The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026041	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 1, complete sequence	3316147	1078298	1095696	3316147	tRNA	uncultured_Mediterranean_phage(18.18%)	15	NA	NA
WP_005455581.1|1078298_1079939_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	4.2e-155
WP_005455579.1|1080017_1081319_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.2e-134
WP_005455577.1|1081946_1082228_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005493934.1|1082229_1082934_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.3	3.4e-05
WP_005493937.1|1082951_1083428_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_005493940.1|1083474_1084518_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005493942.1|1084517_1085294_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.6e-66
WP_005455562.1|1085293_1085920_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	1.3e-35
WP_005455560.1|1085934_1086858_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005478537.1|1086938_1087928_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
WP_005493944.1|1088007_1090569_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.9	4.4e-34
WP_005493945.1|1090653_1091136_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	2.9e-27
WP_005478550.1|1091336_1092380_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	8.1e-112
WP_005493947.1|1092503_1092971_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005455546.1|1093113_1095696_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.0e-78
>prophage 2
NZ_CP026041	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 1, complete sequence	3316147	2124453	2135649	3316147		Vibrio_phage(91.67%)	16	NA	NA
WP_005494987.1|2124453_2124819_+	phage protein	NA	Q9MCC4	Vibrio_phage	95.9	6.0e-62
WP_005494989.1|2124848_2125559_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_005494991.1|2125697_2125976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139792033.1|2126127_2126334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005494995.1|2126915_2127059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005494996.1|2127058_2128444_-	toxin	NA	Q783T9	Vibrio_phage	99.1	1.2e-264
WP_005477634.1|2128448_2128793_-	DUF2523 domain-containing protein	NA	Q783U0	Vibrio_phage	100.0	5.0e-58
WP_005494998.1|2128794_2129901_-	hypothetical protein	NA	Q783U1	Vibrio_phage	98.6	1.3e-155
WP_005495000.1|2130426_2130672_-	hypothetical protein	NA	Q783U2	Vibrio_phage	97.5	3.7e-31
WP_005477619.1|2130677_2130908_-	hypothetical protein	NA	Q783U3	Vibrio_phage	100.0	1.6e-36
WP_005477647.1|2130911_2131271_-	DUF1293 family protein	NA	Q783U4	Vibrio_phage	100.0	9.1e-63
WP_079400570.1|2131274_2132483_-	replication initiation factor domain-containing protein	NA	Q7DKP2	Vibrio_phage	99.8	4.7e-244
WP_005488200.1|2132406_2132622_-	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	98.6	1.8e-34
WP_021447749.1|2132625_2133249_-	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	50.3	8.5e-40
WP_005495006.1|2133382_2133751_+	hypothetical protein	NA	Q9MCC3	Vibrio_phage	59.5	1.6e-33
WP_005495008.1|2133918_2135649_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	2.1e-43
>prophage 3
NZ_CP026041	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 1, complete sequence	3316147	2378706	2387542	3316147		Vibrio_phage(25.0%)	13	NA	NA
WP_005495398.1|2378706_2380932_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.7	8.2e-61
WP_005483265.1|2381226_2381439_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	2.9e-16
WP_005495400.1|2382343_2382547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005495402.1|2382769_2383177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495404.1|2383213_2383615_-	recombination protein NinG	NA	A0A2I7S3K0	Vibrio_phage	45.0	3.7e-20
WP_005495406.1|2383604_2383787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495408.1|2383783_2384434_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	36.5	7.0e-21
WP_005495410.1|2384426_2384807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495412.1|2384803_2385757_-	helix-turn-helix domain-containing protein	NA	A0A1V0E831	Vibrio_phage	35.3	3.8e-39
WP_005495414.1|2385822_2386041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495415.1|2386037_2386502_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.0	3.0e-18
WP_005495417.1|2386521_2386773_-	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	41.9	3.8e-07
WP_079749494.1|2386744_2387542_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	37.2	2.1e-22
>prophage 4
NZ_CP026041	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 1, complete sequence	3316147	2659331	2669145	3316147	tRNA	Klosneuvirus(16.67%)	7	NA	NA
WP_005495749.1|2659331_2660612_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	2.5e-22
WP_005495751.1|2660681_2660948_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	48.9	2.1e-16
WP_023650089.1|2661500_2662400_-	DUF3380 domain-containing protein	NA	K4RM41	Pseudomonas_phage	43.0	4.8e-36
WP_005495761.1|2662602_2663910_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	2.2e-90
WP_005495763.1|2664001_2665351_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	1.1e-84
WP_005460060.1|2665357_2665984_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005495766.1|2666058_2669145_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.9	3.8e-88
>prophage 5
NZ_CP026041	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 1, complete sequence	3316147	3100410	3107112	3316147		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005440184.1|3100410_3100881_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
WP_005496254.1|3101050_3102160_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	1.5e-63
WP_005496255.1|3102329_3102983_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.0	2.1e-33
WP_005496256.1|3102995_3104120_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	1.8e-48
WP_005482986.1|3104127_3104577_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005496257.1|3104704_3105955_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	3.6e-98
WP_005483011.1|3105972_3107112_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.3e-62
>prophage 1
NZ_CP026042	Vibrio parahaemolyticus strain FDAARGOS_51 chromosome 2, complete sequence	1833070	80379	131831	1833070	transposase,integrase,protease	Vibrio_phage(37.5%)	41	86399:86423	101278:101302
WP_021448338.1|80379_84750_+|protease	SslE/AcfD family lipoprotein zinc metalloprotease	protease	NA	NA	NA	NA
WP_005499492.1|84860_85265_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_100198882.1|85480_86383_+	OspB protein	NA	A0A0P0ZCT1	Stx2-converting_phage	35.3	1.2e-29
86399:86423	attL	TCTGACCGAATTACGCAACAAAGCC	NA	NA	NA	NA
WP_021448339.1|86607_87498_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	86.9	1.6e-153
WP_005499483.1|87822_88392_-	TDH-related hemolysin TRH1	NA	NA	NA	NA	NA
WP_005499480.1|88828_89677_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499478.1|89823_90450_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.3	1.8e-05
WP_005499477.1|90446_91139_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.3	9.8e-05
WP_005499475.1|91126_91927_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023650108.1|91943_92912_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005499471.1|92902_94441_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005499470.1|94846_95689_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_005499469.1|95706_96009_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_005499468.1|96019_96343_+	urease subunit beta	NA	NA	NA	NA	NA
WP_005499467.1|96339_98043_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_005499466.1|98097_98577_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_020842398.1|98604_99270_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_005499462.1|99278_99917_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_080332365.1|100111_100387_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021448344.1|101331_102252_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	91.1	1.2e-162
101278:101302	attR	GGCTTTGTTGCGTAATTCGGTCAGA	NA	NA	NA	NA
WP_023650135.1|102465_103035_+	thermostable direct hemolysin TDH	NA	NA	NA	NA	NA
WP_021448345.1|103706_105533_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_005499452.1|106902_107271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161608943.1|107802_108012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021448349.1|110539_111460_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	88.5	2.3e-158
WP_005499427.1|113248_113563_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_025548618.1|113555_114197_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_005499422.1|115893_116550_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005499420.1|116756_117899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029827611.1|117888_118818_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005499416.1|118820_119624_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005499414.1|119892_120612_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005499413.1|120794_121385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499407.1|123392_124232_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499405.1|124315_124498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499403.1|124746_125280_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_005499401.1|125379_125946_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499399.1|126158_127016_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_005499397.1|128442_129612_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	45.6	3.4e-82
WP_005499396.1|129898_130303_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_005499394.1|130538_131831_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	22.7	4.5e-11
