The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	101304	171886	4526841	coat,plate,transposase,tail	Vibrio_phage(16.67%)	59	NA	NA
WP_002213759.1|101304_101763_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208786.1|101961_103473_-	amino acid permease	NA	NA	NA	NA	NA
WP_002208788.1|103730_104603_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208790.1|105260_106349_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002208791.1|106512_107370_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
WP_002208792.1|107440_109912_-	fimbrial biogenesis usher protein PsaC	NA	NA	NA	NA	NA
WP_002208793.1|109995_110817_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002208794.1|110943_111420_-	adhesin PsaA	NA	NA	NA	NA	NA
WP_002216523.1|111964_112453_-	protein PsaF	NA	NA	NA	NA	NA
WP_002208796.1|112449_113094_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002208797.1|113418_115119_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002208798.1|115133_116072_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208799.1|116068_117202_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_002208801.1|117463_117919_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_002208802.1|118031_119030_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208803.1|119065_120640_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208804.1|120748_121837_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208805.1|121944_122655_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_002208806.1|122674_124228_-	xylulokinase	NA	NA	NA	NA	NA
WP_016674066.1|124231_125716_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002208808.1|126066_127209_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002230767.1|127205_128171_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_050879662.1|128181_128997_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.2	1.5e-12
WP_002208811.1|129065_129320_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208812.1|129694_130939_+	tryptophan permease	NA	NA	NA	NA	NA
WP_002228019.1|131042_131615_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208813.1|131754_132948_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002224659.1|133532_135005_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
WP_002208819.1|136685_137669_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208820.1|137727_138429_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208822.1|138870_139455_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_071525527.1|140105_141623_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208825.1|141704_143513_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208826.1|143522_144623_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208827.1|144622_145651_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208828.1|145652_147245_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208829.1|147305_147650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|148634_149834_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208832.1|149937_150645_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208833.1|151178_152936_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208834.1|153097_153382_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002213775.1|153520_153979_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|154179_155184_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|155361_155589_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|155616_157413_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|157643_158027_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|158383_159532_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|159544_160033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|160732_161095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|161220_162657_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|162947_163688_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|163985_164765_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|164861_165209_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|165205_165466_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|165462_166599_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|166602_167058_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208850.1|167667_168723_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|168719_170126_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|170392_171886_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	175064	185094	4526841		Escherichia_phage(42.86%)	10	NA	NA
WP_002208859.1|175064_175355_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|175951_176746_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|176721_177534_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_116463120.1|177536_178232_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208862.1|178264_179569_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|179779_180259_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|180532_181255_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|181460_181703_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|181874_182810_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_011906348.1|183306_185094_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 3
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	208187	264774	4526841	tRNA,protease,transposase,holin	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002210815.1|208187_208697_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|208754_209948_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|210566_211775_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|212031_212574_-	membrane protein	NA	NA	NA	NA	NA
WP_002228030.1|212931_214374_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|214441_216622_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|216891_218007_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|218418_219309_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|219433_219637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659403.1|220861_222070_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	1.2e-50
WP_002210804.1|223453_224788_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|225283_225982_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|226116_227055_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002210801.1|227051_228206_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191984.1|228466_229399_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210799.1|230134_230989_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|231199_232615_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|232638_233496_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|233610_234309_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_032465620.1|234402_235173_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002210794.1|235235_236312_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|236311_237913_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|238036_239305_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|239732_240206_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|240451_241333_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|241335_242196_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011906354.1|242298_243228_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|243264_244101_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|244308_244557_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|244741_245845_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_011906355.1|246157_246499_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|246524_247064_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|247273_248986_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|249106_250042_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|250380_250560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|250633_251572_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|251871_252801_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|253215_253674_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|254601_255465_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|255810_256659_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|256696_257590_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|257821_259870_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|260234_260831_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|260888_262361_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011906357.1|262383_264087_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_011906358.1|264315_264774_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	309661	354437	4526841	tRNA,transposase,integrase	Escherichia_phage(36.36%)	39	328038:328097	354527:355245
WP_002213775.1|309661_310120_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210729.1|310333_311206_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
WP_002210728.1|311205_312372_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_002210727.1|312484_313708_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_002210726.1|313737_316545_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_002210725.1|316900_317617_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_002210724.1|317666_319433_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_002210723.1|319433_319781_-	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
WP_002210722.1|319774_320164_-	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002210721.1|320873_322154_+	citrate synthase	NA	NA	NA	NA	NA
WP_002224622.1|322261_322840_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002210719.1|322963_323845_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002210718.1|323931_325593_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002210717.1|325706_326048_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002210716.1|326197_326482_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011055694.1|326474_327011_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002210714.1|327069_327552_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
328038:328097	attL	TTTTTTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGG	NA	NA	NA	NA
WP_002213759.1|328186_328645_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210713.1|328868_330068_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002210712.1|330146_331235_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002215946.1|333116_333344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210710.1|334151_335039_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002210709.1|335031_335232_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|335231_335774_+	ash family protein	NA	NA	NA	NA	NA
WP_011906363.1|335766_336726_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002210707.1|336722_337811_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|338159_338474_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|338479_338797_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_011901829.1|339401_340424_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|340423_341203_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|342095_342281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|342443_342695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|343405_344173_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
WP_002212202.1|344504_344792_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_002215386.1|345208_345736_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_002210357.1|346102_346549_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011906364.1|349981_351403_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_002210354.1|352108_353776_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.9	8.9e-294
WP_002213759.1|353978_354437_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
354527:355245	attR	CCAAAGCTGAAAGCTTTACTGAACCCCCAGCCTAGCTGGGGGTTTTCTGGGCACAAAAAACGGGAAGAGATCGCTCTCTTCCCGTTGGTTCGATTAAAATTCAGATCGGTTATTCAGTACACCTGTACGTTATCGCCCTGAATCTCAAACGGAATACGGCTCATTTCAAACAAATTATTTGCCACGAATCTCAAATAATTGGCTTTGACCGGCAACGACTGAACCGCTCGCCAACAGCGAGATCCCCGCGTAGTCATCAATATTACTGACGACAACTGGGCTGATCATTGAATGCGCGTTGGCATTCAGATAAGCCAGATCCAGTTCTAACACCGGCTGACCAGCAACCACTGTCGTCCCCTCTTCAACTAAACGGGTAAAGCCCTGGCCGTTAAGCTTCACGGTATCAATCCCGATATGAACCACAATCTCAGCACCGGTTTCCGTTTCCAGGCAGAACGCATGATCCGTATTGAAGATTTTCACAATAGTGCCGCTAGCGGGAGAAACAACTATTTTGTCTGTAGGACGGATAGCAACCCCCTCACCTACCGCTTTGCTAGCAAAAGCCTCATCAGGAACCTGCGCCAATGGCACAACATCACCGGTAATTGGCGAAACCAGAACTAAAGAAGCCGTTTTCGCGGTGTTAATGACCGCCTGCGGTCTTGCACCCGTAGGCGCAGCATTGCTGCTTGCCGCGGGGATTGGGCCACCCG	NA	NA	NA	NA
>prophage 5
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	1778188	1859714	4526841	plate,tRNA,transposase	Yellowstone_lake_phycodnavirus(20.0%)	59	NA	NA
WP_002210509.1|1778188_1781005_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|1781004_1781514_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|1781581_1782040_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|1782020_1782974_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002210504.1|1783555_1784377_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|1784849_1786025_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_011191702.1|1786040_1789274_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|1789501_1790116_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|1790439_1791240_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|1791236_1791692_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|1791841_1792324_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_071525509.1|1792712_1793027_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_011906415.1|1793153_1793618_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|1793707_1794577_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210491.1|1794593_1794971_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|1794984_1795803_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|1795795_1796791_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210488.1|1796774_1798079_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_016674007.1|1798146_1800489_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|1800673_1801507_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|1801804_1802425_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|1803647_1804391_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|1804720_1805734_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|1805744_1806305_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210480.1|1806313_1807816_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210479.1|1807978_1808497_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|1808570_1809014_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|1809046_1810891_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|1810883_1811867_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210475.1|1811884_1814473_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210474.1|1814576_1816925_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002224087.1|1816937_1819157_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|1819182_1820286_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|1820278_1820896_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214737.1|1820901_1821267_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210471.1|1821259_1821751_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002210470.1|1821870_1823226_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011906413.1|1823222_1824812_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210468.1|1828336_1828690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220588.1|1828945_1831852_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210466.1|1832296_1834666_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002210465.1|1834861_1835629_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210464.1|1835697_1836408_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002214276.1|1836394_1838002_-	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002214274.1|1837977_1838970_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002210461.1|1839909_1841571_-	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002224086.1|1842234_1843416_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210456.1|1843656_1844259_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|1844273_1845704_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|1845705_1846797_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|1846799_1848362_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210452.1|1848684_1848900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|1849578_1850535_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|1851088_1852894_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_011906411.1|1854675_1856403_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002424260.1|1856375_1856900_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213775.1|1857098_1857557_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210447.1|1858061_1859072_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|1859255_1859714_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	2036016	2115747	4526841	plate,tRNA,transposase	Escherichia_phage(25.0%)	54	NA	NA
WP_002209448.1|2036016_2038644_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|2038893_2039079_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209450.1|2040175_2040742_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209451.1|2040738_2041167_+	DedA family protein	NA	NA	NA	NA	NA
WP_002228236.1|2041249_2042809_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209453.1|2042976_2043492_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002354744.1|2043580_2044861_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002209455.1|2044932_2045724_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|2045889_2047251_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|2047478_2047727_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011906406.1|2047748_2048297_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|2048335_2049076_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|2049156_2049504_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002209462.1|2049765_2050533_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002223245.1|2052629_2053346_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_011901829.1|2054552_2055575_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|2055574_2056354_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209465.1|2056620_2057742_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|2057950_2058409_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228330.1|2058556_2059714_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002209468.1|2060076_2060439_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002209469.1|2060793_2061525_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002231132.1|2061660_2062638_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209471.1|2062639_2063371_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002217405.1|2063500_2066074_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002218887.1|2066399_2066585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212076.1|2072775_2073705_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|2074125_2075724_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|2075770_2077078_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|2077333_2079061_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002230619.1|2079180_2080023_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_011906136.1|2080237_2083933_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_032485879.1|2089006_2090695_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011906137.1|2091262_2092648_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|2093017_2094664_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011906138.1|2094798_2095206_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|2095348_2096239_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|2096252_2097830_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_011906139.1|2098016_2099228_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|2099815_2100052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|2100055_2101165_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|2101235_2102507_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|2102747_2103659_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|2104129_2104408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|2104559_2105078_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|2105601_2106099_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002230616.1|2106166_2107648_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|2107654_2108095_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|2109210_2110565_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002228704.1|2110615_2111359_+	type VI secretion protein ImpG	NA	NA	NA	NA	NA
WP_002213885.1|2111322_2112411_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002212103.1|2112536_2113853_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002212104.1|2113852_2114398_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212105.1|2114400_2115747_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	2206714	2269038	4526841	protease,transposase,tail	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|2206714_2208160_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|2208362_2211221_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|2211245_2214077_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|2214277_2214637_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_016674138.1|2214633_2215056_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	53.6	7.0e-30
WP_002214300.1|2215068_2215371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|2215504_2219995_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|2220051_2223645_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|2223685_2226187_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|2226422_2227289_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|2227549_2228461_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|2228763_2228967_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|2228974_2229910_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|2229911_2231867_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|2233796_2234270_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|2234274_2234556_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|2234667_2235216_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|2235396_2236737_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|2236985_2237630_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|2237837_2238224_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|2238463_2238874_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|2239226_2240894_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|2240988_2242404_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_016674079.1|2242814_2243768_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|2244001_2244478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|2244776_2245163_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|2245300_2245765_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|2245776_2246712_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|2247049_2247322_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|2247318_2248173_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|2248478_2248961_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|2249389_2250823_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011906149.1|2250884_2251610_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|2251616_2252162_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|2252145_2252709_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|2252705_2253269_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|2253377_2254364_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_038893343.1|2254474_2255449_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|2255713_2256532_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|2256749_2257532_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|2257536_2258094_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|2258106_2258730_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|2258765_2259068_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|2259214_2259469_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|2259622_2260885_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|2261065_2262154_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|2262379_2262838_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|2262954_2264328_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|2264598_2265003_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|2265226_2266354_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|2266666_2267095_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|2267109_2267502_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|2267498_2267696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|2267875_2268517_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|2268522_2269038_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 8
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	2503964	2584948	4526841	tRNA,plate,protease,transposase	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002215902.1|2503964_2504615_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|2505065_2505461_+	lipoprotein	NA	NA	NA	NA	NA
WP_002213014.1|2507736_2508237_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_041175540.1|2508279_2509830_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|2509841_2511194_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2511190_2511877_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|2511876_2513613_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2513616_2514108_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|2514525_2517174_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011906172.1|2517170_2519519_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210009.1|2519534_2521832_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|2521818_2522586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|2522681_2523378_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|2523986_2524622_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|2525950_2528113_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|2528668_2529628_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|2529673_2531173_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|2531205_2532189_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|2532271_2534305_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|2534408_2535509_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|2535825_2536902_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|2537084_2537357_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|2537534_2538650_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|2538987_2539707_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|2539706_2540033_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|2540143_2541070_+	glutaminase B	NA	NA	NA	NA	NA
WP_038905510.1|2542410_2551743_+	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209987.1|2551932_2553063_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|2553055_2553649_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|2553748_2554039_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|2554035_2554590_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|2554877_2555699_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|2555831_2556530_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|2556549_2557674_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|2557782_2558898_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|2558901_2559786_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|2559965_2560388_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|2560387_2560951_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|2561066_2562026_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|2562051_2562783_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|2563034_2563742_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|2563839_2564352_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|2564544_2565699_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|2566905_2568885_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|2569044_2569365_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|2569398_2569509_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|2569654_2570407_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|2570897_2572892_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|2573199_2573658_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209964.1|2573998_2575015_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|2575117_2576281_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|2576400_2577480_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|2577917_2578787_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209960.1|2579049_2579667_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209959.1|2579856_2580636_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|2580646_2581555_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|2581896_2582553_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|2582859_2584101_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002213775.1|2584489_2584948_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	2895450	2963137	4526841	plate,protease,transposase	Escherichia_phage(28.57%)	53	NA	NA
WP_002213775.1|2895450_2895909_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|2897069_2897849_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|2897848_2898871_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211286.1|2899504_2899693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|2899958_2900477_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_032485934.1|2900545_2902297_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|2902507_2902963_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|2903131_2903590_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|2903780_2904842_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|2905199_2905706_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|2905934_2906570_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|2906671_2908810_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|2908839_2909286_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|2909479_2911534_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|2911594_2912059_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|2912237_2912918_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|2913233_2913650_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|2913758_2914076_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|2914136_2915327_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|2915420_2915699_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|2915750_2916080_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|2919725_2922143_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|2922296_2923043_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|2923773_2923992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|2924255_2924780_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|2924769_2926053_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2926054_2926792_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011906264.1|2926807_2928046_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|2928038_2928758_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|2928759_2929512_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|2929514_2930303_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|2930389_2930830_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|2930867_2931116_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|2931214_2932063_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|2933051_2933552_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|2933594_2935145_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_050879673.1|2935156_2936509_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2936505_2937192_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|2937191_2938928_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2938931_2939423_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042659392.1|2939810_2942453_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	2.8e-92
WP_002211928.1|2942455_2944804_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_013060322.1|2944819_2947120_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|2947116_2947890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|2948043_2948304_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|2948319_2950503_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|2950675_2951146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674153.1|2953310_2954543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|2954539_2957962_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|2958005_2959607_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|2959624_2960683_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|2960697_2961153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|2961373_2963137_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	3443646	3556183	4526841	transposase,lysis,terminase,tail,tRNA,integrase	Escherichia_phage(11.11%)	111	3443502:3443561	3498428:3499142
3443502:3443561	attL	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCA	NA	NA	NA	NA
WP_002213775.1|3443646_3444105_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211199.1|3444431_3445046_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211198.1|3445207_3446212_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211197.1|3446266_3447052_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002228434.1|3447048_3447807_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_011906217.1|3447882_3448839_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228437.1|3448859_3450176_+	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
WP_002211194.1|3450442_3451405_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002211193.1|3451744_3453187_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002211192.1|3453516_3454386_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011906215.1|3454738_3456223_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	4.0e-80
WP_002211190.1|3456464_3457106_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002211188.1|3457820_3458264_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211187.1|3458250_3458580_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_002211186.1|3458711_3459056_-	RidA family protein	NA	NA	NA	NA	NA
WP_002211185.1|3459186_3461091_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	4.5e-92
WP_002211184.1|3461162_3461861_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|3462598_3462706_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|3463240_3464929_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|3465088_3466210_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|3466446_3466716_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|3466719_3467532_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|3467556_3468243_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|3468963_3469236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|3469376_3470462_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|3470532_3471189_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|3471291_3471738_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002211738.1|3471764_3473003_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_011901829.1|3473072_3474095_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|3474094_3474874_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|3475041_3475302_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|3475601_3476351_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|3476326_3476773_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|3476846_3477452_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|3477452_3477842_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|3477845_3478064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|3478112_3478676_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|3479099_3479309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|3479305_3479581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|3479826_3480024_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|3480054_3480567_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|3480551_3481010_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|3481555_3482269_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|3482725_3483361_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|3483391_3483841_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_011906214.1|3483850_3485341_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002228445.1|3485340_3486069_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|3486087_3486729_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|3486729_3487842_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|3487963_3488737_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|3488750_3489956_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|3490003_3490486_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|3490482_3490737_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|3490738_3491089_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|3491090_3491675_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|3491671_3492079_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|3492144_3493065_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|3493077_3493389_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|3493436_3493697_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_011906212.1|3493697_3497213_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|3497215_3497557_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|3497862_3498321_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|3498572_3499031_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211709.1|3499150_3499903_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
3498428:3499142	attR	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCAGTTATAAAAACCCCTTTTGATTTGTTAAAACAGTTTGCGGTCTGGCAACTGCAAATGTTCAACAAGAAATCAAAAGGGGGTCCCAATGAGGGATGAAAAGAGCTTAGCGCACACCCGATGGAACTGTAAATATCATATAGTTTTTGCGCCGAAGTACCGAAGGCAGGTGTTCTACAGGGAAAAACGCAGAGCGATTGGCAGTATTTTAAGAAAACTGTGCGAATGGAAAAACGTGAATATCCTGGAAGCAGAATGCTGTGTGGATCACATCCATATGCTTCTGGAGATCCCGCCCAAGATGAGTGTCTCGGGATTTATGGGGTACCTGAAGGGAAAGAGCAGTCTGATGCTTTATGAGCAGTTTGGCGATTTGAAGTTCAAATACCGTAACAGGGAGTTTTGGTGTCGAGGGTATTACGTTGATACGGTAGGGAAAAACACGGCCAGGATACAAGAATACATAAAGCACCAATTGGAAGAGGATAAAATGGGTGAGCAACTCTCGATCCCGTATCCCGGTAGCCCGTTTACGGGCCGTAAGTAATCCATAGATGCAAATGTCAGATCGCGATGCGCCTGTTAGGGCGCGGCTGGTAACAGAGCCTTATAGGCGCATATGAAAAACCTCCGGCTATGCCGGAGGATATTTATTATG	NA	NA	NA	NA
WP_002211708.1|3499905_3500616_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211706.1|3501598_3502030_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|3502153_3502321_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|3502394_3503402_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|3503500_3504052_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|3504194_3504410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|3504465_3505086_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|3505260_3505482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3505657_3508861_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|3508860_3509859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|3509875_3510793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|3510854_3511223_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002214492.1|3511633_3512806_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211693.1|3512809_3514009_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|3514025_3514766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|3515857_3516214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|3516630_3517161_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|3517396_3518971_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|3519214_3519934_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|3520151_3521687_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_011906208.1|3522152_3523457_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|3523472_3524675_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|3524939_3525809_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|3526006_3526912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|3526946_3528065_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|3528172_3529447_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_011906207.1|3529596_3531531_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|3531974_3532724_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|3532796_3533672_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_011906206.1|3533985_3534981_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|3535328_3535742_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|3535812_3536085_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|3536218_3536866_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|3536880_3537897_-	asparaginase	NA	NA	NA	NA	NA
WP_011192431.1|3538013_3539864_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|3540026_3540578_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211670.1|3541809_3543735_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|3543731_3544022_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|3544034_3544421_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|3544518_3545325_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|3546134_3546995_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|3547213_3548422_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002230891.1|3549058_3549907_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002210666.1|3549990_3550455_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|3551788_3552805_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|3553111_3554458_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002209743.1|3554974_3556183_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 11
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	3827610	3886429	4526841	coat,protease,tRNA,transposase	Tupanvirus(18.18%)	52	NA	NA
WP_011906184.1|3827610_3829998_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|3830011_3830995_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|3831351_3831399_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|3831493_3831850_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016674119.1|3831887_3832085_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|3832181_3832733_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|3832736_3834665_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|3835055_3835268_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|3836026_3836278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|3836596_3837280_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|3837401_3838064_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|3838275_3839244_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|3839240_3840131_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|3840130_3841015_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|3841011_3841905_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|3841972_3842185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|3842209_3843085_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|3843213_3843768_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|3844178_3844844_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|3845078_3846287_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3846334_3846685_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3847020_3847857_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3847948_3848710_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|3849045_3850713_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|3850753_3851644_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3851636_3852557_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3852570_3853698_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|3853713_3855006_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3855303_3856014_+	porin	NA	NA	NA	NA	NA
WP_016674211.1|3856547_3857096_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	5.2e-09
WP_002210838.1|3857299_3858691_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3858905_3859757_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|3860141_3860933_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3861119_3862286_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3862612_3863980_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3864033_3864837_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3864833_3865997_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|3865993_3868606_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|3868687_3869467_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3869619_3870162_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|3870819_3871701_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|3872155_3874228_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|3874247_3874961_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|3875056_3875554_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|3875785_3877033_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|3877001_3879653_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|3880130_3880685_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|3880690_3881221_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|3881241_3881799_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|3881829_3882582_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|3882786_3885234_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011906287.1|3885439_3886429_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 12
NZ_CP006754	Yersinia pestis 3067 chromosome, complete genome	4526841	4201151	4271413	4526841	plate,tRNA,transposase	Escherichia_phage(53.85%)	55	NA	NA
WP_002209686.1|4201151_4201631_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|4201711_4202518_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|4202537_4203380_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|4203385_4203646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906308.1|4203744_4206024_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	2.9e-29
WP_002209681.1|4210152_4210989_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|4211004_4211784_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|4211783_4212806_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211571.1|4213484_4214834_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|4214837_4215377_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|4215650_4216136_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|4216461_4217964_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|4217987_4218512_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016674143.1|4218616_4219225_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|4219209_4220400_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|4220424_4221633_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002231031.1|4221654_4223205_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|4223332_4224094_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|4224250_4224796_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|4224996_4227672_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|4228454_4230335_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211584.1|4231453_4232635_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002215319.1|4232641_4233673_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002211586.1|4233712_4235050_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_016583104.1|4235046_4235712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211588.1|4235712_4237395_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011906313.1|4237391_4237874_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211590.1|4238231_4238834_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211594.1|4240095_4241190_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211596.1|4241518_4242538_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002215840.1|4242593_4244180_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211598.1|4244176_4245226_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002211599.1|4245298_4245823_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|4246289_4246769_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211601.1|4246998_4247847_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002211602.1|4248677_4251104_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211603.1|4251115_4251733_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|4251734_4252511_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002228419.1|4252868_4253465_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211606.1|4253461_4254031_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002211607.1|4254276_4254933_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002215846.1|4254929_4255286_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002215847.1|4255312_4255984_-	lipoprotein	NA	NA	NA	NA	NA
WP_002211610.1|4256573_4257005_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|4257099_4257624_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_011906314.1|4257849_4259085_-	alanine transaminase	NA	NA	NA	NA	NA
WP_002211614.1|4259350_4260598_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211615.1|4260675_4261647_-	glucokinase	NA	NA	NA	NA	NA
WP_002211616.1|4261827_4262304_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211617.1|4262406_4263285_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016674232.1|4263420_4264410_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002354622.1|4264679_4264994_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211621.1|4265086_4266316_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002222185.1|4269051_4270467_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002213775.1|4270954_4271413_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP006753	Yersinia pestis 3067 plasmid pCD1, complete sequence	71522	7267	33197	71522	transposase	Enterobacteria_phage(37.5%)	22	NA	NA
WP_011906282.1|7267_8290_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_001297096.1|8289_9069_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901819.1|9783_11190_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|12872_13739_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002213290.1|14134_16333_-	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002233145.1|16350_16779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|17524_17764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|18936_19815_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|19795_19870_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|20111_20366_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|20503_20752_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|21168_21576_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213008.1|21599_21917_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|22088_22547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|22615_22885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011901828.1|25496_27812_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_002213258.1|27975_28527_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|28545_29010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|29148_29478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|29577_30676_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|30824_31250_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_002220893.1|32024_33197_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
>prophage 1
NZ_CP006752	Yersinia pestis 3067 plasmid pMT1, complete sequence	137727	5277	134536	137727	tail,transposase,terminase	Salmonella_phage(79.52%)	130	NA	NA
WP_002224363.1|5277_5583_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|5728_5944_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002231172.1|6103_7426_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_016256030.1|7460_7718_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002224265.1|8018_8813_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|9065_9788_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_050879647.1|9821_11030_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011201822.1|11150_13970_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_011201821.1|13969_15343_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_011901837.1|15339_15885_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_011901838.1|15874_16123_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_011201818.1|16139_16889_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_016674191.1|16919_17108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011201817.1|17139_18990_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_016674192.1|18986_19616_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_032485960.1|19632_20619_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_011901841.1|20621_21269_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_011201813.1|21268_21616_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_011901842.1|21612_24243_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_011201812.1|24235_24802_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_016674193.1|24791_25196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016674194.1|25179_25365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016674195.1|25368_25593_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_011201809.1|25712_26252_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_011901843.1|26273_27668_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_011201807.1|27654_28398_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_011201806.1|28384_28951_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_011201805.1|28965_29271_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_011901844.1|29421_29772_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_071589830.1|29829_29958_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|29981_31190_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_016674166.1|31271_33383_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_016674165.1|33382_38623_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_011901847.1|38624_39362_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_008324922.1|39428_40148_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_011901848.1|40140_40932_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011201827.1|41079_41634_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	7.8e-21
WP_100228227.1|41611_41755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201829.1|41973_42051_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_086028848.1|42031_42907_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002211760.1|44113_45136_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|47211_48975_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|49052_49541_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|50279_50555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|50577_51519_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|51584_52205_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|52404_52731_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|52730_52958_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|53259_54465_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|54461_55433_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|55811_57209_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|57370_57571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|58071_58749_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|58748_58970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|58980_59400_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|59453_60233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|60631_61138_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|61850_62081_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|62153_64163_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_011901829.1|64286_65309_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|65308_66088_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|66221_66830_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|67131_70020_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|70100_70679_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_011901830.1|70735_75367_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
WP_002211773.1|75388_75976_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|75963_76761_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|76753_77452_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|77541_77877_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|77918_82496_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|82503_82728_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|82853_83171_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|83230_83977_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|84051_84435_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|84436_84910_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|84900_85245_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|85342_86176_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|86175_86610_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|86653_87316_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|87390_88266_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|88292_89189_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476623.1|89211_90786_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002211787.1|90819_92076_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|92078_92720_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|92915_93182_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|93191_94082_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|94087_94342_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|94334_94973_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|94969_95638_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|95637_96336_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|96412_97972_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|97974_98253_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|98312_98735_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|98739_99267_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|99590_100241_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|100325_100553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|100778_101237_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211801.1|101912_102395_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|102600_102882_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_050879659.1|103081_103540_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|103778_104534_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|104732_105875_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|105982_108298_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_011201798.1|108375_108945_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002213303.1|108957_109704_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|109693_110053_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|111839_112925_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|113340_114363_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|114722_114947_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|116131_117196_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|117764_117977_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|117976_118312_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|118308_118488_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|118528_118804_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|118871_119282_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|119265_119637_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002213775.1|119856_120315_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002222866.1|120500_121331_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|121334_121535_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|121625_122657_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|122704_122971_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|122970_123915_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|123975_125004_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|125123_125555_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|125775_126027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201800.1|126099_126663_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002425587.1|126692_127118_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|127132_130657_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|130837_132073_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|132169_134536_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
