The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	226626	236357	2803668		Synechococcus_phage(37.5%)	9	NA	NA
WP_009360741.1|226626_227922_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.4	2.2e-18
WP_009360740.1|227988_228711_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	44.0	1.1e-46
WP_009360739.1|228698_228953_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.2e-06
WP_009360738.1|228949_229636_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_019418101.1|229619_231842_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	4.1e-161
WP_035063804.1|231817_233245_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	2.3e-48
WP_009360735.1|233207_234245_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.9	9.4e-68
WP_009360734.1|234241_234844_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	2.6e-25
WP_165569749.1|234818_236357_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.7	2.5e-77
>prophage 2
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	390501	462101	2803668	transposase,capsid,holin,terminase,head,plate,tail,tRNA,portal,protease,integrase	Vibrio_phage(23.08%)	98	408475:408492	460916:460933
WP_049720849.1|390501_391704_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	1.0e-49
WP_049720851.1|392187_392400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049720840.1|392450_393899_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_049720852.1|394129_394672_+	phosphotransferase	NA	NA	NA	NA	NA
WP_035067858.1|394942_395368_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035067856.1|395355_395691_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_035067854.1|395970_396579_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_035064544.1|398191_398854_-|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_035064548.1|398914_400051_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_035064551.1|400108_400966_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_019417166.1|400968_401451_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_009373577.1|401732_403628_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.8	8.7e-104
WP_035064553.1|403848_405018_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.5	5.5e-24
WP_035064556.1|405014_406568_-	recombinase family protein	NA	D2XR37	Bacillus_phage	59.1	5.0e-150
WP_035064559.1|406625_407105_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_035064562.1|407186_407966_-	DUF1829 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	36.4	2.9e-37
WP_035064564.1|407965_408412_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	30.1	3.0e-07
408475:408492	attL	TTTTAAAATTCCGTTTAT	NA	NA	NA	NA
WP_035064570.1|409062_410613_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_035064573.1|410712_411117_-	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	45.2	7.2e-16
WP_035064576.1|411292_411520_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	60.9	1.8e-16
WP_035064579.1|411557_411899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081957664.1|411852_412113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165551154.1|412242_412419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064583.1|412472_412994_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009362114.1|413007_413232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165569754.1|413245_413398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064586.1|413664_413919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064587.1|413923_414256_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_128713007.1|414266_414470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064590.1|414532_415525_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	71.2	6.7e-39
WP_019417148.1|415534_415735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081957666.1|415740_415902_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_165569755.1|415995_416160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064592.1|416159_416639_+	hypothetical protein	NA	S6AVW3	Thermus_phage	50.0	1.8e-34
WP_035064595.1|416640_416901_+	hypothetical protein	NA	S6BFL9	Thermus_phage	75.9	4.9e-18
WP_035064598.1|417256_417466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064601.1|417505_417700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064604.1|417921_418203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049720853.1|418244_418505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064606.1|418516_419251_+	antirepressor	NA	A0A2P1JTZ2	Anoxybacillus_phage	79.3	9.4e-115
WP_035064609.1|419387_419582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064612.1|419605_420049_+	ArpU family transcriptional regulator	NA	Q0H270	Geobacillus_phage	58.1	3.1e-36
WP_035064614.1|420045_420588_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	63.3	1.1e-59
WP_035064616.1|420739_421033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064619.1|421249_421690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064622.1|422536_424360_+|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	57.8	1.3e-194
WP_035064625.1|424378_424609_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	64.9	1.0e-19
WP_049720927.1|424608_426126_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	61.2	1.6e-172
WP_035064629.1|426109_427192_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	43.6	4.1e-74
WP_035064631.1|427191_427551_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	53.0	4.7e-27
WP_081957699.1|427571_428582_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	51.8	3.3e-94
WP_035064637.1|428595_429066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064640.1|429058_429388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064642.1|429397_429952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064644.1|429951_430437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064647.1|430426_430726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064649.1|430729_432190_+|tail	phage tail sheath family protein	tail	A0A067ZJ07	Vibrio_phage	54.2	2.5e-151
WP_035064652.1|432201_432729_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	44.8	2.8e-36
WP_035064655.1|432749_433055_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_049720854.1|433177_435514_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	36.4	8.9e-74
WP_035064658.1|435506_435725_+	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	50.0	2.3e-08
WP_049720855.1|435721_436741_+	hypothetical protein	NA	A0A0C5AJ59	Bacteriophage	40.1	1.0e-58
WP_128713009.1|436737_437202_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	44.3	8.0e-19
WP_049720857.1|437201_437864_+	SH3 domain-containing protein	NA	A0A0C5AN08	Bacteriophage	39.4	4.2e-21
WP_035064663.1|437869_438178_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_035064666.1|438164_439283_+|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	43.6	2.4e-85
WP_035064669.1|439275_439839_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	52.2	7.6e-48
WP_128713015.1|440548_441451_+	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	81.1	4.6e-63
WP_035064671.1|441447_442410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035064673.1|442417_442753_+	hypothetical protein	NA	A0A0K2CNW8	Brevibacillus_phage	34.7	4.7e-05
WP_165569756.1|442754_442892_+	hypothetical protein	NA	A0A1B1P890	Bacillus_phage	74.4	2.0e-10
WP_035064675.1|442963_443383_+|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	94.2	2.1e-63
WP_035064677.1|443379_444048_+	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	93.7	5.6e-122
WP_035064679.1|444162_444384_+	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	42.0	6.1e-09
WP_035064681.1|444569_445301_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.2	3.8e-55
WP_035064682.1|445297_445954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049720858.1|446156_446420_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156185731.1|446935_447277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009362057.1|447650_447950_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_009362056.1|447961_448537_+	redox protein, regulator of disulfide bond formation	NA	NA	NA	NA	NA
WP_009362055.1|448533_448929_+	peroxiredoxin family protein	NA	NA	NA	NA	NA
WP_009362054.1|448940_449168_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_009362053.1|449216_449993_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_009362052.1|450075_450309_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_009362051.1|450361_451495_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_035064684.1|451648_452335_+	peptidase	NA	NA	NA	NA	NA
WP_035065167.1|452381_453719_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_035064687.1|453713_454625_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_009362047.1|454730_455120_+	DUF5365 family protein	NA	NA	NA	NA	NA
WP_019417092.1|455143_455608_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_035064691.1|455604_456033_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_035065170.1|456163_456592_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.3	6.7e-12
WP_035064693.1|456852_458592_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	48.8	1.1e-156
WP_009362042.1|458664_459372_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004892205.1|459397_459649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009362041.1|459749_460202_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	38.4	1.2e-24
WP_035064696.1|460206_461139_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
460916:460933	attR	ATAAACGGAATTTTAAAA	NA	NA	NA	NA
WP_035064699.1|461135_462101_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 3
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	662463	686894	2803668	transposase,integrase,holin,coat	Bacillus_virus(25.0%)	35	663740:663757	693845:693862
WP_035065017.1|662463_662727_+|coat	spore coat protein regulator YlbO	coat	NA	NA	NA	NA
WP_035065019.1|662935_663127_+|holin	holin	holin	NA	NA	NA	NA
WP_035065022.1|663210_663414_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_035065025.1|663472_663928_+	membrane protein	NA	NA	NA	NA	NA
663740:663757	attL	CAAATTGAAAAAGATGTA	NA	NA	NA	NA
WP_035065028.1|663937_664420_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_035065030.1|664416_665433_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_035065033.1|665429_665786_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_035065036.1|665792_665999_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_035065039.1|666001_666859_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_035065042.1|666890_667700_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_035065045.1|668011_668329_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_035065047.1|668416_668653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006322839.1|668734_668863_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_006322845.1|668949_669204_+	sporulation protein	NA	NA	NA	NA	NA
WP_049720861.1|669221_671372_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	33.4	1.0e-76
WP_035065053.1|671454_671634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065056.1|671731_672130_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.7	3.6e-52
WP_035065058.1|672142_673252_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	1.5e-84
WP_035065190.1|673375_674053_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_035065061.1|674182_674614_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021094697.1|674618_675131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035065064.1|675190_675883_-	esterase family protein	NA	NA	NA	NA	NA
WP_035065066.1|675985_676501_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	49.1	2.1e-36
WP_035020866.1|676603_676999_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_035065069.1|677332_678103_-	dioxygenase	NA	NA	NA	NA	NA
WP_035065071.1|678225_678705_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	62.6	2.7e-46
WP_035065073.1|678988_680092_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.6	6.4e-14
WP_035065076.1|680095_681235_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_004891686.1|681255_681792_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_035065078.1|681910_682543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081957686.1|682840_683755_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.6	9.9e-29
WP_035065083.1|683772_683958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065085.1|684124_684931_+	hypothetical protein	NA	A0A2H4J7R7	uncultured_Caudovirales_phage	48.9	9.6e-20
WP_035065087.1|685305_686403_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035065089.1|686672_686894_+|holin	holin	holin	NA	NA	NA	NA
693845:693862	attR	CAAATTGAAAAAGATGTA	NA	NA	NA	NA
>prophage 4
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	695258	757313	2803668	transposase,portal,integrase	Liberibacter_phage(13.33%)	49	698418:698462	752596:752640
WP_035065113.1|695258_696569_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_035065116.1|697189_697531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065119.1|697687_698266_+	hypothetical protein	NA	NA	NA	NA	NA
698418:698462	attL	ACCTTGACAGGGTGGAGGTCGCTGGTTCGAGCCCAGTCGGAATCA	NA	NA	NA	NA
WP_035065126.1|698574_699729_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	38.9	1.0e-70
WP_128713014.1|700794_701658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065129.1|701768_702830_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_035065133.1|703542_703944_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_081957697.1|704017_704269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065197.1|704506_705535_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_035065135.1|705588_705951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049720862.1|706103_706799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035065138.1|707014_708181_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.2	1.2e-34
WP_049720840.1|708446_709895_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_035067778.1|710501_711986_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	42.2	1.1e-109
WP_049720863.1|711975_713208_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035067776.1|713204_716159_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.9	2.2e-101
WP_035067785.1|716207_717188_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_035067774.1|717235_717964_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_035067772.1|718435_718834_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_035067781.1|719183_720833_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.8	1.5e-56
WP_035067768.1|722576_722849_-	DUF3986 family protein	NA	NA	NA	NA	NA
WP_049720865.1|723172_723619_-	DMT family transporter	NA	NA	NA	NA	NA
WP_049720866.1|723617_723797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035067766.1|724454_724892_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035067763.1|724984_725497_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	27.9	4.1e-08
WP_035067761.1|725851_726274_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035067759.1|726639_727893_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_035067483.1|728876_729392_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.5	1.1e-08
WP_035067481.1|729406_729937_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035067478.1|730293_732024_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.3e-50
WP_035067476.1|732017_733814_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	2.8e-59
WP_035067474.1|734571_735405_+	pirin family protein	NA	NA	NA	NA	NA
WP_035067472.1|735559_736294_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_035067470.1|736622_737285_+	HD domain-containing protein	NA	S4W232	Pandoravirus	32.1	2.9e-14
WP_035067469.1|737265_739164_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	4.7e-57
WP_035067467.1|739182_740322_+	virulence factor	NA	NA	NA	NA	NA
WP_015863926.1|742186_742555_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	78.7	1.1e-50
WP_035067453.1|742547_744686_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	85.0	0.0e+00
WP_035067451.1|745052_746129_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_035067449.1|746272_747115_-	methionine ABC transporter ATPase	NA	NA	NA	NA	NA
WP_035067447.1|747153_747819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035067446.1|747808_748822_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.5e-30
WP_035067442.1|749426_750977_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_035067440.1|751273_751561_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_128713030.1|751560_752124_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.3	5.5e-30
WP_035067436.1|753121_753892_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
752596:752640	attR	ACCTTGACAGGGTGGAGGTCGCTGGTTCGAGCCCAGTCGGAATCA	NA	NA	NA	NA
WP_019418695.1|753904_755227_-	GntP family permease	NA	NA	NA	NA	NA
WP_035067434.1|755450_756800_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_081957764.1|757025_757313_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	1726624	1768790	2803668	transposase,protease,coat	Bacillus_phage(45.45%)	49	NA	NA
WP_019417634.1|1726624_1727299_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_026011665.1|1727341_1728247_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	46.7	4.3e-24
WP_019417636.1|1728259_1729606_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_035066952.1|1729617_1730982_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_019417638.1|1730957_1731626_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_009373711.1|1731702_1732683_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_006319394.1|1732752_1734018_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_049720892.1|1734170_1734887_+	N-acetylglucosaminylphosphatidylinositol deacetylase	NA	NA	NA	NA	NA
WP_009373715.1|1734913_1735501_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_019418541.1|1735582_1736503_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009373720.1|1736585_1737344_-	calcineurin-like phosphohydrolase	NA	NA	NA	NA	NA
WP_035066950.1|1737345_1737720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009373723.1|1737838_1738075_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_009373725.1|1738058_1738319_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_009373727.1|1738336_1738906_+|coat	component of the inner spore coat	coat	NA	NA	NA	NA
WP_009373730.1|1738906_1739344_-	YpbF family protein	NA	NA	NA	NA	NA
WP_009373731.1|1739404_1739926_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_019418536.1|1739918_1740509_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009373734.1|1740505_1741948_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.8	1.6e-57
WP_035066945.1|1741940_1742963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003394452.1|1743163_1743412_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	54.7	1.9e-19
WP_019418534.1|1743530_1744031_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	45.5	2.7e-28
WP_035066943.1|1744200_1745775_+	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.3	8.7e-33
WP_009373738.1|1745803_1746616_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_035066941.1|1746840_1747542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019418532.1|1747534_1748005_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_009373741.1|1748001_1748589_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_035066939.1|1748599_1749025_-	cobalamin biosynthesis protein CobU	NA	NA	NA	NA	NA
WP_035066937.1|1748976_1749573_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_035066935.1|1749530_1750280_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_035066934.1|1750258_1750810_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_035066932.1|1750806_1751856_-	threonine-phosphate decarboxylase	NA	A0A1X6WGT4	Pacmanvirus	24.8	1.8e-10
WP_035066930.1|1751830_1752763_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_035066928.1|1752759_1754217_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.8	1.3e-11
WP_019418524.1|1754207_1755254_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_019418523.1|1755219_1756176_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019418522.1|1756554_1758318_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.2	2.9e-37
WP_009373760.1|1758314_1759031_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.7	1.9e-43
WP_009373761.1|1759180_1760356_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_035066926.1|1760368_1761985_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_035066924.1|1761997_1762519_-	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_009373764.1|1762612_1763350_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012574675.1|1763429_1763963_-	spore maturation protein	NA	NA	NA	NA	NA
WP_009373766.1|1763962_1764556_-	spore maturation protein	NA	NA	NA	NA	NA
WP_035066921.1|1764548_1765661_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.6	1.1e-21
WP_035066919.1|1765730_1766507_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_035066918.1|1766565_1767054_-	YpuI family protein	NA	NA	NA	NA	NA
WP_035066916.1|1767067_1767487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035066914.1|1767650_1768790_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D2XQ03	Bacillus_virus	59.4	4.7e-121
>prophage 6
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	1775092	1780817	2803668		Staphylococcus_phage(66.67%)	8	NA	NA
WP_033383623.1|1775092_1775680_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.3	1.8e-15
WP_049720893.1|1775679_1776456_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.2	2.8e-08
WP_019418512.1|1776456_1776984_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_019418511.1|1776990_1777335_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019418510.1|1777417_1777882_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.7	1.2e-43
WP_035066902.1|1777896_1779090_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.6	5.5e-120
WP_026011839.1|1779096_1779735_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	4.4e-44
WP_035066900.1|1779740_1780817_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.6	1.8e-61
>prophage 7
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	2461025	2466444	2803668		Streptococcus_phage(33.33%)	7	NA	NA
WP_081957734.1|2461025_2461661_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	1.3e-51
WP_035066245.1|2461689_2461947_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_009362294.1|2461966_2462929_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.0	1.9e-51
WP_019417457.1|2462941_2463907_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.9	1.8e-57
WP_035066241.1|2463903_2464794_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.6	9.4e-08
WP_009362297.1|2464811_2465270_-	8-oxo-dGTP diphosphatase	NA	A0A1S6UAL7	Serratia_phage	30.2	6.5e-05
WP_009362298.1|2465496_2466444_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	55.4	5.5e-91
>prophage 8
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	2486425	2494062	2803668		Bacillus_phage(33.33%)	9	NA	NA
WP_035066194.1|2486425_2487862_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.5	1.8e-24
WP_035066193.1|2488038_2489301_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	39.0	3.9e-15
WP_035066190.1|2489320_2490214_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009362324.1|2490203_2490890_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.0	5.9e-26
WP_009362325.1|2491050_2491377_-	cytochrome c	NA	NA	NA	NA	NA
WP_035066187.1|2491435_2492296_-	YitT family protein	NA	NA	NA	NA	NA
WP_020424541.1|2492385_2492646_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	69.8	5.3e-28
WP_081957733.1|2492614_2492944_-	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	43.5	2.3e-12
WP_128713022.1|2492954_2494062_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	1.1e-05
>prophage 9
NZ_CP012152	Anoxybacillus gonensis strain G2 chromosome, complete genome	2803668	2546483	2563021	2803668	transposase,protease,bacteriocin	Bacillus_phage(100.0%)	14	NA	NA
WP_012576101.1|2546483_2547206_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012576102.1|2547216_2548875_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_035066089.1|2548887_2551083_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.1	6.4e-58
WP_075039767.1|2551561_2551804_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_128713019.1|2551881_2552115_-|bacteriocin	bacteriocin, lactococcin A1 family protein	bacteriocin	NA	NA	NA	NA
WP_012576108.1|2552616_2552826_-|bacteriocin	bacteriocin, lactococcin A1 family	bacteriocin	NA	NA	NA	NA
WP_019417539.1|2553054_2554032_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_049720885.1|2554582_2556031_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_035067548.1|2557000_2557642_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012576112.1|2558493_2558928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035067546.1|2559172_2559553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049720911.1|2561602_2562001_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_035067544.1|2561957_2562200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165569768.1|2562679_2563021_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	52.6	2.0e-19
