The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	41893	47235	4142037		Xanthomonas_phage(16.67%)	8	NA	NA
WP_034164493.1|41893_42352_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.5	4.6e-51
WP_034164494.1|42329_43547_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	1.6e-42
WP_034164495.1|43736_44423_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	29.8	5.7e-21
WP_015460658.1|44661_44898_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_005290066.1|44909_45077_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_034164496.1|45170_45980_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	1.1e-26
WP_034164497.1|45976_46462_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.4	2.2e-27
WP_034164498.1|46458_47235_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	32.1	4.9e-05
>prophage 2
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	845736	890149	4142037	head,integrase,lysis,tail,holin	Salmonella_phage(58.49%)	59	849411:849456	890504:890549
WP_049703668.1|845736_846801_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.0	4.6e-54
WP_034163265.1|846810_848064_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.2	2.4e-86
WP_034163266.1|848132_849164_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
849411:849456	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_049703669.1|849470_850634_-|integrase	site-specific integrase	integrase	M1FN74	Enterobacteria_phage	67.9	4.0e-152
WP_049703928.1|850899_851142_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	78.8	3.8e-28
WP_049703670.1|851144_853316_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.6	1.2e-181
WP_085062003.1|853312_853471_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_049703671.1|853482_854172_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.0	7.7e-26
WP_049703672.1|854182_854854_-	AAA family ATPase	NA	G9L667	Escherichia_phage	45.7	3.3e-50
WP_049703673.1|854850_855522_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.4	4.6e-15
WP_049703674.1|855723_857079_-	hypothetical protein	NA	A0A077KGZ0	Edwardsiella_phage	83.8	3.1e-26
WP_049703675.1|857161_857434_-	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	2.7e-27
WP_023181101.1|857444_857642_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085061976.1|857641_857842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420055.1|858123_858312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049703676.1|858283_858502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049703677.1|858729_859422_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	54.5	6.9e-59
WP_085062004.1|859551_859785_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	51.4	3.9e-14
WP_049703678.1|859820_860141_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	84.9	1.3e-41
WP_049703679.1|860386_861277_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	50.3	2.1e-68
WP_049703680.1|861273_862671_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.0	3.5e-166
WP_049703681.1|862670_862961_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	64.1	1.8e-29
WP_049703682.1|863393_863732_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	6.6e-47
WP_049703683.1|863876_864479_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	90.5	7.5e-102
WP_049703684.1|864478_864685_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	3.4e-22
WP_049703685.1|864687_865299_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	79.3	4.0e-66
WP_049703686.1|865295_865433_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.0	1.6e-07
WP_049703687.1|865432_866122_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	7.4e-61
WP_049703688.1|866420_866741_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	34.3	4.5e-13
WP_049703689.1|866743_867355_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	63.5	1.5e-68
WP_049703690.1|867351_867825_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	66.2	7.1e-47
WP_049703691.1|867873_868494_+	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	2.9e-88
WP_049703692.1|868524_868998_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.1	3.1e-50
WP_049703693.1|869000_870623_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	2.1e-311
WP_049703694.1|870622_872092_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	93.6	2.0e-265
WP_144420071.1|871979_872714_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	94.1	2.1e-106
WP_049703696.1|872728_873967_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	92.5	1.1e-213
WP_049703697.1|873971_874469_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	85.5	3.1e-77
WP_085061978.1|874487_875429_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	95.5	7.5e-173
WP_049703699.1|875470_875839_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.0	3.6e-38
WP_049703700.1|875804_876212_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	1.6e-68
WP_049703701.1|876208_876763_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	7.4e-80
WP_049703702.1|876749_877139_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	94.6	1.9e-66
WP_049703703.1|877113_877677_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	77.4	2.1e-82
WP_049703704.1|877679_879173_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	50.3	2.3e-123
WP_049703705.1|879183_879624_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	76.7	2.9e-58
WP_049703706.1|879627_880053_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	3.5e-37
WP_049703707.1|880230_882171_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.5e-191
WP_049703708.1|882170_882758_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	87.7	1.6e-85
WP_049703709.1|882757_883060_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	86.0	2.7e-44
WP_049703710.1|883062_884127_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	79.4	2.2e-157
WP_049703711.1|884126_884459_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	67.1	1.5e-22
WP_049703712.1|884557_885787_+	chromosome segregation ATPase	NA	Q9MC01	Enterobacteria_phage	64.5	8.1e-103
WP_049703713.1|885851_886604_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	54.2	5.4e-73
WP_049703930.1|886603_886957_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	87.2	1.1e-52
WP_049703714.1|886957_888157_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	82.7	2.5e-181
WP_049703715.1|888153_888834_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.0	5.5e-109
WP_085061980.1|888833_889787_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	66.9	1.9e-51
WP_049703716.1|889789_890149_+|tail	tail fiber assembly protein	tail	L0MXF6	Edwardsiella_phage	66.3	5.6e-28
890504:890549	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	2057496	2067399	4142037	tRNA	Bacillus_phage(14.29%)	11	NA	NA
WP_045427908.1|2057496_2057985_-	endopeptidase	NA	S5MM68	Bacillus_phage	38.5	4.9e-11
WP_085061992.1|2058128_2058887_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.3	3.3e-06
WP_034163366.1|2059857_2060061_-	protein DsrB	NA	NA	NA	NA	NA
WP_005285818.1|2060151_2060448_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	2.4e-13
WP_034163365.1|2060452_2062840_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	2.1e-06
WP_034163364.1|2062854_2063838_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_106120997.1|2064023_2064068_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_015461533.1|2064230_2064587_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005293643.1|2064630_2064828_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_034163363.1|2064924_2065467_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	7.4e-16
WP_034163362.1|2065470_2067399_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.5e-127
>prophage 4
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	2316266	2395450	4142037	head,portal,integrase,protease,lysis,terminase,tail,plate,holin,capsid	Enterobacteria_phage(11.43%)	78	2389559:2389572	2395778:2395791
WP_034164850.1|2316266_2317562_-|protease	zinc protease	protease	NA	NA	NA	NA
WP_034164919.1|2318004_2318724_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_049703812.1|2319433_2321521_-	YadA C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_034165889.1|2322147_2323527_-	membrane protein	NA	NA	NA	NA	NA
WP_034165887.1|2323896_2324376_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_034165886.1|2324375_2324921_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_034165885.1|2324898_2325984_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_034165884.1|2325947_2327702_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_034165883.1|2328948_2330550_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_034165882.1|2330549_2334017_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_034165881.1|2334013_2335222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144242841.1|2335206_2335479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038631656.1|2335565_2337917_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	9.7e-20
WP_038631659.1|2337913_2340577_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	6.7e-94
WP_038631662.1|2340754_2341246_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_038631664.1|2341251_2342982_-	OmpA family protein	NA	NA	NA	NA	NA
WP_034166038.1|2342978_2343668_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_049703813.1|2343664_2345005_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_049703814.1|2345022_2346570_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_034171959.1|2346603_2347101_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_071881934.1|2348693_2348846_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_158407655.1|2349485_2350565_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	32.7	1.6e-30
WP_034165338.1|2350602_2351130_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	37.8	1.0e-25
WP_051905111.1|2351132_2352056_-	hypothetical protein	NA	A0A077SK37	Escherichia_phage	49.6	1.1e-16
WP_034165337.1|2352112_2352706_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.2	4.0e-31
WP_034165336.1|2352702_2353845_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	28.0	8.3e-25
WP_034165335.1|2353846_2354284_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	42.0	2.3e-15
WP_095666569.1|2354280_2354823_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_034165332.1|2354861_2355947_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	32.7	6.8e-45
WP_034165331.1|2355943_2357344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165330.1|2357523_2359329_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	47.7	3.9e-29
WP_034165329.1|2359470_2359749_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034165328.1|2359750_2360122_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_034165327.1|2360125_2361628_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	43.1	6.5e-102
WP_071881935.1|2361624_2361816_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_034165326.1|2361819_2362365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165325.1|2362361_2362721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165324.1|2362725_2363094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165323.1|2363065_2364115_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	6.2e-51
WP_034165321.1|2364245_2364650_-|head	head decoration protein	head	NA	NA	NA	NA
WP_034165319.1|2364649_2365231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165318.1|2365232_2366102_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.7	1.2e-52
WP_034165316.1|2366098_2367736_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.5	2.1e-93
WP_034165315.1|2367735_2367999_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_034165314.1|2368007_2370137_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.1	8.6e-100
WP_034165313.1|2370078_2370660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165312.1|2370902_2371541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165311.1|2371543_2371738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165310.1|2372399_2372600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666570.1|2372636_2373122_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	67.6	1.9e-47
WP_034165308.1|2373118_2373595_-	glycoside hydrolase family 104 protein	NA	K7P890	Enterobacteria_phage	84.7	3.6e-75
WP_034165307.1|2373598_2373919_-|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	34.3	7.7e-13
WP_034165306.1|2374512_2375376_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.6	1.8e-40
WP_034165351.1|2375612_2376383_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	50.0	3.5e-67
WP_081926446.1|2376402_2376801_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	59.5	2.2e-33
WP_034165305.1|2377035_2377770_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	39.2	1.8e-33
WP_034165304.1|2377766_2378810_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	56.1	3.1e-71
WP_081926460.1|2378802_2379693_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	57.7	5.4e-80
WP_015461732.1|2379672_2379945_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	68.9	5.0e-29
WP_034165303.1|2379904_2380189_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.4	7.8e-17
WP_034165347.1|2380235_2380415_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_034165302.1|2380606_2381134_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.1e-23
WP_034165301.1|2381153_2381360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071881937.1|2381450_2382101_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	38.9	7.2e-34
WP_034165300.1|2382740_2385854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165299.1|2386334_2388008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165298.1|2388512_2388800_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	52.2	3.3e-07
WP_034165297.1|2388778_2389069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165296.1|2389218_2389689_-	hypothetical protein	NA	NA	NA	NA	NA
2389559:2389572	attL	GCAAATATTGCTGA	NA	NA	NA	NA
WP_034165295.1|2389935_2390136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081926447.1|2390132_2390522_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	64.9	1.9e-26
WP_034165294.1|2390582_2390771_+	hypothetical protein	NA	A0A077KC30	Edwardsiella_phage	86.9	2.2e-20
WP_034165292.1|2391364_2391736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165291.1|2391728_2392064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165290.1|2392063_2392894_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	53.2	1.8e-66
WP_095666584.1|2392902_2393148_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	46.3	1.1e-08
WP_034165289.1|2393147_2394158_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	62.8	2.6e-123
WP_034165288.1|2394412_2395450_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	54.9	5.1e-98
2395778:2395791	attR	TCAGCAATATTTGC	NA	NA	NA	NA
>prophage 5
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	2413125	2445048	4142037	head,portal,tail,tRNA,terminase,holin,capsid	Cronobacter_phage(41.67%)	35	NA	NA
WP_095666535.1|2413125_2413395_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	46.5	1.4e-12
WP_034165800.1|2413453_2414509_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	53.1	1.0e-85
WP_034165801.1|2414483_2416283_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	55.2	9.8e-190
WP_034165802.1|2416469_2417369_+	hypothetical protein	NA	R9TRS3	Vibrio_phage	36.0	2.6e-42
WP_034165803.1|2417383_2418469_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	57.2	2.5e-95
WP_034165804.1|2418425_2419127_+|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	48.7	4.9e-52
WP_034165805.1|2419239_2419722_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	41.0	2.0e-28
WP_034165806.1|2419732_2420212_+	hypothetical protein	NA	F1BUL7	Cronobacter_phage	38.4	7.7e-25
WP_034165807.1|2420198_2420933_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	42.9	5.5e-38
WP_034165808.1|2420937_2422110_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	49.6	9.5e-101
WP_034165809.1|2422106_2422562_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	56.3	1.6e-43
WP_034165810.1|2422565_2422856_+|holin	holin	holin	C7BGD7	Burkholderia_phage	42.2	9.1e-13
WP_034165811.1|2422872_2423424_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	68.5	1.2e-66
WP_049703819.1|2423454_2423748_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	43.2	9.8e-15
WP_158407642.1|2423792_2423933_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	54.3	4.0e-06
WP_034165812.1|2423936_2426051_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	38.9	1.5e-104
WP_034165813.1|2426040_2426394_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	58.2	9.7e-25
WP_034165814.1|2426386_2427571_+	phage protein	NA	F1BUK6	Cronobacter_phage	61.6	6.1e-140
WP_034165815.1|2427567_2428137_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.2	2.2e-47
WP_051905066.1|2428133_2429828_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	46.6	1.3e-71
WP_034165816.1|2429827_2430439_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	37.6	2.3e-29
WP_034165817.1|2430444_2431164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165818.1|2431135_2431720_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	43.8	1.9e-25
WP_034165819.1|2431716_2433465_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	41.5	9.8e-102
WP_012848878.1|2434698_2435247_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_034165459.1|2435301_2437134_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_034165460.1|2437126_2437783_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_012848881.1|2438347_2438572_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_034165461.1|2438675_2439005_+	membrane protein	NA	NA	NA	NA	NA
WP_034165462.1|2439039_2439894_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_144242784.1|2440502_2440748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015461748.1|2441241_2442495_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.4e-20
WP_071881864.1|2442726_2443368_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_034165465.1|2443405_2443852_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_034165467.1|2443944_2445048_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	2850657	2922099	4142037	portal,tail,integrase,terminase,plate,holin	Enterobacteria_phage(41.03%)	70	2878152:2878167	2904009:2904024
WP_034162669.1|2850657_2851134_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_034162670.1|2851137_2852979_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_081926387.1|2854109_2856710_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	30.6	3.3e-85
WP_034162673.1|2856709_2858695_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.5	1.3e-46
WP_012849267.1|2858789_2859092_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_034162674.1|2859105_2860176_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_049703848.1|2860900_2862289_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_034162677.1|2862285_2862936_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_034162678.1|2862932_2866715_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_034162680.1|2867574_2868663_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.8	4.5e-89
WP_034162681.1|2868756_2869689_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_034162682.1|2869899_2870445_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_034162683.1|2870496_2870973_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_015461965.1|2871365_2871662_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_034162684.1|2872059_2873376_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_034162685.1|2873660_2874428_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_034162686.1|2875698_2876202_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_034162687.1|2876198_2876753_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_034162688.1|2876749_2878717_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
2878152:2878167	attL	GCGAAGGCCACGGAAA	NA	NA	NA	NA
WP_034162731.1|2878713_2879202_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_034162689.1|2879201_2879435_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_034162690.1|2879431_2880184_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_034162691.1|2880360_2881020_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_034162692.1|2881016_2881640_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.2	1.0e-05
WP_034162693.1|2882336_2882546_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_034162694.1|2882557_2883547_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_034162695.1|2883555_2885220_+	FUSC family protein	NA	NA	NA	NA	NA
WP_034162696.1|2885655_2886813_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P7E1	Enterobacteria_phage	78.2	1.5e-175
WP_034162732.1|2886912_2887266_-|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	57.4	1.8e-31
WP_071881868.1|2889059_2889932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034162697.1|2890111_2890774_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	30.4	1.3e-14
WP_071881869.1|2890827_2891829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034162698.1|2891825_2894945_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	58.6	0.0e+00
WP_071881870.1|2894985_2895639_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	64.2	1.0e-72
WP_034162699.1|2895536_2896274_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	70.2	1.8e-105
WP_034162700.1|2896362_2896899_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	56.4	7.1e-27
WP_034162701.1|2896977_2897676_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	70.3	1.3e-92
WP_014526494.1|2897691_2898021_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	56.9	6.9e-33
WP_034162702.1|2898020_2900927_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	39.2	1.2e-120
WP_034162703.1|2900916_2901243_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	44.1	3.2e-14
WP_014526491.1|2901251_2901650_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	38.0	3.4e-10
WP_014526490.1|2901702_2902473_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	42.6	5.2e-39
WP_014526489.1|2902474_2902888_-|tail	minor tail component of prophage	tail	A5LH34	Enterobacteria_phage	40.5	2.2e-20
WP_034162704.1|2902884_2903463_-|tail	tail component of prophage protein	tail	NA	NA	NA	NA
WP_034162705.1|2903474_2903756_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	41.8	8.8e-13
WP_034162706.1|2903748_2904072_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	66.0	6.3e-31
2904009:2904024	attR	TTTCCGTGGCCTTCGC	NA	NA	NA	NA
WP_049703849.1|2904164_2906180_-	peptidase S14	NA	A5LH30	Enterobacteria_phage	72.9	1.5e-279
WP_014526543.1|2906136_2907663_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	65.2	1.5e-183
WP_014526542.1|2907662_2907866_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	45.7	7.5e-06
WP_014526541.1|2907862_2909956_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	70.7	1.0e-294
WP_014526540.1|2909955_2910492_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	59.8	7.8e-50
WP_014526537.1|2911174_2911387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034162708.1|2911500_2911788_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	57.6	1.9e-26
WP_034171747.1|2911984_2912386_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	47.5	2.9e-17
WP_034168845.1|2912489_2913338_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	58.4	2.7e-28
WP_034166122.1|2913461_2914007_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	65.0	3.6e-63
WP_034162745.1|2914003_2914285_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	49.5	1.2e-14
WP_014526530.1|2914281_2914653_-	membrane protein	NA	S4TRS4	Salmonella_phage	40.9	1.9e-15
WP_014526529.1|2914851_2915130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034166109.1|2915335_2915872_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	37.2	1.9e-24
WP_034171748.1|2915888_2916932_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	37.6	2.1e-59
WP_015462004.1|2916931_2917147_-	LexA repressor	NA	U5P451	Shigella_phage	46.2	7.7e-09
WP_034166126.1|2917146_2917962_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	59.0	4.6e-86
WP_034172590.1|2918117_2918513_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	57.6	6.8e-35
WP_034166015.1|2919032_2919275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034166016.1|2919271_2920177_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	76.3	8.3e-36
WP_071881874.1|2920179_2920356_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_034166017.1|2920550_2921090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034166018.1|2921183_2921369_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	59.0	8.4e-12
WP_049703850.1|2921448_2922099_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	68.5	7.1e-82
>prophage 7
NZ_CP011516	Edwardsiella sp. LADL05-105 chromosome, complete genome	4142037	3235482	3244834	4142037	integrase	Enterobacteria_phage(83.33%)	12	3232632:3232646	3240068:3240082
3232632:3232646	attL	ATCGCGCTGGCCATC	NA	NA	NA	NA
WP_034165561.1|3235482_3236706_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.1	3.3e-104
WP_034165560.1|3236702_3237815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165559.1|3237795_3238131_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_045425719.1|3238270_3238618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420066.1|3238996_3239614_-	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_071818543.1|3239586_3239829_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.3	1.1e-19
WP_049703874.1|3239825_3240578_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	43.0	2.9e-42
3240068:3240082	attR	GATGGCCAGCGCGAT	NA	NA	NA	NA
WP_034165550.1|3241129_3241396_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	72.7	1.2e-30
WP_034165548.1|3241392_3241944_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	75.9	5.9e-37
WP_034165547.1|3241940_3242168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034165546.1|3242164_3242485_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_034165544.1|3242500_3244834_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.6	0.0e+00
