894387.1|2239132_2239579_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_050894388.1|2239624_2240428_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_050894389.1|2240509_2240860_+	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	96.6	1.8e-55
WP_050894390.1|2240949_2242293_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	99.8	2.9e-194
WP_020751740.1|2243206_2243593_+	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	45.2	2.3e-27
WP_050894391.1|2243854_2244280_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	89.4	2.8e-63
WP_032797619.1|2244580_2245036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894392.1|2245028_2245490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894393.1|2245596_2246811_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	26.9	6.1e-34
2252488:2252503	attR	TTAACAAACGTGAATA	NA	NA	NA	NA
>prophage 10
NZ_CP012187	Lacticaseibacillus paracasei strain CAUH35 chromosome, complete genome	2770411	2285190	2351783	2770411	bacteriocin,protease,tRNA,transposase	Bacillus_phage(27.27%)	59	NA	NA
WP_003576207.1|2285190_2286684_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|2286831_2287812_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003603236.1|2287927_2288599_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003603237.1|2288782_2289613_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603238.1|2289759_2290599_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_050894402.1|2290611_2291628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|2291634_2292009_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016371648.1|2292173_2293445_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_050894403.1|2293762_2294539_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003603253.1|2294556_2295444_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
WP_003567252.1|2295746_2296862_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003599699.1|2296884_2298249_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2298265_2298808_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2299028_2299319_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2299435_2299813_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003603256.1|2300057_2301377_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
WP_003603257.1|2301735_2303082_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003599703.1|2303309_2304410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661801.1|2304406_2305603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2305665_2306544_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003599714.1|2306705_2308760_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
WP_050894404.1|2308916_2311547_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	1.6e-87
WP_003576237.1|2311708_2312332_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_050894405.1|2312831_2313503_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003599717.1|2314012_2315134_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2315147_2315432_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|2315622_2316738_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2316925_2317132_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2317264_2317522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2317592_2317799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603264.1|2318602_2319835_+	MFS transporter	NA	NA	NA	NA	NA
WP_050894406.1|2319913_2321170_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.5	2.8e-98
WP_050894407.1|2321258_2322092_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_003588746.1|2322408_2322603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|2322856_2323393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599733.1|2325039_2325867_-	class C sortase	NA	NA	NA	NA	NA
WP_050894408.1|2325873_2327433_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_050894409.1|2327429_2328752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894410.1|2328753_2331759_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003567312.1|2332036_2332594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894411.1|2332688_2333885_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016377825.1|2334093_2335149_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_050894412.1|2335419_2336049_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	2.1e-06
WP_003567322.1|2336184_2336514_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603292.1|2336510_2337299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894413.1|2337572_2338988_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050555697.1|2338959_2339721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2339765_2340044_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599758.1|2340067_2340352_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_050894414.1|2340939_2342295_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_050894415.1|2342600_2342912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603306.1|2343507_2344887_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_050894416.1|2344897_2347090_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-36
WP_003603310.1|2347576_2347693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894417.1|2348061_2349180_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2349184_2349991_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003661762.1|2350352_2350550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603311.1|2351096_2351336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599800.1|2351609_2351783_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP012188	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence	73307	17681	50645	73307	transposase,holin	Clostridium_phage(20.0%)	35	NA	NA
WP_050894534.1|17681_17786_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016372359.1|17941_18331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587058.1|18333_18477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016378771.1|18469_18919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003570626.1|18932_19223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016374048.1|19232_19679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016374046.1|20344_20704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155467358.1|20881_21669_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003600004.1|22152_23430_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_021353390.1|23577_23667_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016386147.1|24133_25483_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.1	2.7e-123
WP_071799104.1|25524_25719_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155467361.1|26066_26853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050894537.1|26840_27164_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003589800.1|27506_28385_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_050894538.1|28505_30239_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_050894539.1|30265_31690_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|31738_32074_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003585301.1|32371_32569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|32543_32897_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_155467364.1|34918_35706_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050894541.1|35755_36031_-	hypothetical protein	NA	A0A2P0ZLG2	Lactobacillus_phage	37.1	8.9e-10
WP_050894562.1|36151_36784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894542.1|37240_37828_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	4.5e-19
WP_050894543.1|38279_39047_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.1	9.7e-46
WP_003561810.1|39087_40017_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
WP_016377049.1|40844_41843_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003606447.1|42092_42341_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_155467368.1|42929_44035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	1.0e-27
WP_032789985.1|44879_44993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547071.1|45163_46246_-	YdcF family protein	NA	NA	NA	NA	NA
WP_050894545.1|47950_48601_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.1e-18
WP_012537722.1|48713_49217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060611715.1|49236_49524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050894546.1|49961_50645_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	4.7e-60
>prophage 1
NZ_CP012189	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence	47712	0	6697	47712	transposase	Lactococcus_phage(50.0%)	5	NA	NA
WP_016386160.1|984_1515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586333.1|2515_3073_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003586331.1|3038_4223_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003603806.1|4244_5156_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.4	3.1e-59
WP_050894563.1|5767_6697_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
>prophage 2
NZ_CP012189	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence	47712	18566	19448	47712		Enterococcus_phage(100.0%)	1	NA	NA
WP_003582592.1|18566_19448_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	5.0e-38
>prophage 3
NZ_CP012189	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence	47712	22889	26860	47712	transposase	unidentified_phage(33.33%)	4	NA	NA
WP_050894571.1|22889_23819_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BVY4	unidentified_phage	29.8	2.3e-25
WP_003600616.1|23940_24450_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_155467377.1|24650_25571_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.5e-37
WP_003600772.1|25684_26860_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	8.2e-28
>prophage 4
NZ_CP012189	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence	47712	33511	37502	47712	transposase	Acinetobacter_phage(33.33%)	4	NA	NA
WP_155467384.1|33511_34673_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.5e-29
WP_050894574.1|35939_36266_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_050894575.1|36430_37066_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.0	1.8e-53
WP_080988372.1|37166_37502_+	TIR domain-containing protein	NA	A0A0S2MYG4	Enterococcus_phage	61.5	9.2e-17
>prophage 5
NZ_CP012189	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence	47712	45065	45749	47712	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_050894580.1|45065_45749_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
>prophage 1
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	0	1100	50420	transposase	Lactobacillus_phage(100.0%)	1	NA	NA
WP_032760944.1|884_1100_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	97.2	4.2e-31
>prophage 2
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	4794	5478	50420	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_050894583.1|4794_5478_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	4.7e-60
>prophage 3
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	10950	11898	50420		Salmonella_phage(100.0%)	1	NA	NA
WP_003600582.1|10950_11898_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	37.5	3.2e-46
>prophage 4
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	18426	20233	50420		Clostridium_phage(50.0%)	2	NA	NA
WP_050894593.1|18426_19014_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	5.9e-19
WP_050894594.1|19465_20233_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.1	7.5e-46
>prophage 5
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	26125	26377	50420	transposase	Lactobacillus_phage(100.0%)	1	NA	NA
WP_002816285.1|26125_26377_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
>prophage 6
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	35196	40347	50420	transposase	Staphylococcus_phage(33.33%)	5	NA	NA
WP_002816607.1|35196_35880_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_002834562.1|36016_36373_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_002834561.1|36372_36651_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016370698.1|37158_38175_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.2	2.5e-33
WP_050894603.1|39525_40347_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	33.0	1.3e-32
>prophage 7
NZ_CP012190	Lacticaseibacillus paracasei strain CAUH35 plasmid unnamed3, complete sequence	50420	50042	50267	50420		Staphylococcus_phage(100.0%)	1	NA	NA
WP_050894608.1|50042_50267_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	50.8	2.3e-08
