The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	81117	90259	4524943	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002215390.1|81117_81885_-	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
WP_002212204.1|82595_82847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215393.1|83009_83195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|84087_84867_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|84866_85889_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002215951.1|86493_86811_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|86816_87131_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|87479_88568_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_011906363.1|88564_89524_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002215949.1|89516_90059_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|90058_90259_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
>prophage 2
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	160786	217380	4524943	holin,protease,tRNA,transposase	Enterobacteria_phage(16.67%)	46	NA	NA
WP_011906358.1|160786_161245_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_011906357.1|161473_163177_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_002218281.1|163199_164672_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|164729_165326_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|165690_167739_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|167970_168864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|168901_169750_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|170095_170959_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213759.1|171886_172345_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210776.1|172759_173689_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002228612.1|173988_174927_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210778.1|175000_175180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210780.1|175518_176454_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210781.1|176574_178287_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210782.1|178496_179036_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_011906355.1|179061_179403_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210785.1|179715_180819_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002210786.1|181003_181252_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210787.1|181459_182296_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_011906354.1|182332_183262_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210789.1|183364_184225_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210790.1|184227_185109_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210791.1|185354_185828_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210792.1|186255_187524_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210793.1|187647_189249_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210794.1|189248_190325_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_032465620.1|190387_191158_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002223523.1|191251_191950_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_002210797.1|192064_192922_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002210798.1|192945_194361_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210799.1|194578_195433_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_011191984.1|196168_197101_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210801.1|197361_198516_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|198512_199451_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-20
WP_002353933.1|199585_200284_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210804.1|200779_202114_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_042659403.1|203497_204706_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	1.2e-50
WP_002210806.1|205930_206134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210807.1|206258_207149_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210809.1|207560_208676_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210810.1|208945_211126_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002228030.1|211193_212636_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210812.1|212993_213536_+	membrane protein	NA	NA	NA	NA	NA
WP_002221775.1|213792_215001_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210814.1|215619_216813_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002210815.1|216870_217380_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 3
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	240473	272047	4524943	coat,tail,transposase,plate	Escherichia_phage(17.65%)	33	NA	NA
WP_011906348.1|240473_242261_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|242757_243693_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|243864_244107_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|244312_245035_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|245308_245788_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|245998_247303_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_116463120.1|247335_248031_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208861.1|248033_248846_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|248821_249616_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|250212_250503_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|250548_251166_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|251170_251365_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|251361_252870_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|252891_253260_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|253261_253561_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|253681_255175_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|255441_256848_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|256844_257900_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208848.1|258509_258965_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|258968_260105_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|260101_260362_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|260358_260706_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|260802_261582_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|261879_262620_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|262910_264347_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|264472_264835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|265534_266023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|266035_267184_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|267540_267924_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|268154_269951_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|269978_270206_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|270383_271388_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|271588_272047_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	670420	740745	4524943	tRNA,plate,transposase	Escherichia_phage(42.86%)	59	NA	NA
WP_002213759.1|670420_670879_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|671021_671531_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|671579_673307_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|673355_673613_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|674111_675080_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002231042.1|675236_675971_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|676219_677206_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|677296_679309_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|679328_679544_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|679644_679992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|680123_680729_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|680995_681454_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|681941_683357_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211621.1|686212_687442_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|687534_687849_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_016674232.1|688118_689108_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|689243_690122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|690224_690701_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|690881_691853_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|691930_693178_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_011906314.1|693443_694679_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|694904_695429_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|695523_695955_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|696544_697216_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|697242_697599_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|697595_698252_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|698497_699067_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|699063_699660_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|700017_700794_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|700795_701413_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|701424_703851_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|704681_705530_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|705759_706239_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|706705_707230_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|707302_708352_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|708348_709935_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|709990_711010_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|711338_712433_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|713694_714297_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011906313.1|714654_715137_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|715133_716816_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016583104.1|716816_717482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|717478_718816_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|718855_719887_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|719893_721075_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211582.1|722193_724074_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|724856_727532_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|727732_728278_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|728434_729196_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002231031.1|729323_730874_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|730895_732104_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|732128_733319_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016674143.1|733303_733912_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|734016_734541_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|734564_736067_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|736392_736878_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|737151_737691_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|737694_739044_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011901829.1|739722_740745_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
>prophage 5
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	997717	1073749	4524943	tRNA,coat,transposase	Salmonella_phage(14.29%)	57	NA	NA
WP_002210913.1|997717_998833_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210912.1|999019_999466_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002218214.1|999458_1000085_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_002210910.1|1000215_1001469_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_011906293.1|1001614_1002658_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210908.1|1002933_1003194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210907.1|1003313_1004894_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_002210906.1|1005813_1006671_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002227977.1|1006830_1007214_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002210903.1|1007745_1009071_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_002210902.1|1009372_1009576_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
WP_002210901.1|1009878_1010778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210900.1|1010869_1011319_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214045.1|1011809_1012343_-	membrane protein	NA	NA	NA	NA	NA
WP_002210897.1|1012625_1013636_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016674113.1|1014042_1017225_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.2	0.0e+00
WP_002210893.1|1017765_1017978_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071525649.1|1018069_1018384_+	protein DsrB	NA	NA	NA	NA	NA
WP_002209743.1|1021091_1022300_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210891.1|1022760_1023459_+	MgtC family protein	NA	G3MA03	Bacillus_virus	40.0	2.1e-15
WP_011906291.1|1023859_1026559_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	6.5e-44
WP_002210889.1|1028101_1028683_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_011906290.1|1028887_1029775_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_011171846.1|1029771_1031073_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_011906289.1|1031089_1033255_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002210885.1|1033417_1033915_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_002210884.1|1034206_1035442_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210883.1|1035454_1035832_-	RidA family protein	NA	NA	NA	NA	NA
WP_002210882.1|1035828_1036815_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002210881.1|1037004_1037670_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002224033.1|1038144_1041951_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002210878.1|1042478_1045355_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_002214064.1|1045423_1046125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210876.1|1046365_1048039_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.5e-11
WP_002220817.1|1048222_1049833_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	2.3e-12
WP_002214065.1|1050005_1050878_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002210873.1|1052026_1052416_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	1.3e-06
WP_002210872.1|1052425_1053070_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_002210870.1|1053640_1054405_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	1.9e-09
WP_002215938.1|1054761_1056972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215939.1|1056958_1057393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210869.1|1057492_1058446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210868.1|1059064_1060294_-	alanine racemase	NA	NA	NA	NA	NA
WP_002210867.1|1060695_1060890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210865.1|1061440_1061689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210864.1|1062081_1063338_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_002210862.1|1063492_1063726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1064296_1065076_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|1065075_1066098_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002215943.1|1066504_1066894_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1067003_1067243_-	YebV family protein	NA	NA	NA	NA	NA
WP_011906287.1|1067450_1068440_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1068645_1071093_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1071297_1072050_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1072080_1072638_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1072658_1073189_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1073194_1073749_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	1397290	1492311	4524943	tRNA,integrase,transposase,lysis,terminase,tail	Cronobacter_phage(12.24%)	95	1441924:1441954	1481735:1481765
WP_002209743.1|1397290_1398499_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210664.1|1399015_1400362_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|1400668_1401685_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|1403018_1403483_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|1403566_1404415_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|1405051_1406260_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|1406478_1407339_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|1408148_1408955_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|1409052_1409439_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|1409451_1409742_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|1409738_1411664_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211673.1|1412895_1413447_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_011192431.1|1413609_1415460_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|1415576_1416593_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|1416607_1417255_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|1417388_1417661_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|1417731_1418145_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011906206.1|1418492_1419488_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|1419801_1420677_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|1420749_1421499_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011906207.1|1421942_1423877_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|1424026_1425301_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|1425408_1426527_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|1426561_1427467_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|1427664_1428534_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|1428798_1430001_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_011906208.1|1430016_1431321_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|1431786_1433322_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|1433539_1434259_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|1434502_1436077_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|1436312_1436843_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|1437259_1437616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|1438707_1439448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|1439464_1440664_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|1440667_1441840_+	MFS transporter	NA	NA	NA	NA	NA
1441924:1441954	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_097608205.1|1442250_1442619_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|1442680_1443598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|1443614_1444613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|1444612_1447816_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|1447991_1448213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|1448387_1449008_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|1449063_1449279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|1449421_1449973_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|1450071_1451079_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|1451152_1451320_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|1451443_1451875_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211708.1|1452857_1453568_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|1453570_1454323_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213775.1|1454442_1454901_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|1455152_1455611_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|1455916_1456258_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_011906212.1|1456260_1459776_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|1459776_1460037_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|1460084_1460396_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|1460408_1461329_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|1461394_1461802_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|1461798_1462383_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|1462384_1462735_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|1462736_1462991_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|1462987_1463470_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|1463517_1464723_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|1464736_1465510_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|1465631_1466744_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|1466744_1467386_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|1467404_1468133_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_011906214.1|1468132_1469623_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002211724.1|1469632_1470082_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|1470112_1470748_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|1471204_1471918_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|1472463_1472922_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|1472906_1473419_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|1473449_1473647_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|1473892_1474168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|1474164_1474374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|1474797_1475361_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|1475409_1475628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|1475631_1476021_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|1476021_1476627_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|1476700_1477147_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|1477122_1477872_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|1478171_1478432_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|1478599_1479379_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|1479378_1480401_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211738.1|1480470_1481709_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|1481735_1482182_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
1481735:1481765	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|1482284_1482941_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|1483011_1484097_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|1484237_1484510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|1485230_1485917_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|1485941_1486754_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|1486757_1487027_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|1487263_1488385_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002220632.1|1488544_1490233_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|1490767_1490875_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211184.1|1491612_1492311_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	1945648	2017025	4524943	tRNA,plate,lysis,transposase	Indivirus(11.11%)	51	NA	NA
WP_002211870.1|1945648_1947676_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|1947839_1948298_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|1948515_1949178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|1949875_1950952_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|1950969_1952223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|1952555_1953737_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|1953978_1954386_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|1954382_1955078_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|1955413_1956298_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|1956653_1958351_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|1958631_1959369_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_001297096.1|1961110_1961890_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011906260.1|1962804_1964319_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	3.4e-10
WP_002211963.1|1964548_1965541_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|1966288_1967455_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|1967509_1968172_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|1968355_1969507_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|1969642_1970512_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002224699.1|1970786_1971926_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211956.1|1971946_1972789_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|1973045_1973258_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_042659393.1|1973341_1975702_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|1975703_1976966_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|1976967_1977636_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|1977645_1978956_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|1979490_1980765_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|1980766_1981537_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002211947.1|1981601_1982255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|1982482_1984078_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|1984760_1985384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|1985595_1986963_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|1986987_1987440_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|1987439_1988021_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016674055.1|1987995_1989081_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|1989044_1990808_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211939.1|1991028_1991484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211938.1|1991498_1992557_-	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211937.1|1992574_1994176_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211936.1|1994219_1997642_-	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_016674153.1|1997638_1998871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214564.1|2001035_2001506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211932.1|2001678_2003862_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211931.1|2003877_2004138_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211930.1|2004291_2005065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060322.1|2005061_2007362_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211928.1|2007377_2009726_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_042659392.1|2009728_2012371_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	2.8e-92
WP_002210014.1|2012758_2013250_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002214568.1|2013253_2014990_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|2014989_2015676_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002213011.1|2015672_2017025_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	2366511	2447495	4524943	tRNA,plate,protease,transposase	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002213775.1|2366511_2366970_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209956.1|2367358_2368600_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002209957.1|2368906_2369563_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209958.1|2369904_2370813_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209959.1|2370823_2371603_-	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209960.1|2371792_2372410_-	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209961.1|2372672_2373542_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209962.1|2373979_2375059_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209963.1|2375178_2376342_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209964.1|2376444_2377461_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|2377801_2378260_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209965.1|2378567_2380562_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|2381052_2381805_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|2381950_2382061_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|2382094_2382415_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|2382574_2384554_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|2385760_2386915_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228653.1|2387107_2387620_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|2387717_2388425_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|2388676_2389408_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|2389433_2390393_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|2390508_2391072_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|2391071_2391494_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|2391673_2392558_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|2392561_2393677_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|2393785_2394910_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|2394929_2395628_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|2395760_2396582_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|2396869_2397424_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|2397420_2397711_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|2397810_2398404_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|2398396_2399527_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_038905510.1|2399716_2409049_-	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209989.1|2410389_2411316_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|2411426_2411753_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|2411752_2412472_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|2412809_2413925_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|2414102_2414375_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|2414557_2415634_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|2415950_2417051_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|2417154_2419188_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|2419270_2420254_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|2420286_2421786_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|2421831_2422791_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|2423346_2425509_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|2426837_2427473_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|2428080_2428778_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|2428873_2429641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|2429627_2431925_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011906172.1|2431940_2434289_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210013.1|2434285_2436934_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210014.1|2437351_2437843_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|2437846_2439583_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|2439582_2440269_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002211664.1|2440265_2441618_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_041175540.1|2441629_2443180_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2443222_2443723_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|2445998_2446394_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|2446844_2447495_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	2682385	2744708	4524943	protease,tail,transposase	uncultured_Mediterranean_phage(18.18%)	56	NA	NA
WP_002216203.1|2682385_2682901_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|2682906_2683548_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|2683727_2683925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|2683921_2684314_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|2684328_2684757_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|2685069_2686197_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|2686420_2686825_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|2687095_2688469_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|2688585_2689044_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|2689269_2690358_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|2690538_2691801_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|2691954_2692209_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|2692355_2692658_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|2692693_2693317_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|2693329_2693887_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|2693891_2694674_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|2694891_2695710_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_038893343.1|2695974_2696949_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|2697059_2698046_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|2698154_2698718_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|2698714_2699278_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|2699261_2699807_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_011906149.1|2699813_2700539_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|2700600_2702034_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|2702462_2702945_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|2703250_2704105_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|2704101_2704374_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|2704711_2705647_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|2705658_2706123_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|2706260_2706647_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|2706945_2707422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674079.1|2707655_2708609_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|2709019_2710435_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|2710529_2712197_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|2712549_2712960_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|2713199_2713586_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|2713793_2714438_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|2714686_2716027_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|2716207_2716756_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|2716867_2717149_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|2717153_2717627_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|2719556_2721512_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|2721513_2722449_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|2722456_2722660_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|2722962_2723874_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|2724134_2725001_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|2725236_2727738_+	toxin	NA	NA	NA	NA	NA
WP_002220204.1|2727778_2731372_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|2731428_2735919_+	toxin	NA	NA	NA	NA	NA
WP_002214300.1|2736052_2736355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674138.1|2736367_2736790_+	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	53.6	7.0e-30
WP_002210086.1|2736786_2737146_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210084.1|2737346_2740178_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_071845066.1|2740202_2740985_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002378891.1|2741335_2743060_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210082.1|2743262_2744708_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 10
NZ_CP006783	Yersinia pestis 1412 chromosome, complete genome	4524943	3043857	3097741	4524943	transposase	Erysipelothrix_phage(16.67%)	46	NA	NA
WP_002213775.1|3043857_3044316_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209332.1|3044558_3045983_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.0e-40
WP_002209330.1|3046288_3047818_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_002209329.1|3047831_3050495_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_002216080.1|3050690_3051455_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_002209327.1|3052317_3053715_+	amino acid permease	NA	NA	NA	NA	NA
WP_002209326.1|3054147_3055002_-	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_002209325.1|3055291_3055843_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_002209324.1|3055955_3056864_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_002209323.1|3057066_3057531_+	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_002216083.1|3057523_3059062_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_002209321.1|3059058_3060258_+	protein transport protein HofC	NA	NA	NA	NA	NA
WP_002209320.1|3060652_3061696_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
WP_002209319.1|3061991_3062612_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209318.1|3062608_3063361_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209317.1|3063546_3063753_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_002213759.1|3063942_3064401_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_011901829.1|3064511_3065534_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002210424.1|3066573_3066960_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3067254_3069969_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3070046_3070580_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3070608_3071133_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3071299_3072220_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3072319_3073471_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3073543_3074800_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3074826_3075654_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3075655_3076576_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3076568_3078044_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_011906408.1|3078181_3079252_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3079248_3080451_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3080450_3081767_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3081769_3082852_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3082845_3084222_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3084218_3085706_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011906409.1|3085692_3087456_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3087521_3087839_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_011906410.1|3087835_3088792_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3088794_3089253_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3089807_3089897_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3090354_3090795_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002213759.1|3090994_3091453_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210447.1|3091636_3092647_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|3093151_3093610_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|3093808_3094333_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011906411.1|3094305_3096033_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002209743.1|3096532_3097741_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 1
NZ_CP006780	Yersinia pestis 1412 plasmid pCD, complete sequence	71522	7112	33042	71522	transposase	Enterobacteria_phage(37.5%)	22	NA	NA
WP_011906282.1|7112_8135_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_001297096.1|8134_8914_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901819.1|9628_11035_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|12717_13584_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002213290.1|13979_16178_-	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002233145.1|16195_16624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|17369_17609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|18781_19660_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|19640_19715_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|19956_20211_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|20348_20597_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|21013_21421_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213008.1|21444_21762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|21933_22392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|22460_22730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011901828.1|25341_27657_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_002213258.1|27820_28372_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|28390_28855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|28993_29323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|29422_30521_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|30669_31095_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_002220893.1|31869_33042_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
>prophage 1
NZ_CP006779	Yersinia pestis 1412 plasmid pMT, complete sequence	137017	31	65316	137017	tail,transposase	Salmonella_phage(30.0%)	64	NA	NA
WP_002221060.1|31_493_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	40.8	3.1e-23
WP_002211770.1|573_3462_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|3763_4372_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_001297096.1|4505_5285_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011906282.1|5284_6307_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_002211744.1|6430_8440_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|8512_8743_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|9455_9962_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|10360_11140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|11193_11613_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|11623_11845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|11844_12522_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|13022_13223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|13384_14782_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|15160_16132_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|16128_17334_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|17635_17863_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|17862_18189_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|18388_19009_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|19074_20016_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|20038_20314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|21052_21541_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|21618_23382_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|25457_26480_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_086028848.1|27686_28562_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_011201829.1|28542_28620_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_100228227.1|28838_28982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011201827.1|28959_29514_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	7.8e-21
WP_011901848.1|29661_30453_-	DsbA family protein	NA	NA	NA	NA	NA
WP_008324922.1|30445_31165_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_011901847.1|31231_31969_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_016674165.1|31970_37211_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_016674166.1|37210_39322_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_002209743.1|39403_40612_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_071589830.1|40635_40764_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011901844.1|40821_41172_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_011201805.1|41322_41628_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_011201806.1|41642_42209_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_011201807.1|42195_42939_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_011901843.1|42925_44320_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_011201809.1|44341_44881_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_016674195.1|45000_45225_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_016674194.1|45228_45414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674193.1|45397_45802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201812.1|45791_46358_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_011901842.1|46350_48981_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_011201813.1|48977_49325_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_011901841.1|49324_49972_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_032485960.1|49974_50961_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_016674192.1|50977_51607_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_011201817.1|51603_53454_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_016674191.1|53485_53674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201818.1|53704_54454_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_011901838.1|54470_54719_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_011901837.1|54708_55254_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_011201821.1|55250_56624_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_011201822.1|56623_59443_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_050879647.1|59563_60772_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|60805_61528_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|61780_62575_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_016256030.1|62875_63133_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002231172.1|63167_64490_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_002224361.1|64649_64865_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002224363.1|65010_65316_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
>prophage 2
NZ_CP006779	Yersinia pestis 1412 plasmid pMT, complete sequence	137017	73785	136876	137017	terminase,tail,transposase	Salmonella_phage(96.77%)	65	NA	NA
WP_002211766.1|73785_76152_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002211767.1|76248_77484_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002221186.1|77664_81189_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002425587.1|81203_81629_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_011201800.1|81658_82222_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002215095.1|82294_82546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213135.1|82766_83198_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002213132.1|83317_84346_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002225551.1|84406_85351_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_000920226.1|85350_85617_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_161597819.1|85664_86696_+	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_002213439.1|86786_86987_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_002222866.1|86990_87821_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002222868.1|87974_88346_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222869.1|88329_88740_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002228797.1|88807_89083_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002228796.1|89123_89303_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002227818.1|89299_89635_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002222711.1|89634_89847_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002214164.1|90415_91480_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002389821.1|92664_92889_+	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002213298.1|93248_94271_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213300.1|94686_95772_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_038918515.1|97558_97918_+	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213303.1|97907_98654_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_011201798.1|98666_99236_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002231165.1|99313_101629_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_002231164.1|101736_102879_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_011901832.1|103077_103833_+	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002213775.1|104071_104530_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|104729_105011_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002211801.1|105216_105699_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002213759.1|106374_106833_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214137.1|107058_107286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|107370_108021_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|108344_108872_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|108876_109299_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|109358_109637_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211794.1|109639_111199_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002228791.1|111275_111974_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211792.1|111973_112642_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|112638_113277_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|113269_113524_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|113529_114420_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|114429_114696_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|114891_115533_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|115535_116792_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_025476623.1|116825_118400_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002231160.1|118422_119319_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211784.1|119345_120221_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211783.1|120295_120958_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|121001_121436_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|121435_122269_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|122366_122711_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|122701_123175_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|123176_123560_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|123634_124381_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_000163862.1|124440_124758_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|124883_125108_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_002211776.1|125115_129693_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000440566.1|129734_130070_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011901831.1|130159_130858_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_002211774.1|130850_131648_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|131635_132223_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_011901830.1|132244_136876_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
