The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012136	Corynebacterium pseudotuberculosis strain E19 chromosome, complete genome	2367956	1753448	1830873	2367956	tRNA,integrase,bacteriocin,protease	Agrobacterium_phage(13.33%)	58	1805615:1805642	1811528:1811555
WP_014655693.1|1753448_1756184_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	1.1e-139
WP_013242455.1|1756350_1757331_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014523532.1|1757933_1758692_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1758750_1760037_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1760197_1763002_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1763078_1763708_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763723_1764323_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1764533_1765886_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766674_1766917_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1767053_1767830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767916_1768927_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1769044_1769518_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769584_1770205_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1770538_1773154_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014523536.1|1773575_1774154_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1774272_1774665_+	globin	NA	NA	NA	NA	NA
WP_013242473.1|1775575_1776184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1776189_1776618_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776825_1778496_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_032802507.1|1778685_1779246_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032802509.1|1779774_1781529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781525_1783064_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014523541.1|1783090_1784569_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784565_1787169_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1787168_1788182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1788178_1789159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1789197_1789368_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1789441_1790893_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1790914_1791673_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791669_1792593_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1792683_1794729_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367488.1|1795321_1797607_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1797626_1797827_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1798167_1799994_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014733040.1|1800269_1801265_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801391_1802195_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1802260_1802920_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1803099_1803927_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803980_1805171_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805615:1805642	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1805789_1806467_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_075140840.1|1806580_1806922_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1807372_1808377_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052399380.1|1808373_1808811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138130224.1|1809512_1809845_+	hypothetical protein	NA	A0A2H4J297	uncultured_Caudovirales_phage	63.9	9.4e-14
WP_014733042.1|1810265_1810823_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_032802513.1|1811173_1811398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655718.1|1813072_1813627_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
1811528:1811555	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014800825.1|1813635_1813980_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1814101_1814377_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1814465_1814945_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814982_1815636_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815648_1816038_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_050859095.1|1816168_1825267_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1825491_1825797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032802516.1|1827070_1827697_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1827740_1828772_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_050859130.1|1828953_1829712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050859096.1|1830210_1830873_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP012136	Corynebacterium pseudotuberculosis strain E19 chromosome, complete genome	2367956	1985351	1993812	2367956	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1985351_1987100_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1987077_1987746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1987753_1988140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1988136_1988652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1988662_1989109_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1989105_1989561_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989562_1989904_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1989890_1990673_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1990674_1991238_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_050859107.1|1991230_1993234_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_050859108.1|1993230_1993812_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.8	6.7e-15
