The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	771399	810387	4911121	transposase,protease	Shigella_phage(33.33%)	29	NA	NA
WP_144421940.1|771399_772544_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_011038588.1|773039_773591_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011038587.1|773702_775070_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.8	3.6e-43
WP_011038586.1|775327_775627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038585.1|775845_776301_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011038584.1|776297_776798_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050911255.1|776823_777915_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011038582.1|777911_779561_-	MFS transporter	NA	NA	NA	NA	NA
WP_014509029.1|779648_780410_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012437339.1|780598_781489_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_040940621.1|781533_783513_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011038578.1|784138_784858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014509025.1|784861_785485_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_087942080.1|788104_789248_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_050911257.1|789249_789579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050911258.1|789575_791330_+	quinoprotein dehydrogenase-associated putative ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012437347.1|791277_791997_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_050911259.1|791993_793040_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_012437349.1|793074_794181_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	1.8e-29
WP_050911260.1|794191_796576_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087942922.1|796877_797676_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016945071.1|798068_800042_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012437352.1|800711_801644_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_003482734.1|801920_802967_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
WP_050911261.1|803299_804655_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012437354.1|804651_805137_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_050911262.1|805140_807201_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011038563.1|807197_808316_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_144421941.1|809285_810387_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.3e-43
>prophage 2
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	1009701	1064002	4911121	transposase,protease	Leptospira_phage(14.29%)	46	NA	NA
WP_087942911.1|1009701_1010834_-|transposase	IS3-like element ISXca1 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.7e-49
WP_011038406.1|1010880_1011342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038405.1|1011338_1011869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144421943.1|1012240_1013220_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.1e-97
WP_162274440.1|1013210_1013777_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_050911285.1|1013816_1014923_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_011038397.1|1016354_1016939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011269533.1|1017553_1018102_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_011038396.1|1018171_1019293_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_011035783.1|1019459_1020827_+|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
WP_011038395.1|1020852_1021356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050911286.1|1022194_1023451_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011038393.1|1023610_1024174_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	29.6	4.7e-13
WP_050911287.1|1024529_1025888_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_050911867.1|1025902_1026484_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_050911288.1|1026625_1027510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019237312.1|1027896_1029978_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_043877713.1|1030138_1030798_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_014508862.1|1030923_1031739_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.4e-05
WP_050911289.1|1032371_1033319_+	YiiG family protein	NA	NA	NA	NA	NA
WP_050911290.1|1033544_1034417_-	ion transporter	NA	NA	NA	NA	NA
WP_011038384.1|1034489_1035716_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.8	2.0e-16
WP_011038381.1|1036992_1039284_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_040940714.1|1039416_1041024_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011038379.1|1041020_1041446_+	cytochrome c	NA	NA	NA	NA	NA
WP_011038378.1|1041471_1041975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038377.1|1042007_1043207_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.5	6.0e-10
WP_011038376.1|1043369_1043819_+	azurin	NA	NA	NA	NA	NA
WP_050911292.1|1043888_1046654_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011038374.1|1046882_1048172_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011038371.1|1052429_1053053_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_029216955.1|1053076_1053316_+	rubredoxin	NA	NA	NA	NA	NA
WP_011038369.1|1053413_1054295_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011038368.1|1054335_1054785_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011038367.1|1054917_1055565_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012437476.1|1055666_1056137_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011038365.1|1056133_1056724_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011038364.1|1057287_1057584_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011038363.1|1057580_1057802_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011038362.1|1058037_1058580_+	YecA family protein	NA	NA	NA	NA	NA
WP_011038361.1|1058592_1059927_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162490376.1|1060215_1060545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144421944.1|1060531_1061330_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011038303.1|1061435_1062248_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011038304.1|1062261_1063074_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_144421945.1|1063204_1064002_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	2318944	2387790	4911121	transposase,integrase,tRNA	Leptospira_phage(26.67%)	57	2380146:2380171	2395141:2395166
WP_011037315.1|2318944_2319460_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	33.6	1.1e-05
WP_012438217.1|2319531_2320116_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	36.2	9.1e-20
WP_011037313.1|2320277_2321237_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_050911457.1|2321236_2323615_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	3.7e-176
WP_011269676.1|2323757_2324579_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014507870.1|2324784_2325294_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_050911458.1|2325352_2325841_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_050911459.1|2326049_2326808_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_014507867.1|2326936_2327551_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_050911460.1|2327610_2328783_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE	NA	NA	NA	NA	NA
WP_011037305.1|2328779_2329856_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
WP_011037304.1|2329958_2330159_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_050911461.1|2330128_2330644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050911462.1|2330601_2331813_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011037301.1|2332005_2332233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050911463.1|2332337_2334701_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_019237616.1|2334737_2338178_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.8	8.3e-28
WP_029216977.1|2338243_2338624_-	response regulator	NA	NA	NA	NA	NA
WP_029216976.1|2340839_2341301_-	cytochrome c	NA	NA	NA	NA	NA
WP_011037295.1|2341309_2341696_-	cytochrome c	NA	NA	NA	NA	NA
WP_040941270.1|2341898_2343032_+	MexH family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050911464.1|2343028_2346529_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.7	1.9e-112
WP_011037292.1|2346525_2349612_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.5	1.6e-59
WP_016902600.1|2350918_2351578_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011037290.1|2351630_2353547_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011037289.1|2353692_2354412_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011037288.1|2354408_2355416_-	glucokinase	NA	NA	NA	NA	NA
WP_011037287.1|2355412_2356843_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KIX9	Synechococcus_phage	34.3	1.7e-64
WP_011037286.1|2357264_2358359_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	4.4e-23
WP_011037285.1|2358512_2359385_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011037284.1|2359328_2359595_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011037283.1|2359651_2360047_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_050911465.1|2360043_2360430_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_012438231.1|2360460_2362251_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016945344.1|2362257_2362467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011037280.1|2362483_2363266_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014507842.1|2363375_2363624_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_019237618.1|2363655_2364027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014507840.1|2364050_2365292_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_040941280.1|2365284_2366025_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.8	3.1e-33
WP_050911466.1|2366652_2367717_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_050911467.1|2368127_2370518_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_019237621.1|2370546_2371215_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_019237622.1|2371218_2371656_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011037271.1|2371652_2373422_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	1.6e-51
WP_050911468.1|2373418_2374474_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011037269.1|2374554_2375364_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011037268.1|2375360_2375825_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_043877749.1|2375848_2377267_+	nhl repeat protein	NA	NA	NA	NA	NA
WP_011037266.1|2377263_2379120_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011037265.1|2379119_2379752_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2380146:2380171	attL	TTGGAGCGGGAAACGAGACTCGAACT	NA	NA	NA	NA
WP_080994470.1|2380286_2380733_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_144421953.1|2381218_2382356_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_050911469.1|2382473_2383454_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.4e-97
WP_011035783.1|2383997_2385365_-|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
WP_144421953.1|2385570_2386708_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_050911469.1|2386809_2387790_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.4e-97
2395141:2395166	attR	AGTTCGAGTCTCGTTTCCCGCTCCAA	NA	NA	NA	NA
>prophage 4
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	2412426	2419134	4911121	coat	Xanthomonas_phage(77.78%)	12	NA	NA
WP_050911472.1|2412426_2413077_+	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	49.5	1.0e-48
WP_011037221.1|2413372_2414413_+	replication initiation protein	NA	A0A1W6DXW7	Xanthomonas_phage	95.3	3.1e-196
WP_011037222.1|2414409_2414706_+	hypothetical protein	NA	A0A1W6DXU2	Xanthomonas_phage	90.7	2.1e-44
WP_019237633.1|2414709_2414961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005918131.1|2414988_2415117_+|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_162490378.1|2415724_2416066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019237631.1|2416059_2416299_+	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	92.4	9.1e-35
WP_011037230.1|2416309_2416630_+|coat	minor coat protein	coat	Q4LAU3	Stenotrophomonas_phage	44.2	5.0e-20
WP_011037227.1|2416631_2417954_+	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	56.0	5.3e-132
WP_075272161.1|2417973_2418282_-	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	90.3	1.0e-46
WP_011037229.1|2418348_2418687_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	100.0	4.7e-61
WP_075272161.1|2418825_2419134_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	90.3	1.0e-46
>prophage 5
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	2939702	2957320	4911121	transposase	Leptospira_phage(50.0%)	12	NA	NA
WP_011035386.1|2939702_2940917_-|transposase	IS4-like element IS1481A family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	31.5	2.7e-50
WP_009602864.1|2944701_2945097_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_002804328.1|2945093_2945345_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_050911570.1|2945526_2946093_+	recombinase family protein	NA	Q71TD8	Escherichia_phage	53.0	5.1e-44
WP_011036808.1|2946145_2947213_-	avirulence protein	NA	NA	NA	NA	NA
WP_080994534.1|2947468_2947909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011035385.1|2949222_2950203_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	1.3e-98
WP_144421956.1|2950373_2951506_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	5.5e-53
WP_144421957.1|2951640_2952742_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.5e-44
WP_011035385.1|2952790_2953771_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	1.3e-98
WP_144421957.1|2955068_2956170_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.5e-44
WP_144421958.1|2956211_2957320_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	2.9e-43
>prophage 6
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	4062870	4069253	4911121		Enterobacteria_phage(50.0%)	6	NA	NA
WP_014506571.1|4062870_4064217_+	phosphohexose mutase	NA	A0A127AWJ1	Bacillus_phage	26.4	1.2e-30
WP_011035868.1|4064262_4065666_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	1.1e-47
WP_011035867.1|4065787_4066696_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.6	2.6e-29
WP_011035866.1|4066692_4067250_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	4.3e-43
WP_012439277.1|4067246_4068134_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	1.2e-95
WP_011270013.1|4068197_4069253_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	3.1e-82
>prophage 7
NZ_CP012145	Xanthomonas campestris pv. campestris strain ICMP 21080 chromosome, complete genome	4911121	4362257	4400296	4911121	plate,transposase,tRNA	Leptospira_phage(22.22%)	33	NA	NA
WP_011038897.1|4362257_4363322_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	3.9e-101
WP_002808376.1|4363602_4363818_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011038898.1|4364044_4364491_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	2.7e-24
WP_019238042.1|4365329_4366277_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011038900.1|4366357_4368106_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
WP_011038901.1|4368102_4368603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038902.1|4368691_4369684_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_050911761.1|4369913_4371491_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014506322.1|4371510_4372407_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011038905.1|4372409_4373573_-	heme A synthase	NA	NA	NA	NA	NA
WP_011038906.1|4373583_4374159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038907.1|4374186_4374912_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_011038908.1|4374972_4375191_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_042595322.1|4375287_4376163_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_011038910.1|4376199_4376796_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011038912.1|4376946_4378551_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.2	7.8e-05
WP_011038913.1|4378590_4379574_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_016944221.1|4379590_4380067_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_050911762.1|4380345_4383546_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_129588839.1|4384936_4385173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038659.1|4385399_4386491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038660.1|4386588_4387188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050911763.1|4387353_4387752_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_012437267.1|4387748_4388021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029217052.1|4388320_4389601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144421964.1|4389686_4390786_-|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.1e-42
WP_012437264.1|4391130_4392012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038664.1|4392176_4392587_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_144421965.1|4392543_4393652_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	5.0e-43
WP_087942071.1|4394970_4396115_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	1.8e-88
WP_011038670.1|4396448_4397462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050911766.1|4397688_4398669_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	9.7e-99
WP_011035783.1|4398928_4400296_-|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
