The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	17915	75843	4530125	transposase,tRNA,plate	Yellowstone_lake_phycodnavirus(25.0%)	40	NA	NA
WP_002213759.1|17915_18374_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210447.1|18557_19568_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|20072_20531_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|20729_21254_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011906411.1|21226_22954_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002209743.1|23453_24662_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002216437.1|24736_26542_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|27112_28069_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|28747_28963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210453.1|29285_30848_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|30850_31942_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|31943_33374_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|33388_33991_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|34231_35413_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|36076_37738_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|38677_39670_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|39645_41253_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|41239_41950_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|42018_42786_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|42981_45351_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|45795_48702_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|48957_49311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906413.1|52835_54425_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|54421_55777_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|55896_56388_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|56380_56746_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|56751_57369_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|57361_58465_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|58490_60710_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|60722_63071_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|63174_65763_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|65780_66764_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|66756_68601_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|68633_69077_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|69150_69669_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|69831_71334_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|71342_71903_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|71913_72927_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|73256_74000_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|75222_75843_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	1103019	1165619	4530125	transposase,protease,tRNA	Bacillus_phage(21.43%)	59	NA	NA
WP_002209154.1|1103019_1104279_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_002209155.1|1104282_1105287_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002217227.1|1105458_1105659_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002209157.1|1105758_1107057_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
WP_002217229.1|1107405_1107831_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209161.1|1110725_1111466_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_032484797.1|1111885_1113517_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002215294.1|1113588_1113900_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_011901829.1|1114216_1115239_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1115238_1116018_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_032485927.1|1116083_1116800_+	esterase	NA	NA	NA	NA	NA
WP_011906452.1|1117166_1117559_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002430134.1|1117567_1117885_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210155.1|1117889_1118117_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210156.1|1118156_1118609_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_042659218.1|1118848_1119262_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002210157.1|1119383_1119839_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210158.1|1119978_1120719_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_002228198.1|1121076_1121697_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210159.1|1121794_1122460_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_002210160.1|1122614_1124585_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002220539.1|1125019_1125760_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_002210162.1|1125762_1126326_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_002210163.1|1126661_1126874_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_002210164.1|1126981_1128313_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002210165.1|1128571_1129210_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002210166.1|1129484_1131221_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_011906451.1|1131217_1135114_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_002210168.1|1135116_1135473_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002210169.1|1135590_1136118_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_011191626.1|1136317_1137331_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	1.8e-71
WP_002210171.1|1137501_1138884_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210172.1|1139179_1139443_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002210173.1|1139831_1140302_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002210174.1|1140765_1141704_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002210175.1|1142137_1142413_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210176.1|1142596_1142944_+	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210177.1|1143040_1144012_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	6.0e-08
WP_002210178.1|1144271_1144583_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002210179.1|1144602_1144860_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210180.1|1144947_1145934_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002210181.1|1145934_1147107_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002210182.1|1147201_1148269_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210183.1|1148265_1148928_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_002217314.1|1148933_1150382_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_002210184.1|1150639_1151116_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002210185.1|1151243_1151537_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002228196.1|1151683_1152313_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_002228195.1|1152369_1154304_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
WP_002210188.1|1154423_1155257_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	6.5e-19
WP_002210189.1|1155266_1156607_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002210190.1|1156829_1157165_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002222054.1|1157696_1158149_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002209253.1|1158170_1159658_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002223151.1|1159682_1162361_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
WP_002209255.1|1162426_1162837_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002209256.1|1162836_1163811_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002209257.1|1163933_1164203_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_086558220.1|1164265_1165619_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 3
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	1615762	1672378	4530125	transposase,protease,tRNA,holin	Planktothrix_phage(16.67%)	46	NA	NA
WP_011906358.1|1615762_1616221_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_011906357.1|1616449_1618153_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_002218281.1|1618175_1619648_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|1619705_1620302_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|1620666_1622715_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|1622946_1623840_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|1623877_1624726_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|1625071_1625935_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213759.1|1626863_1627322_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210776.1|1627736_1628666_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002228612.1|1628965_1629904_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210778.1|1629977_1630157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210780.1|1630495_1631431_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210781.1|1631551_1633264_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210782.1|1633473_1634013_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_011906355.1|1634038_1634380_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210785.1|1634692_1635796_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002210786.1|1635980_1636229_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210787.1|1636436_1637273_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_011906354.1|1637309_1638239_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210789.1|1638341_1639202_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210790.1|1639204_1640086_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210791.1|1640331_1640805_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210792.1|1641232_1642501_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210793.1|1642624_1644226_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210794.1|1644225_1645302_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_032465620.1|1645364_1646135_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002223523.1|1646228_1646927_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_002210797.1|1647041_1647899_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002210798.1|1647922_1649338_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210799.1|1649534_1650389_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_011191984.1|1651124_1652057_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210801.1|1652317_1653472_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|1653468_1654407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002353933.1|1654541_1655240_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210804.1|1655777_1657112_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002209743.1|1658495_1659704_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210806.1|1660928_1661132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210807.1|1661256_1662147_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210809.1|1662558_1663674_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210810.1|1663943_1666124_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002228030.1|1666191_1667634_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210812.1|1667991_1668534_+	membrane protein	NA	NA	NA	NA	NA
WP_002221775.1|1668790_1669999_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210814.1|1670617_1671811_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002210815.1|1671868_1672378_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 4
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	1695471	1727030	4530125	transposase,tail,coat,plate	Escherichia_phage(17.65%)	33	NA	NA
WP_011906348.1|1695471_1697259_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1697740_1698676_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1698847_1699090_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1699295_1700018_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1700291_1700771_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1700981_1702286_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_116463120.1|1702318_1703014_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208861.1|1703016_1703829_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1703804_1704599_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1705195_1705486_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1705531_1706149_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1706153_1706348_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1706344_1707853_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1707874_1708243_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|1708244_1708544_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1708664_1710158_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1710424_1711831_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1711827_1712883_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208848.1|1713492_1713948_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1713951_1715088_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1715084_1715345_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1715341_1715689_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1715785_1716565_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|1716862_1717603_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|1717893_1719330_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|1719455_1719818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|1720517_1721006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|1721018_1722167_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|1722523_1722907_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|1723137_1724934_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|1724961_1725189_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|1725366_1726371_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|1726571_1727030_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	2127640	2198001	4530125	transposase,plate,tRNA	Escherichia_phage(42.86%)	59	NA	NA
WP_002213759.1|2127640_2128099_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|2128241_2128751_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|2128799_2130527_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|2130575_2130833_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|2131331_2132300_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002231042.1|2132456_2133191_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|2133439_2134426_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|2134516_2136529_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|2136548_2136764_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|2136864_2137212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|2137343_2137949_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|2138215_2138674_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|2139161_2140577_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211621.1|2143432_2144662_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|2144754_2145069_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|2145338_2146328_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|2146463_2147342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|2147444_2147921_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|2148101_2149073_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|2149150_2150398_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_011906314.1|2150663_2151899_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|2152124_2152649_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|2152743_2153175_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|2153764_2154436_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|2154462_2154819_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|2154815_2155472_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|2155717_2156287_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|2156283_2156880_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|2157237_2158014_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|2158015_2158633_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|2158644_2161071_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|2161901_2162750_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|2162979_2163459_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|2163925_2164450_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|2164522_2165572_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|2165568_2167155_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|2167210_2168230_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|2168558_2169653_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|2170914_2171517_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011906313.1|2171874_2172357_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|2172353_2174036_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002224806.1|2174036_2174738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|2174734_2176072_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|2176111_2177143_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|2177149_2178331_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211582.1|2179449_2181330_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|2182112_2184788_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|2184988_2185534_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|2185690_2186452_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002231031.1|2186579_2188130_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2188151_2189360_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|2189384_2190575_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011906310.1|2190559_2191168_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|2191272_2191797_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|2191820_2193323_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|2193648_2194134_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|2194407_2194947_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|2194950_2196300_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011901829.1|2196978_2198001_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
>prophage 6
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	2519662	2537632	4530125	transposase,protease,coat	Escherichia_phage(50.0%)	15	NA	NA
WP_000255944.1|2519662_2520685_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|2521091_2521481_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|2521590_2521830_-	YebV family protein	NA	NA	NA	NA	NA
WP_011906287.1|2522037_2523027_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|2523232_2525680_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|2525867_2526620_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|2526650_2527208_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2527228_2527759_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|2527764_2528319_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|2528798_2531450_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|2531418_2532666_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|2532897_2533395_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|2533490_2534204_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|2534223_2536296_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|2536750_2537632_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	2852894	2947192	4530125	transposase,integrase,terminase,tail,tRNA,lysis	Escherichia_phage(12.77%)	91	2897514:2897544	2936616:2936646
WP_002209743.1|2852894_2854103_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210665.1|2856273_2857290_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|2858623_2859088_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|2859171_2860020_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|2860656_2861865_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|2862083_2862944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|2863753_2864560_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2864657_2865044_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2865056_2865347_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2865343_2867269_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211673.1|2868485_2869037_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_011192431.1|2869199_2871050_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2871166_2872183_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2872197_2872845_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2872978_2873251_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2873321_2873735_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011906206.1|2874082_2875078_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|2875391_2876267_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2876339_2877089_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011906207.1|2877532_2879467_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|2879616_2880891_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|2880998_2882117_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2882151_2883057_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2883254_2884124_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2884388_2885591_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_011906208.1|2885606_2886911_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|2887376_2888912_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2889129_2889849_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|2890092_2891667_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2891902_2892433_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2892849_2893206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2894297_2895038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2895054_2896254_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
2897514:2897544	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_097608205.1|2897840_2898209_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|2898270_2899188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2899204_2900203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2900202_2903406_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|2903581_2903803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2903977_2904598_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2904653_2904869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2905011_2905563_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2905661_2906669_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2906742_2906910_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2907033_2907465_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211708.1|2908447_2909158_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|2909160_2909913_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|2910032_2910491_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|2910796_2911138_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_011906212.1|2911140_2914656_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|2914656_2914917_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|2914964_2915276_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|2915288_2916209_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|2916274_2916682_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|2916678_2917263_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211717.1|2917617_2917872_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|2917868_2918351_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|2918398_2919604_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|2919617_2920391_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|2920512_2921625_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|2921625_2922267_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|2922285_2923014_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_011906214.1|2923013_2924504_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002211724.1|2924513_2924963_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|2924993_2925629_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|2926085_2926799_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|2927344_2927803_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|2927787_2928300_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|2928330_2928528_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|2928773_2929049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2929045_2929255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2929678_2930242_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2930290_2930509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|2930512_2930902_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2930902_2931508_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2931581_2932028_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2932003_2932753_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2933052_2933313_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|2933480_2934260_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|2934259_2935282_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211738.1|2935351_2936590_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|2936616_2937063_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2936616:2936646	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|2937165_2937822_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|2937892_2938978_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|2939118_2939391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|2940111_2940798_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|2940822_2941635_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|2941638_2941908_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|2942144_2943266_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002220632.1|2943425_2945114_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|2945648_2945756_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211184.1|2946493_2947192_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	3400415	3445573	4530125	transposase,plate,lysis,tRNA	Escherichia_phage(25.0%)	36	NA	NA
WP_002211870.1|3400415_3402443_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|3402606_3403065_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|3403282_3403945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|3404642_3405719_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|3405736_3406990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|3407322_3408504_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|3408745_3409153_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|3409149_3409845_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|3410180_3411065_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|3411420_3413118_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|3413398_3414136_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_011901829.1|3414854_3415877_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|3415876_3416656_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011906260.1|3417570_3419085_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	3.4e-10
WP_002211963.1|3419314_3420307_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|3421054_3422221_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|3422275_3422938_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|3423121_3424273_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|3424408_3425278_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002224699.1|3425551_3426691_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211956.1|3426711_3427554_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|3427810_3428023_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|3428106_3430467_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|3430468_3431731_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|3431732_3432401_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|3432410_3433721_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|3434255_3435530_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|3435531_3436302_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002211947.1|3436366_3437020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|3437247_3438843_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|3439525_3440149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|3440360_3441728_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|3441752_3442205_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|3442204_3442786_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011906261.1|3442760_3443846_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|3443809_3445573_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 9
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	3821587	3902553	4530125	transposase,protease,plate,tRNA	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002213775.1|3821587_3822046_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209956.1|3822434_3823676_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002209957.1|3823982_3824639_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209958.1|3824980_3825889_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209959.1|3825899_3826679_-	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209960.1|3826868_3827486_-	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209961.1|3827748_3828618_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209962.1|3829055_3830135_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209963.1|3830254_3831418_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209964.1|3831520_3832537_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|3832877_3833336_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209965.1|3833643_3835638_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|3836128_3836881_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|3837026_3837137_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|3837170_3837491_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|3837650_3839630_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|3840836_3841991_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228653.1|3842183_3842696_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|3842793_3843501_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|3843752_3844484_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|3844509_3845469_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|3845584_3846148_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|3846147_3846570_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|3846749_3847634_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|3847637_3848753_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|3848861_3849986_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|3850005_3850704_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|3850836_3851658_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|3851945_3852500_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|3852496_3852787_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|3852886_3853480_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|3853472_3854603_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011906173.1|3854792_3864125_-	virulence determinant	NA	NA	NA	NA	NA
WP_002209989.1|3865465_3866392_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|3866502_3866829_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|3866828_3867548_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|3867885_3869001_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|3869178_3869451_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|3869633_3870710_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|3871008_3872109_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|3872212_3874246_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|3874328_3875312_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|3875344_3876844_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|3876889_3877849_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3878404_3880567_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|3881895_3882531_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|3883138_3883836_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|3883931_3884699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|3884685_3886983_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011906172.1|3886998_3889347_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210013.1|3889343_3891992_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210014.1|3892409_3892901_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|3892904_3894641_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|3894640_3895327_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_050881258.1|3895323_3896676_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_041175540.1|3896687_3898238_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|3898280_3898781_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|3901056_3901452_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|3901902_3902553_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	4138895	4201191	4530125	transposase,protease,tail	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002216203.1|4138895_4139411_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|4139416_4140058_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|4140237_4140435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|4140431_4140824_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|4140838_4141267_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|4141579_4142707_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|4142930_4143335_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|4143605_4144979_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|4145095_4145554_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|4145779_4146868_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|4147048_4148311_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|4148464_4148719_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|4148865_4149168_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|4149203_4149827_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|4149839_4150397_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|4150401_4151184_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|4151401_4152220_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|4152484_4153459_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|4153569_4154556_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|4154664_4155228_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|4155224_4155788_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|4155771_4156317_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_011906149.1|4156323_4157049_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|4157110_4158544_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|4158972_4159455_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|4159760_4160615_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|4160611_4160884_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|4161221_4162157_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|4162168_4162633_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|4162770_4163157_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|4163455_4163932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|4164165_4165119_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|4165529_4166945_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|4167039_4168707_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|4169059_4169470_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|4169693_4170080_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|4170287_4170932_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|4171180_4172521_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|4172701_4173250_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|4173361_4173643_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|4173647_4174121_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|4176050_4178006_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|4178007_4178943_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|4178950_4179154_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|4179456_4180368_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|4180628_4181495_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|4181730_4184232_+	toxin	NA	NA	NA	NA	NA
WP_002220204.1|4184272_4187866_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|4187922_4192413_+	toxin	NA	NA	NA	NA	NA
WP_002214300.1|4192546_4192849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011906147.1|4192861_4193263_+	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	60.2	1.1e-35
WP_002210086.1|4193259_4193619_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002228695.1|4193819_4196660_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210083.1|4196684_4199543_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210082.1|4199745_4201191_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 11
NZ_CP006758	Yersinia pestis 1522 chromosome, complete genome	4530125	4292032	4353227	4530125	transposase,plate	Escherichia_phage(33.33%)	39	NA	NA
WP_002212105.1|4292032_4293379_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002212104.1|4293381_4293927_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212103.1|4293926_4295243_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002213885.1|4295368_4296457_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002228704.1|4296420_4297164_-	type VI secretion protein ImpG	NA	NA	NA	NA	NA
WP_100067904.1|4297214_4298568_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002212100.1|4299684_4300125_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002230616.1|4300131_4301613_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212098.1|4301680_4302178_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212097.1|4302701_4303220_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212095.1|4303371_4303650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212093.1|4304120_4305032_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212092.1|4305272_4306544_-	maltoporin	NA	NA	NA	NA	NA
WP_002212091.1|4306614_4307724_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002221973.1|4307727_4307964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906139.1|4308551_4309763_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002212088.1|4309949_4311527_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212087.1|4311540_4312431_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_011906138.1|4312573_4312981_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212085.1|4313115_4314762_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011906137.1|4315131_4316517_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_032485879.1|4317084_4318773_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011906136.1|4323846_4327542_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002230619.1|4327756_4328599_+	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_002212079.1|4328718_4330446_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212078.1|4330701_4332009_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212077.1|4332055_4333654_-	malate synthase A	NA	NA	NA	NA	NA
WP_002212076.1|4334074_4335004_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002218887.1|4341193_4341379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217405.1|4341704_4344278_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002209471.1|4344407_4345139_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002231132.1|4345140_4346118_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209469.1|4346253_4346985_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002209468.1|4347339_4347702_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_050881260.1|4348033_4348486_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228330.1|4348775_4349933_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002209465.1|4350037_4351159_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001297096.1|4351425_4352205_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|4352204_4353227_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
>prophage 1
NZ_CP006757	Yersinia pestis 1522 plasmid pCD, complete sequence	71507	1448	27378	71507	transposase	Enterobacteria_phage(42.86%)	22	NA	NA
WP_002220893.1|1448_2621_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|3395_3821_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|3968_5068_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|5167_5497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|5635_6100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|6118_6670_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_011901828.1|6833_9149_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_042469136.1|11760_12030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|12098_12557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213008.1|12728_13046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213294.1|13069_13477_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002233137.1|13893_14142_+	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002229817.1|14279_14534_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233140.1|14775_14850_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002213292.1|14830_15709_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002213291.1|16881_17121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002233145.1|17866_18295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213290.1|18312_20511_+	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002213287.1|20906_21773_+	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_011901819.1|23455_24862_+	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_001297096.1|25576_26356_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|26355_27378_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
>prophage 1
NZ_CP006756	Yersinia pestis 1522 plasmid pMT, complete sequence	137012	7065	12818	137012	transposase	Salmonella_phage(83.33%)	7	NA	NA
WP_002209743.1|7065_8274_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|8307_9030_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|9282_10077_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_016256030.1|10377_10635_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002231172.1|10669_11992_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_002224361.1|12151_12367_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002224363.1|12512_12818_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
>prophage 2
NZ_CP006756	Yersinia pestis 1522 plasmid pMT, complete sequence	137012	21287	94478	137012	transposase,terminase,tail	Salmonella_phage(88.41%)	73	NA	NA
WP_002211766.1|21287_23654_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002211767.1|23750_24986_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002221186.1|25166_28691_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002425587.1|28705_29131_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_011201800.1|29160_29724_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002215095.1|29796_30048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213135.1|30268_30700_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002213132.1|30819_31848_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002225551.1|31908_32853_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_000920226.1|32852_33119_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_161597819.1|33166_34198_+	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_002213439.1|34288_34489_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_002222866.1|34492_35323_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002222868.1|35476_35848_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222869.1|35831_36242_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002228797.1|36309_36585_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002228796.1|36625_36805_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002227818.1|36801_37137_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002222711.1|37136_37349_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002214164.1|37917_38982_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002389821.1|40166_40391_+	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002213298.1|40750_41773_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213300.1|42188_43274_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_038918515.1|45060_45420_+	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213303.1|45409_46156_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_011201798.1|46168_46738_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002231165.1|46815_49131_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_002231164.1|49238_50381_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_011901832.1|50579_51335_+	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002213775.1|51573_52032_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|52231_52513_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002211801.1|52718_53201_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002213759.1|53876_54335_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214137.1|54560_54788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|54872_55523_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|55846_56374_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|56378_56801_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|56860_57139_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211794.1|57141_58701_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002228791.1|58773_59472_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211792.1|59471_60140_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|60136_60775_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|60767_61022_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|61027_61918_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|61927_62194_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|62389_63031_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|63033_64290_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_025476623.1|64323_65898_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002231160.1|65920_66817_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211784.1|66843_67719_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211783.1|67793_68456_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|68499_68934_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|68933_69767_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|69864_70209_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|70199_70673_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|70674_71058_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|71132_71879_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_000163862.1|71938_72256_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|72381_72606_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_002211776.1|72613_77191_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000440566.1|77232_77568_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011901831.1|77657_78356_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_002211774.1|78348_79146_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|79133_79721_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_011901830.1|79742_84374_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
WP_002211771.1|84430_85009_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002211770.1|85089_87978_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|88279_88888_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_001297096.1|89021_89801_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|89800_90823_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211744.1|90946_92956_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|93028_93259_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|93971_94478_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
