The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012070	Arsenicicoccus sp. oral taxon 190 strain F0371 chromosome 1, complete sequence	3525271	1203796	1232893	3525271	transposase,integrase	Bacillus_phage(25.0%)	29	1195346:1195405	1235493:1235694
1195346:1195405	attL	ACGGATGTCGAGATGCAGCGGAGACTTCACAAACGCACTTCGGATGTTTCATAAACCTCG	NA	NA	NA	NA
WP_050346957.1|1203796_1205044_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.2e-80
WP_050347447.1|1205123_1205504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156188132.1|1205626_1207696_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_156188133.1|1207771_1209068_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	45.5	1.5e-70
WP_050347451.1|1209431_1210133_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_050347452.1|1210129_1211542_+	TniQ family protein	NA	NA	NA	NA	NA
WP_050347453.1|1211538_1211934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172669705.1|1211930_1212245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050347455.1|1212241_1213906_+	TniQ family protein	NA	NA	NA	NA	NA
WP_050347456.1|1214312_1215545_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_050347457.1|1215519_1215789_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_050347458.1|1215983_1216280_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_050347459.1|1216300_1217398_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_156188136.1|1218067_1219318_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.8	5.5e-22
WP_040161810.1|1219314_1220154_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	40.9	2.7e-49
WP_050347461.1|1220246_1220597_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040161804.1|1220593_1221184_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_156188137.1|1221186_1222248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050347463.1|1222318_1223443_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.5	2.3e-27
WP_050347464.1|1223439_1224156_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	5.4e-30
WP_050347465.1|1224326_1224566_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_050347466.1|1224594_1226097_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_050347467.1|1226093_1227011_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_050347468.1|1227124_1227409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050347469.1|1227517_1228123_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_050347470.1|1228149_1230510_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	1.1e-79
WP_050347471.1|1230591_1231020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156188300.1|1231307_1232519_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_082176767.1|1232593_1232893_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	53.1	1.1e-08
1235493:1235694	attR	ACGGATGTCGAGATGCAGCGGAGACTTCACAAACGCACTTCGGATGTTTCATAAACCTCGTGTAATGGATCCCCATGGGTGGTGTTGCCCCTGCGGAGGTTCACTCCGTGCACACCATTGGCAAGACACTGGACAAAATGCTCGACGTCTTCAGCAACTCCTCCGTCCTGGGACCGGAGGGTCATGCCGTGGTCGAGGCAGT	NA	NA	NA	NA
>prophage 2
NZ_CP012070	Arsenicicoccus sp. oral taxon 190 strain F0371 chromosome 1, complete sequence	3525271	2488326	2497952	3525271		Emiliania_huxleyi_virus(16.67%)	8	NA	NA
WP_050348378.1|2488326_2489523_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	29.2	2.3e-33
WP_050348379.1|2489553_2490612_-	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	23.6	2.2e-11
WP_082177162.1|2490763_2491336_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	62.8	1.9e-09
WP_050348381.1|2491425_2492178_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_050348382.1|2492297_2495483_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.6	1.8e-295
WP_050348383.1|2495664_2496186_+	VOC family protein	NA	NA	NA	NA	NA
WP_050348384.1|2496360_2497077_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.1e-11
WP_050348385.1|2497073_2497952_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.0	3.9e-14
