The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	738892	775004	4843068	transposase,integrase,tRNA,bacteriocin,protease	Acinetobacter_phage(33.33%)	39	728525:728539	762282:762296
728525:728539	attL	CCATGCCAGCATCAA	NA	NA	NA	NA
WP_000421096.1|738892_739171_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|739413_739680_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|739676_739994_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014341481.1|741114_741459_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001681938.1|741643_741928_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|742269_742977_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_046598498.1|745587_746844_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|747060_748146_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|748258_748534_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|748561_749614_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|749768_750488_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|750487_750814_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|750863_751583_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|751705_752164_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|752482_753529_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|753661_754669_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|754759_755896_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|755888_756482_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|756489_756780_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|756776_757343_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|757361_758066_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|758083_759064_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|759193_759880_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|759926_760343_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|760342_760906_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|761121_762069_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|762088_762820_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
762282:762296	attR	TTGATGCTGGCATGG	NA	NA	NA	NA
WP_000286121.1|762896_763604_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|763699_764197_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|764275_765670_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062140.1|766162_767317_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|767372_767672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905074.1|767668_767833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|767966_768098_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|768106_770083_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|770310_771231_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|771331_772090_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|772365_774357_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|774545_775004_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	1047413	1113265	4843068	tail,tRNA	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1047413_1050044_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1050278_1050464_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1051723_1052290_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1052286_1052712_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1052788_1054345_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1054494_1055010_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1055355_1056726_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187289.1|1056774_1058313_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1058329_1059502_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1059628_1060159_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1060655_1061840_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1062004_1063000_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1063069_1064134_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1065682_1066642_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1066652_1068797_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1068769_1069180_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1069176_1069422_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209805.1|1069693_1070125_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1071631_1071958_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1072119_1072470_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1072504_1072954_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1073652_1074054_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1074402_1074930_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1074939_1075239_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1075421_1075580_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1076150_1076828_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531291.1|1076869_1078270_-	GABA permease	NA	NA	NA	NA	NA
WP_001095643.1|1078399_1079683_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1079697_1081146_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1081167_1082436_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993092.1|1082461_1083439_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1083741_1085256_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1085266_1085701_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1085712_1086522_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1086676_1087351_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1087337_1088753_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1088993_1089899_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1090620_1091517_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1091810_1092740_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1093256_1094309_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1095330_1097511_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1097570_1098488_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1098519_1099764_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1099873_1103530_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1103610_1104726_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000905046.1|1105409_1105976_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1106118_1107291_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1107300_1107816_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1107870_1108173_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1108187_1108307_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|1108299_1111377_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|1111373_1111859_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1111855_1112956_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1113046_1113265_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 3
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	1799589	1806901	4843068	protease,integrase	Dickeya_phage(16.67%)	7	1800840:1800854	1812206:1812220
WP_001201759.1|1799589_1800708_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|1800704_1802651_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1800840:1800854	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1802780_1803002_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1803325_1803646_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|1803676_1805953_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|1806164_1806362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1806523_1806901_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1812206:1812220	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	1878214	1920273	4843068	holin,plate,tail,head,terminase	Salmonella_phage(77.78%)	61	NA	NA
WP_001262313.1|1878214_1879507_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1879551_1879800_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1879840_1880080_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1880085_1880967_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1880963_1882028_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1882105_1882786_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1882782_1883568_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1883573_1883870_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1883960_1884161_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1884449_1884854_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|1884983_1885220_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|1885185_1885560_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1885644_1886628_+	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1886630_1887380_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1887390_1887738_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1887734_1888259_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1888258_1888732_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1888735_1889308_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|1890153_1890333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1890343_1890841_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1891025_1891265_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|1891599_1892202_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1892410_1893022_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1893018_1893165_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1893154_1893952_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|1894350_1894476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|1894611_1895061_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|1895277_1895667_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|1895653_1895935_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|1895934_1896549_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_001050879.1|1896545_1897085_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	38.4	2.5e-08
WP_000495544.1|1897127_1897505_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|1897601_1897829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|1897918_1898671_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|1898636_1900040_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|1900039_1901509_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|1901393_1902131_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|1902145_1903378_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|1903382_1903880_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|1903891_1904833_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1904874_1905243_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|1905208_1905616_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|1905612_1906167_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|1906153_1906543_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|1906517_1907081_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|1907084_1908230_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|1908241_1908682_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|1908685_1909138_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|1909315_1911268_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|1911267_1911918_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|1911921_1912224_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|1912226_1913258_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|1913254_1913590_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|1913784_1914516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|1914515_1914944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|1915002_1915758_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001270647.1|1915998_1916352_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_050395943.1|1916352_1917552_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.2	2.5e-213
WP_000049938.1|1917548_1918229_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|1918228_1919740_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|1919754_1920273_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
>prophage 5
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	2400823	2473405	4843068	transposase,integrase,capsid,tRNA,plate,tail,protease	Burkholderia_virus(40.0%)	86	2393327:2393343	2449119:2449135
2393327:2393343	attL	TTTATCCAGCGCCAGTC	NA	NA	NA	NA
WP_000502119.1|2400823_2401282_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|2401238_2401421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001766314.1|2401814_2402066_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|2402334_2403156_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2403190_2403520_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2403506_2403869_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118268.1|2404285_2405320_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2405494_2406883_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2406893_2408423_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2408949_2409894_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2410075_2410465_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_001315282.1|2410436_2410886_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_010989166.1|2410878_2411094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2411083_2411314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2411310_2411994_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_153781233.1|2411990_2412191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2412198_2412582_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2412578_2412881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2412890_2413163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2413451_2413982_-	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2414009_2414279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2414281_2415448_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|2415458_2417228_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000567456.1|2417231_2417396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144079282.1|2417405_2417789_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	58.9	1.7e-27
WP_100208317.1|2417832_2418429_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2418672_2419023_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2419025_2419754_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2419737_2420388_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2420384_2420711_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2420710_2421022_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2421021_2421567_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_170825686.1|2421617_2423159_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000090679.1|2423158_2424655_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2424635_2425457_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2425459_2425918_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2426132_2427248_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2427262_2428216_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|2428225_2428564_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2428565_2429012_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2429011_2429476_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666498.1|2429475_2429727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2429716_2431144_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_162828734.1|2431140_2431665_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000110118.1|2431667_2431949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2432046_2432382_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2432326_2432464_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2432557_2435023_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2435022_2435907_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000478221.1|2435906_2436119_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2436106_2437261_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2437257_2437785_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2437841_2438189_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2438179_2439283_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2439275_2439854_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_000002041.1|2439856_2440825_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	54.8	2.2e-63
WP_001057643.1|2440831_2441449_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_001802272.1|2441448_2441952_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_024131173.1|2441962_2442436_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	4.3e-36
WP_001165548.1|2442507_2443080_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2443360_2444743_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2444804_2445140_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2445266_2445998_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000824321.1|2446478_2447630_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2447782_2449489_+	amidohydrolase	NA	NA	NA	NA	NA
2449119:2449135	attR	GACTGGCGCTGGATAAA	NA	NA	NA	NA
WP_001681605.1|2449599_2450901_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2450976_2451906_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2451902_2453306_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2453473_2455120_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2455319_2456495_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2456597_2458106_+	YdgA family protein	NA	NA	NA	NA	NA
WP_000565566.1|2458811_2459813_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_000998242.1|2459886_2460927_-	oxidoreductase	NA	NA	NA	NA	NA
WP_031608772.1|2461134_2461260_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2461558_2461774_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2461862_2462303_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2462379_2462961_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2462960_2463539_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2463531_2465553_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2465553_2466612_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2466615_2467236_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2467238_2467931_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2467930_2468566_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2469166_2470672_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2470776_2471382_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2472130_2473405_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 6
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	2560911	2624797	4843068	transposase,holin,integrase,capsid,tRNA,plate,tail,portal,head,terminase	Enterobacteria_phage(80.95%)	72	2563339:2563358	2601966:2601985
WP_000080607.1|2560911_2561661_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
WP_001181565.1|2561660_2562212_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000954986.1|2562303_2563284_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2563339:2563358	attL	TTGAAAGAAAAAAGGCCGCA	NA	NA	NA	NA
WP_000997174.1|2563491_2563821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023144639.1|2563928_2564261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247211.1|2564293_2565232_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_001781887.1|2565320_2565632_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|2565723_2566002_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917803.1|2566016_2566355_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
WP_000159458.1|2566365_2566644_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
WP_000514277.1|2566655_2566898_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021663.1|2566894_2567008_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
WP_000985153.1|2567095_2567299_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
WP_000564234.1|2567622_2568012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021575710.1|2568008_2570849_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_001504475.1|2570925_2571885_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_000211283.1|2571889_2572204_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
WP_000193205.1|2572287_2573130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|2573169_2573667_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087812.1|2574315_2575362_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001297574.1|2575361_2577113_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001297576.1|2577267_2578104_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_001055119.1|2578127_2579180_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001297575.1|2579225_2580026_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
WP_001297578.1|2580127_2580622_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_000864897.1|2580621_2580822_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2580824_2581148_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2581144_2581537_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780551.1|2581533_2581941_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
WP_000920594.1|2582078_2582546_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_032145235.1|2582538_2583174_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001345538.1|2583185_2583752_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	1.7e-100
WP_001067548.1|2583769_2584099_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001297572.1|2584102_2584999_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
WP_001761060.1|2584991_2585522_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
WP_021575714.1|2589829_2590417_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
WP_000979945.1|2590452_2590941_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_048668115.1|2590953_2593761_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
WP_000333503.1|2593747_2593903_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2593911_2594286_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2594341_2594854_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_046598508.1|2594853_2596038_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_021524734.1|2596195_2597299_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
WP_001781354.1|2597463_2598099_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005564.1|2598095_2599208_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_021575717.1|2599200_2600589_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
WP_000004182.1|2600588_2600861_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_001781539.1|2601113_2601374_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2601564_2601705_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229266.1|2602113_2602413_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2601966:2601985	attR	TTGAAAGAAAAAAGGCCGCA	NA	NA	NA	NA
WP_000672399.1|2602417_2604805_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|2604820_2605804_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2605940_2605985_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2606105_2606462_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2606512_2606710_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011106936.1|2606805_2607348_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
WP_001144226.1|2607351_2609280_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
WP_000905563.1|2610171_2611395_+	O-antigen polymerase	NA	NA	NA	NA	NA
WP_010989178.1|2611717_2611924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916613.1|2612948_2613263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046434.1|2613405_2614365_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000770984.1|2614413_2615172_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251706.1|2615460_2616393_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146133.1|2616489_2616780_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267686.1|2616886_2617747_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222158.1|2617789_2618326_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106859.1|2618474_2619143_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000505801.1|2619280_2619880_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010658.1|2620016_2621408_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_000977510.1|2621510_2621753_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_000019093.1|2621969_2624222_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
WP_000502119.1|2624338_2624797_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	2693080	2697492	4843068		Escherichia_phage(50.0%)	6	NA	NA
WP_000497451.1|2693080_2693320_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001529135.1|2694192_2695002_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2695074_2695452_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2695599_2696142_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2696333_2697062_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2697078_2697492_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 8
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	2901365	2908599	4843068		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|2901365_2902796_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|2902869_2903565_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|2903644_2903956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2904606_2905791_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|2906051_2906240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|2906250_2906463_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|2906908_2908177_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|2908179_2908599_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 9
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	2992341	3002848	4843068		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|2992341_2993655_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|2993681_2994761_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|2994765_2995539_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|2995554_2996529_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|2996534_2997086_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|2997086_2997965_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|2998012_2998912_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|2998911_2999997_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3000373_3001267_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3001444_3002848_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 10
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	3078740	3087911	4843068	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3078740_3080774_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3081014_3081473_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3081644_3082175_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3082231_3082699_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3082745_3083465_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3083461_3085147_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3085369_3086101_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3086160_3086268_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3086248_3086980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3086963_3087911_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 11
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	3322420	3328451	4843068		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3322420_3323362_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3324604_3324994_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3324962_3325217_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|3325233_3327156_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|3328145_3328289_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3328304_3328451_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 12
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	3553335	3598339	4843068	holin,integrase,plate,tail,terminase	Salmonella_phage(45.24%)	57	3579367:3579384	3603984:3604001
WP_000790154.1|3553335_3555135_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_023239910.1|3555593_3555770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046593561.1|3555809_3556079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046593560.1|3556331_3557474_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_046593559.1|3557514_3558090_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.3	1.7e-90
WP_046593558.1|3558079_3558904_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	96.7	4.4e-153
WP_046598534.1|3558900_3560610_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	2.6e-91
WP_046593555.1|3560606_3561233_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	72.1	6.6e-93
WP_046598535.1|3561216_3562443_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	63.6	1.8e-147
WP_001261467.1|3562439_3562772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026342.1|3562768_3563485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181121.1|3563481_3564525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061271.1|3564524_3564800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000011138.1|3564796_3565513_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	1.3e-28
WP_046593553.1|3565512_3567567_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	2.2e-20
WP_046593552.1|3567690_3568278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|3568277_3568715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046593549.1|3568718_3570113_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.1	7.1e-71
WP_046593547.1|3570118_3571060_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	36.7	1.1e-51
WP_046593545.1|3571043_3571478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046593542.1|3571474_3571903_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	1.3e-23
WP_046593541.1|3571899_3572382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046593539.1|3572449_3573481_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.7e-72
WP_046593537.1|3573497_3574358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046593534.1|3574373_3575993_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001091611.1|3576005_3576830_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.7	1.4e-53
WP_046593532.1|3576826_3578248_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
WP_046593530.1|3578259_3579591_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	6.4e-154
3579367:3579384	attL	ATACTGACGATATTCAGC	NA	NA	NA	NA
WP_046593527.1|3579592_3580345_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.3	1.3e-15
WP_046598537.1|3580405_3580909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046598538.1|3581011_3581554_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_046593563.1|3581550_3582165_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	7.6e-110
WP_162264800.1|3582167_3582509_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001047634.1|3582913_3583711_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001617856.1|3583700_3583847_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_046593564.1|3583843_3584455_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.5	3.0e-90
WP_046598596.1|3584663_3585266_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	98.5	2.8e-109
WP_014343878.1|3585300_3585549_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_046593565.1|3585665_3585899_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	74.0	2.1e-28
WP_046593566.1|3587159_3587663_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	71.3	9.9e-31
WP_046593567.1|3587662_3588019_-	Eaf protein	NA	T1SA95	Salmonella_phage	91.5	3.6e-59
WP_046593568.1|3588015_3588363_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	9.1e-52
WP_000800012.1|3588373_3589123_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001191966.1|3589125_3590187_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.1	1.1e-36
WP_015702794.1|3590460_3590835_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|3590800_3591028_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_046593569.1|3591041_3591509_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	85.2	2.1e-67
WP_046593570.1|3591656_3592655_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.1	1.5e-43
WP_046593571.1|3592683_3592890_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_048668188.1|3593186_3593723_+	HNH endonuclease	NA	A0A0M3ULK5	Salmonella_phage	99.4	1.2e-95
WP_046593573.1|3594003_3594300_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	91.8	2.3e-43
WP_046593574.1|3594305_3595049_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	69.4	9.7e-67
WP_046593575.1|3595045_3595669_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.4	2.2e-56
WP_046593576.1|3595665_3596562_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.7	3.0e-155
WP_001754984.1|3596567_3596807_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_046593578.1|3596847_3597132_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	84.0	2.7e-41
WP_046593579.1|3597109_3598339_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	3.2e-232
3603984:3604001	attR	GCTGAATATCGTCAGTAT	NA	NA	NA	NA
>prophage 13
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	4025227	4037881	4843068	integrase	Enterobacteria_phage(50.0%)	12	4024686:4024699	4036090:4036103
4024686:4024699	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_000783716.1|4025227_4027561_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	86.5	0.0e+00
WP_000795388.1|4027575_4027896_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|4027892_4028120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|4028116_4028668_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001779443.1|4029463_4030207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468230.1|4030210_4030450_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|4030465_4031032_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|4031307_4032471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700163.1|4032460_4033519_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000573583.1|4033515_4034592_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|4034654_4035920_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4036390_4037881_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4036090:4036103	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 14
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	4176845	4255679	4843068	integrase,capsid,plate,tail,lysis,portal,head,terminase	Salmonella_phage(83.33%)	88	4183998:4184013	4256774:4256789
WP_000954536.1|4176845_4178105_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4178415_4179699_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4180679_4181462_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_162009227.1|4181731_4181926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193665.1|4182318_4182540_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4182536_4182998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4183544_4185218_+	hypothetical protein	NA	NA	NA	NA	NA
4183998:4184013	attL	GAAGAAGACTTCTTTG	NA	NA	NA	NA
WP_010989300.1|4185298_4187584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131240.1|4187887_4188139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4188220_4188673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4188852_4189341_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4189337_4189631_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4190057_4191071_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4191234_4192824_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4192807_4194319_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4195172_4195712_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4195956_4197234_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4197236_4198283_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4198306_4200802_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4200801_4202538_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4202582_4203650_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4203659_4204454_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4204479_4205175_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4205197_4206502_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4206521_4208492_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
WP_000354257.1|4208793_4209540_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4209539_4210430_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001681810.1|4210440_4210698_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_000027757.1|4211804_4212830_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4212833_4213466_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4213582_4213825_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4213857_4214367_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4214374_4214575_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4214538_4214880_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4214947_4215181_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4215180_4215408_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4215404_4215989_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4215985_4216846_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_000301193.1|4216836_4219245_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
WP_001154438.1|4219412_4219601_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4219612_4219846_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4219941_4220160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4220169_4221234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4221230_4222295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4222314_4223010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4223058_4224102_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4224101_4225868_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4226010_4226844_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4226860_4227925_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4227928_4228579_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4228672_4229137_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4229136_4229340_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4229343_4229559_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4229539_4230049_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4230053_4230431_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_024131238.1|4230427_4230856_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_001039961.1|4230951_4231383_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343944.1|4231375_4231822_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4231890_4232469_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4232465_4232825_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4232811_4233720_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4233712_4234318_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4234314_4235934_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4235940_4236348_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4236545_4237268_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4237481_4237700_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4237802_4238975_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4238984_4239500_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4239554_4239857_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4239871_4239991_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_161976233.1|4240217_4242764_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000980405.1|4242763_4243249_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4243245_4244346_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4244413_4244632_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4244718_4245096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4245315_4246590_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4246721_4246991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|4247090_4247417_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022217.1|4247491_4248391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4248464_4249373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4249444_4251394_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000115421.1|4251482_4251941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|4252018_4252315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|4252311_4252764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046598522.1|4252781_4252991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|4253256_4253637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020123.1|4253732_4254035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907593.1|4254758_4255679_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
4256774:4256789	attR	GAAGAAGACTTCTTTG	NA	NA	NA	NA
>prophage 15
NZ_LT904868	Salmonella enterica subsp. enterica serovar Typhi strain H12ESR04734-001A chromosome 1	4843068	4550991	4589049	4843068	transposase,integrase,capsid,plate,tail,lysis,portal,head,terminase	Salmonella_phage(78.57%)	48	4545955:4545969	4558121:4558135
4545955:4545969	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4550991_4552638_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4552777_4552876_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4553501_4554554_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4554742_4554934_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4554949_4555519_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4555644_4555866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4555898_4556408_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4556415_4556712_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4556829_4557171_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4557238_4557472_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4557471_4557699_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4557695_4558553_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4558121:4558135	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4558549_4560964_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4561117_4561306_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4561373_4561673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4561781_4562660_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4563273_4564188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048668161.1|4564184_4564925_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4564959_4565997_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4565996_4567763_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4567905_4568739_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4568755_4569814_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4569817_4570468_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4570563_4571028_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4571027_4571231_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4571234_4571450_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4571430_4571943_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4571944_4572322_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4572318_4572747_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4572842_4573274_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4573266_4573713_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_048668159.1|4573781_4574360_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	9.4e-94
WP_000177595.1|4574356_4574716_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4574702_4575611_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4575603_4576209_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|4576205_4577720_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|4577719_4578313_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4578284_4578725_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_000905046.1|4579153_4579720_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4579862_4581035_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4581044_4581560_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4581614_4581917_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4581931_4582051_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|4582043_4585121_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|4585117_4585603_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4585599_4586700_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4586790_4587009_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502114.1|4588590_4589049_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
