The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	12649	30058	4808702	integrase,transposase	Escherichia_phage(33.33%)	17	NA	NA
WP_001138064.1|12649_15616_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|15618_16179_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|16304_16655_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|16857_17871_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|18028_18502_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|18731_19079_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|19072_19912_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001067855.1|20145_20850_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|20896_21298_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|21447_22308_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|22807_23512_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|23572_24409_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_024261901.1|24408_25212_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|25272_26088_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|26395_27247_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|28002_28707_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|28753_30058_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
>prophage 2
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	764326	808029	4808702	protease,transposase,tRNA,bacteriocin	Acinetobacter_phage(25.0%)	47	NA	NA
WP_000421096.1|764326_764605_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|764847_765114_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|765110_765428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525158.1|766548_766728_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001681938.1|767077_767362_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|767703_768411_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|771021_772278_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|772494_773580_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|773692_773968_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|773995_775048_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|775202_775922_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|775921_776248_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|776297_777017_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|777139_777598_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|777916_778963_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|779095_780103_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|780193_781330_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|781322_781916_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|781923_782214_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|782210_782777_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|782795_783500_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|783517_784498_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|784627_785314_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|785360_785777_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|785776_786340_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|786555_787503_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|787522_788254_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286121.1|788330_789038_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|789133_789631_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|789709_791104_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001062140.1|791596_792751_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|792806_793106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|793400_793532_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|793540_795517_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|795744_796665_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|796765_797524_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|797799_799791_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|799979_800438_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000956919.1|800542_801199_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000367758.1|801192_801876_-	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000553254.1|801857_802565_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124001.1|802565_803144_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000218564.1|803169_803595_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218338.1|803968_805015_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000111274.1|805036_806200_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034386.1|806301_807381_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001204111.1|807570_808029_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	1073412	1139403	4808702	tail,tRNA	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1073412_1076043_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1076277_1076463_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1077861_1078428_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1078424_1078850_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1078926_1080483_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1080632_1081148_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1081493_1082864_+	glycoporin	NA	NA	NA	NA	NA
WP_001187289.1|1082912_1084451_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1084467_1085640_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1085766_1086297_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1086793_1087978_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1088142_1089138_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1089207_1090272_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1091820_1092780_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1092790_1094935_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1094907_1095318_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1095314_1095560_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_010989219.1|1095658_1095835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209805.1|1095831_1096263_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1097769_1098096_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1098257_1098608_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1098642_1099092_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1099790_1100192_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1100540_1101068_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1101077_1101377_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1101559_1101718_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1102288_1102966_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001095643.1|1104537_1105821_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1105835_1107284_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1107305_1108574_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001782268.1|1108599_1109586_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1109879_1111394_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1111404_1111839_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1111850_1112660_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1112814_1113489_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1113475_1114891_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1115131_1116037_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1116758_1117655_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1117948_1118878_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1119394_1120447_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1121468_1123649_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1123708_1124626_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1124657_1125902_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1126011_1129668_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1129748_1130864_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000905046.1|1131547_1132114_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1132256_1133429_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1133438_1133954_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1134008_1134311_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1134325_1134445_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|1134437_1137515_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|1137511_1137997_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1137993_1139094_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1139184_1139403_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 4
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	1825830	1833142	4808702	protease,integrase	Dickeya_phage(16.67%)	7	1827081:1827095	1838260:1838274
WP_001201759.1|1825830_1826949_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|1826945_1828892_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1827081:1827095	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1829021_1829243_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1829566_1829887_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|1829917_1832194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|1832405_1832603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1832764_1833142_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1838260:1838274	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 5
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	1904280	1978380	4808702	protease,tail,integrase,transposase,terminase,holin,head	Salmonella_phage(75.41%)	91	1886346:1886365	1956953:1956972
1886346:1886365	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|1904280_1905573_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1905617_1905866_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1905906_1906146_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1906151_1907033_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1907029_1908094_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1908171_1908852_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1908848_1909634_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1909639_1909936_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1910026_1910227_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1910515_1910920_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|1911049_1911286_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|1911251_1911626_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1911710_1912694_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1912696_1913446_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1913456_1913804_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1913800_1914325_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1914324_1914798_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1914801_1915374_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_001220318.1|1915467_1915734_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
WP_010989139.1|1915815_1915977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509711.1|1916219_1916399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1916409_1916907_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1917091_1917331_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001574100.1|1917320_1917626_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929790.1|1917665_1918268_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1918476_1919088_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1919084_1919231_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1919220_1920018_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|1920416_1920542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|1920677_1921127_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|1921343_1921733_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|1921719_1922001_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|1922000_1922615_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000495544.1|1923192_1923570_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|1923666_1923894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|1923983_1924736_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|1924701_1926105_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|1926104_1927574_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|1927458_1928196_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|1928210_1929443_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|1929447_1929945_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|1929956_1930898_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1930939_1931308_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|1931273_1931681_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|1931677_1932232_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|1932218_1932608_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|1932582_1933146_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|1933149_1934295_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|1934306_1934747_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|1934750_1935203_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|1935380_1937333_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|1937332_1937983_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|1937986_1938289_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|1938291_1939323_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|1939319_1939655_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|1939849_1940581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|1940580_1941009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|1941067_1941823_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_000564971.1|1941910_1942048_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
WP_001270647.1|1942063_1942417_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|1942417_1943617_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|1943613_1944294_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|1944293_1945805_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|1945819_1946338_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|1947259_1947961_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000497443.1|1948273_1948552_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
WP_000193884.1|1948977_1951590_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|1951797_1952808_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1952973_1953516_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|1953512_1954622_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|1954720_1956829_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|1956841_1958749_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1956953:1956972	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1958763_1960017_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1960021_1961662_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1961658_1962222_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|1962475_1962643_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1962742_1963261_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|1963329_1965090_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|1965275_1965728_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|1965799_1966852_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1967206_1967716_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|1967932_1968538_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|1968524_1970678_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1970696_1971143_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|1971266_1973321_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1973356_1973815_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1973909_1974572_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1974742_1975159_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1975203_1975521_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|1975578_1976790_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502118.1|1977921_1978380_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	2425920	2465504	4808702	protease,tail,head,plate	Burkholderia_virus(40.0%)	41	NA	NA
WP_000549642.1|2425920_2426742_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2426776_2427106_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2427092_2427455_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001539987.1|2427566_2427737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118268.1|2427871_2428906_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001219360.1|2430478_2432008_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2432534_2433479_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2433660_2434050_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|2434021_2434474_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|2434463_2434679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2434668_2434899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132655.1|2435574_2435790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2435782_2436166_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2436162_2436465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2436474_2436747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2437035_2437566_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2437593_2437863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124682070.1|2440986_2441325_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.1	1.9e-22
WP_100208317.1|2441413_2442010_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2442253_2442604_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2442606_2443335_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2443318_2443969_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2443965_2444292_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2444291_2444603_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000117561.1|2448214_2449036_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2449038_2449497_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2449711_2450827_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2450841_2451795_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000271668.1|2452143_2452590_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001789770.1|2453049_2453304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034292.1|2454719_2455241_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110118.1|2455243_2455525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000458383.1|2458595_2459480_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_010989167.1|2459476_2459692_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2459679_2460834_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2460830_2461358_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000852584.1|2462846_2463425_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_088204032.1|2463427_2463994_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	70.8	8.0e-37
WP_072194399.1|2463936_2464422_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	6.6e-40
WP_001057643.1|2464421_2465039_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_031624893.1|2465045_2465504_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.7	5.6e-41
>prophage 7
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	2678543	2682955	4808702		Escherichia_phage(50.0%)	7	NA	NA
WP_000497459.1|2678543_2678783_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
WP_001036668.1|2678994_2679159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2679655_2680465_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2680537_2680915_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2681062_2681605_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2681796_2682525_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2682541_2682955_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 8
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	2886816	2894050	4808702		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|2886816_2888247_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|2888320_2889016_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|2889095_2889407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2890057_2891242_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|2891502_2891691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|2891701_2891914_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|2892359_2893628_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|2893630_2894050_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 9
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	3000350	3010857	4808702		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|3000350_3001664_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|3001690_3002770_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|3002774_3003548_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|3003563_3004538_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|3004543_3005095_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|3005095_3005974_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|3006021_3006921_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|3006920_3008006_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3008382_3009276_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3009453_3010857_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 10
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	3086748	3095919	4808702	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3086748_3088782_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3089022_3089481_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3089652_3090183_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3090239_3090707_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3090753_3091473_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3091469_3093155_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3093377_3094109_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3094168_3094276_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3094256_3094988_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3094971_3095919_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 11
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	3330428	3336459	4808702		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3330428_3331370_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3332612_3333002_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3332970_3333225_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_044790602.1|3333241_3335164_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.0	3.6e-299
WP_106417236.1|3336153_3336297_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3336312_3336459_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 12
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	3992800	4002565	4808702	capsid,integrase	Enterobacteria_phage(50.0%)	10	3989371:3989384	4000774:4000787
3989371:3989384	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_015701354.1|3992800_3993352_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556589.1|3993284_3993608_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
WP_010989311.1|3994030_3994891_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_000468230.1|3994894_3995134_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|3995149_3995716_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|3995991_3997155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989310.1|3997129_3998203_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
WP_000573583.1|3998199_3999276_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|3999338_4000604_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4001074_4002565_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4000774:4000787	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 13
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	4141528	4216064	4808702	plate,tail,integrase,portal,terminase,capsid,lysis,head	Salmonella_phage(83.33%)	80	4171866:4171881	4194869:4194884
WP_000954536.1|4141528_4142788_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4143098_4144382_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4145362_4146145_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000193665.1|4147001_4147223_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4147219_4147681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4148227_4149901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989300.1|4149981_4152267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905294.1|4152558_4152822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4152903_4153356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4153535_4154024_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4154020_4154314_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4154740_4155754_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4155917_4157507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120833.1|4157490_4159002_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4159855_4160395_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4160639_4161917_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4161919_4162966_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_072076597.1|4162989_4165485_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4165484_4167221_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4167265_4168333_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4168342_4169137_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4169162_4169858_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4169880_4171185_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4171204_4173175_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
4171866:4171881	attL	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_000354257.1|4173476_4174223_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4174222_4175113_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681810.1|4175123_4175381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902197.1|4176027_4176381_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
WP_000027757.1|4176487_4177513_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4177516_4178149_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4178265_4178508_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4178540_4179050_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4179057_4179258_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4179221_4179563_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4179630_4179864_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4179863_4180091_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4180087_4180672_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4180668_4181529_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001154438.1|4184082_4184271_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4184282_4184516_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4184611_4184830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4184839_4185904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4185900_4186965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4186984_4187680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4187728_4188772_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4188771_4190538_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4190680_4191514_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4191530_4192595_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4192598_4193249_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4193342_4193807_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4193806_4194010_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4194013_4194229_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4194209_4194719_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4194723_4195101_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
4194869:4194884	attR	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_001772475.1|4195100_4195526_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
WP_001039966.1|4195621_4196053_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_000343944.1|4196045_4196492_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4196560_4197139_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4197135_4197495_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4197481_4198390_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4198382_4198988_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4198984_4200604_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4200610_4201018_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4201215_4201938_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4202151_4202370_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4202472_4203645_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4203654_4204170_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4204224_4204527_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4204541_4204661_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001282813.1|4204653_4207434_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
WP_000980405.1|4207433_4207919_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4207915_4209016_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4209083_4209302_+	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4209388_4209766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4209985_4211260_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4211391_4211661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989298.1|4211760_4212120_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022216.1|4212161_4213061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4213134_4214043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4214114_4216064_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
>prophage 14
NZ_LT883153	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, chromosome: 1	4808702	4665696	4703754	4808702	plate,tail,integrase,portal,transposase,terminase,capsid,lysis,head	Salmonella_phage(76.74%)	49	4660660:4660674	4672826:4672840
4660660:4660674	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4665696_4667343_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4667482_4667581_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4668206_4669259_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4669447_4669639_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4669654_4670224_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4670349_4670571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4670603_4671113_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4671120_4671417_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4671534_4671876_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4671943_4672177_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4672176_4672404_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4672400_4673258_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4672826:4672840	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4673254_4675669_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4675822_4676011_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4676078_4676378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4676486_4677365_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4677978_4678893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4678889_4679630_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4679664_4680702_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4680701_4682468_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4682610_4683444_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4683460_4684519_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4684522_4685173_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4685268_4685733_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4685732_4685936_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4685939_4686155_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|4686174_4686648_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727853.1|4686649_4687027_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4687023_4687452_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4687547_4687979_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4687971_4688418_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4688486_4689065_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4689061_4689421_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4689407_4690316_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4690308_4690914_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_048667453.1|4690910_4692317_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.3	5.2e-154
WP_001174915.1|4692319_4692760_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_000805568.1|4692731_4693325_-|tail	tail assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_031625033.1|4693324_4693828_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	71.3	2.1e-57
WP_000905046.1|4693858_4694425_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4694567_4695740_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4695749_4696265_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4696319_4696622_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4696636_4696756_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|4696748_4699826_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|4699822_4700308_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4700304_4701405_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4701495_4701714_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502114.1|4703295_4703754_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_LT883154	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, plasmid: 2	106706	488	89920	106706	terminase,integrase,tail	Salmonella_phage(91.84%)	107	NA	NA
WP_000064174.1|488_812_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
WP_044790583.1|926_3479_-|tail	tail fiber domain-containing protein	tail	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
WP_011011097.1|3561_7950_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.7	0.0e+00
WP_001293197.1|7964_8552_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
WP_000528167.1|8539_9337_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	95.8	1.2e-155
WP_072075016.1|9329_10061_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
WP_000440566.1|10117_10453_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_044790579.1|10494_15078_-	tape measure protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
WP_002228782.1|15085_15355_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_000163862.1|15435_15753_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000072376.1|15812_16559_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
WP_000469441.1|16633_17017_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_000523626.1|17018_17492_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_001027662.1|17482_17827_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000057119.1|17924_18758_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_000801184.1|18757_19192_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_001115046.1|19235_20159_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_001130336.1|20233_21109_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_001055287.1|21135_22032_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
WP_000423989.1|22054_23629_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
WP_001007302.1|23662_24919_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
WP_000215412.1|24921_25563_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
WP_000176291.1|25758_26025_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_011011099.1|26034_26934_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
WP_001113021.1|26930_27185_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_000049963.1|27177_27816_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
WP_000164561.1|27812_28481_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_011011100.1|28480_29179_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.6	1.9e-125
WP_000218382.1|29243_30803_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
WP_001291547.1|30805_31084_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000683475.1|31143_31566_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_000182009.1|31570_32098_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
WP_011011101.1|32101_32410_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000072873.1|32732_33383_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
WP_000234274.1|33467_33695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009195.1|34326_34809_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
WP_024134090.1|34821_35055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011102.1|35014_35302_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
WP_000218787.1|35422_35815_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
WP_000786235.1|35943_36255_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
WP_000559556.1|36331_36646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594283.1|36740_36959_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
WP_000276519.1|36969_37185_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
WP_011011103.1|37327_37573_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
WP_000132517.1|39009_40200_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
WP_000916329.1|40209_40527_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
WP_011011104.1|40611_40893_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
WP_000860613.1|41066_41270_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
WP_000218758.1|41330_41618_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
WP_011011105.1|41614_41926_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
WP_000861921.1|41934_42477_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
WP_000086990.1|42473_43115_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
WP_000766011.1|43206_43578_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
WP_001291673.1|43858_44548_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
WP_011011107.1|44606_46310_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_000333240.1|46433_47006_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
WP_000462606.1|47114_47957_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|48065_48254_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_024134091.1|48263_48758_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
WP_011011108.1|48900_49509_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
WP_000262979.1|50094_50325_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_000559567.1|50527_51121_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
WP_011011109.1|51306_52233_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
WP_000208226.1|52277_52835_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_000564632.1|52844_53264_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
WP_000386471.1|53327_53972_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_000781812.1|53971_54448_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_006812548.1|54444_54858_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
WP_011011110.1|54859_55975_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
WP_000673231.1|56090_57020_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
WP_011011111.1|57102_58245_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
WP_000623686.1|58352_60668_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_000047571.1|60745_61315_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
WP_000009516.1|61327_62074_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
WP_000670362.1|62063_63980_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_000107766.1|63976_64213_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
WP_000174806.1|64209_65295_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
WP_000832167.1|65523_66027_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
WP_001288958.1|66058_66553_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
WP_000364575.1|66628_67273_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
WP_001293470.1|68017_69073_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
WP_154080930.1|69278_69419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011087.1|69601_69805_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
WP_000859650.1|69804_70110_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
WP_000699340.1|70150_70426_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
WP_000737807.1|70494_70905_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
WP_000801005.1|70888_71260_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_000715582.1|71422_72265_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
WP_000589750.1|72268_72469_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_001051805.1|72560_73637_-	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
WP_000920226.1|73639_73906_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_001108398.1|73905_74850_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
WP_000045710.1|74910_75939_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
WP_000102109.1|76058_76490_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_000459729.1|76735_77326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031298.1|77419_77863_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
WP_000645855.1|77859_81378_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
WP_000127343.1|81558_82794_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
WP_044790587.1|82890_85248_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
WP_000790461.1|85357_85570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224608.1|85831_86218_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000798892.1|86209_87316_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_001117719.1|87576_88068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869626.1|88232_88478_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	41.6	2.1e-10
WP_000131231.1|88477_88858_-	hypothetical protein	NA	Q716B1	Shigella_phage	67.2	6.7e-40
WP_000159906.1|88873_89077_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
WP_011011090.1|89086_89920_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	2.4e-90
>prophage 2
NZ_LT883154	Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, plasmid: 2	106706	93738	106420	106706		Salmonella_phage(88.24%)	17	NA	NA
WP_000067984.1|93738_94044_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
WP_044790586.1|94040_94193_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
WP_011011092.1|94192_94399_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
WP_000901956.1|94388_94565_-	hypothetical protein	NA	J9Q729	Salmonella_phage	96.6	2.6e-23
WP_000413053.1|94564_95887_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
WP_011011093.1|95921_96179_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
WP_000642525.1|96479_97274_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
WP_000209842.1|97457_98510_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
WP_011011094.1|98511_99723_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
WP_011011095.1|99785_101126_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
WP_000078184.1|101186_101912_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
WP_001238819.1|102189_103245_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
WP_000966077.1|103314_104070_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
WP_000062815.1|104118_104478_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
WP_000161333.1|104477_105143_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
WP_001287064.1|105473_106025_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
WP_011011096.1|106075_106420_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
