The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	739561	775673	4800835	transposase,bacteriocin,integrase,protease,tRNA	Acinetobacter_phage(33.33%)	41	729194:729208	762951:762965
729194:729208	attL	CCATGCCAGCATCAA	NA	NA	NA	NA
WP_000421096.1|739561_739840_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|740082_740349_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|740345_740663_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_171004593.1|741783_742083_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001681938.1|742312_742597_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|742938_743646_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_046598498.1|746256_747513_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|747729_748815_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|748927_749203_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|749230_750283_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|750437_751157_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|751156_751483_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|751532_752252_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|752374_752833_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_023227599.1|752789_752972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000394189.1|753151_754198_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|754330_755338_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|755428_756565_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|756557_757151_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|757158_757449_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|757445_758012_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|758030_758735_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|758752_759733_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|759862_760549_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|760595_761012_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|761011_761575_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|761790_762738_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|762757_763489_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
762951:762965	attR	TTGATGCTGGCATGG	NA	NA	NA	NA
WP_000286121.1|763565_764273_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|764368_764866_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|764944_766339_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062140.1|766831_767986_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|768041_768341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905074.1|768337_768502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|768635_768767_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|768775_770752_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|770979_771900_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|772000_772759_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|773034_775026_+	transketolase	NA	NA	NA	NA	NA
WP_000431187.1|775075_775258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|775214_775673_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	1048060	1113912	4800835	tail,tRNA	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1048060_1050691_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1050925_1051111_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1052370_1052937_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1052933_1053359_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1053435_1054992_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1055141_1055657_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1056002_1057373_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187289.1|1057421_1058960_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1058976_1060149_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1060275_1060806_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1061302_1062487_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1062651_1063647_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1063716_1064781_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1066329_1067289_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1067299_1069444_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1069416_1069827_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1069823_1070069_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209805.1|1070340_1070772_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1072278_1072605_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1072766_1073117_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1073151_1073601_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1074299_1074701_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1075049_1075577_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1075586_1075886_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1076068_1076227_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1076797_1077475_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531291.1|1077516_1078917_-	GABA permease	NA	NA	NA	NA	NA
WP_001095643.1|1079046_1080330_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1080344_1081793_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1081814_1083083_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993092.1|1083108_1084086_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1084388_1085903_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1085913_1086348_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1086359_1087169_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1087323_1087998_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1087984_1089400_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1089640_1090546_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1091267_1092164_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1092457_1093387_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1093903_1094956_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1095977_1098158_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1098217_1099135_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1099166_1100411_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1100520_1104177_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1104257_1105373_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000905046.1|1106056_1106623_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1106765_1107938_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1107947_1108463_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1108517_1108820_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1108834_1108954_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|1108946_1112024_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|1112020_1112506_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1112502_1113603_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1113693_1113912_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 3
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	1408865	1414896	4800835		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|1408865_1409012_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|1409027_1409171_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400611.1|1410160_1412083_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_000703599.1|1412099_1412354_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|1412322_1412712_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377769.1|1413954_1414896_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
>prophage 4
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	1649405	1658576	4800835	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1649405_1650353_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1650336_1651068_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1651048_1651156_-	protein YohO	NA	NA	NA	NA	NA
WP_001240415.1|1651215_1651947_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272853.1|1652169_1653855_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598632.1|1653851_1654571_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1654617_1655085_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1655141_1655672_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1655843_1656302_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195338.1|1656542_1658576_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	1734468	1744975	4800835		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111852.1|1734468_1735872_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
WP_000981469.1|1736049_1736943_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1737319_1738405_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023656.1|1738404_1739304_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857536.1|1739351_1740230_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_000973711.1|1740230_1740782_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018220.1|1740787_1741762_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1741777_1742551_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565909.1|1742555_1743635_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000126347.1|1743661_1744975_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	1828717	1835951	4800835		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1828717_1829137_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457648.1|1829139_1830408_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000208507.1|1830853_1831066_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_024131163.1|1831076_1831265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|1831525_1832710_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_000107435.1|1833360_1833672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377043.1|1833751_1834447_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_001157299.1|1834520_1835951_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	2039823	2044235	4800835		Escherichia_phage(50.0%)	7	NA	NA
WP_000281950.1|2039823_2040237_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_001766395.1|2040253_2040982_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000158843.1|2041173_2041716_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|2041863_2042241_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|2042313_2043123_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001036668.1|2043619_2043784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497451.1|2043995_2044235_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 8
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	2112508	2176373	4800835	tail,transposase,plate,terminase,portal,holin,capsid,integrase,head,tRNA	Enterobacteria_phage(76.09%)	76	2135321:2135340	2173927:2173946
WP_000502119.1|2112508_2112967_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000019093.1|2113083_2115336_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
WP_000977510.1|2115552_2115795_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_001010658.1|2115897_2117289_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_000505801.1|2117425_2118025_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106859.1|2118162_2118831_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222158.1|2118979_2119516_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267686.1|2119558_2120419_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146133.1|2120525_2120816_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251706.1|2120912_2121845_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000770984.1|2122133_2122892_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001046434.1|2122940_2123900_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000916613.1|2124042_2124357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989178.1|2125381_2125588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905563.1|2125910_2127134_-	O-antigen polymerase	NA	NA	NA	NA	NA
WP_001144226.1|2128025_2129954_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
WP_011106936.1|2129957_2130500_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
WP_001124225.1|2130595_2130793_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2130843_2131200_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2131320_2131365_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|2131501_2132485_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672399.1|2132500_2134888_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|2134892_2135192_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2135321:2135340	attL	TGCGGCCTTTTTTCTTTCAA	NA	NA	NA	NA
WP_000078916.1|2135600_2135741_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001781539.1|2135931_2136192_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000004182.1|2136444_2136717_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_021575717.1|2136716_2138105_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
WP_000005564.1|2138097_2139210_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_001781354.1|2139206_2139842_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_021524734.1|2140006_2141110_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
WP_046598508.1|2141267_2142452_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_000290462.1|2142451_2142964_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|2143019_2143394_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|2143402_2143558_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_048668115.1|2143544_2146352_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
WP_000979945.1|2146364_2146853_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_021575714.1|2146888_2147476_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
WP_050144320.1|2147601_2148564_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	94.4	3.8e-180
WP_000972092.1|2148565_2149093_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
WP_000972163.1|2149121_2149655_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_046598513.1|2149657_2151760_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	59.6	3.2e-200
WP_001761060.1|2151762_2152293_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
WP_001297572.1|2152285_2153182_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
WP_001067548.1|2153185_2153515_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001345538.1|2153532_2154099_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	1.7e-100
WP_032145235.1|2154110_2154746_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920594.1|2154738_2155206_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780551.1|2155343_2155751_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
WP_000072327.1|2155747_2156140_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2156136_2156460_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2156462_2156663_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_001297578.1|2156662_2157157_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_001297575.1|2157258_2158059_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
WP_001055119.1|2158104_2159157_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001297576.1|2159180_2160017_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_001297574.1|2160171_2161923_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087812.1|2161922_2162969_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001068329.1|2163617_2164115_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|2164154_2164997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211283.1|2165080_2165395_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
WP_001504475.1|2165399_2166359_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_021575710.1|2166435_2169276_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000564234.1|2169272_2169662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985153.1|2169985_2170189_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
WP_000021663.1|2170276_2170390_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
WP_000514277.1|2170386_2170629_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159458.1|2170640_2170919_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
WP_000917803.1|2170929_2171268_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
WP_000163908.1|2171282_2171561_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001781887.1|2171652_2171964_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247211.1|2172052_2172991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_023144639.1|2173023_2173356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|2173463_2173793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954986.1|2174000_2174981_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2173927:2173946	attR	TGCGGCCTTTTTTCTTTCAA	NA	NA	NA	NA
WP_001181565.1|2175072_2175624_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000080607.1|2175623_2176373_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
>prophage 9
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	2263879	2336513	4800835	tail,transposase,plate,capsid,integrase,protease,tRNA	Burkholderia_virus(42.86%)	78	2302411:2302427	2335421:2335437
WP_000168626.1|2263879_2265154_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
WP_000765713.1|2265902_2266508_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100913.1|2266612_2268118_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030324.1|2268718_2269354_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289628.1|2269353_2270046_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920820.1|2270048_2270669_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231887.1|2270672_2271731_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_001092600.1|2273744_2274323_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133179.1|2274322_2274904_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214061.1|2274980_2275421_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217946.1|2275509_2275725_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_031608772.1|2276023_2276149_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_000998242.1|2276356_2277397_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000565566.1|2277470_2278472_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000753325.1|2279177_2280686_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170615.1|2280788_2281964_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066606.1|2282163_2283810_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000259129.1|2283977_2285381_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000092483.1|2285377_2286307_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001681605.1|2286382_2287684_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000928668.1|2287794_2289501_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000824321.1|2289653_2290805_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_001080045.1|2291285_2292017_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524877.1|2292143_2292479_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000412353.1|2292540_2293923_-	amino acid permease	NA	NA	NA	NA	NA
WP_001165548.1|2294203_2294776_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_001057643.1|2295349_2295967_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_024135229.1|2295973_2296450_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.0e-45
WP_000852584.1|2297487_2298066_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_001219103.1|2298058_2299162_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000148263.1|2299555_2300083_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000808000.1|2300079_2301234_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000478221.1|2301221_2301434_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458383.1|2301433_2302318_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000135574.1|2302317_2304783_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
2302411:2302427	attL	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_000110118.1|2305390_2305672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162828734.1|2305674_2306199_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000729859.1|2306195_2307623_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000666498.1|2307612_2307864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271668.1|2308326_2308773_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2308774_2309113_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286905.1|2309122_2310076_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_001273072.1|2310090_2311206_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_000135517.1|2311420_2311879_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117561.1|2311881_2312703_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000090679.1|2312683_2314180_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000124060.1|2315769_2316315_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|2316314_2316626_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2316625_2316952_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264664.1|2316948_2317599_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_001104436.1|2317582_2318311_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000793143.1|2318313_2318664_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_100208317.1|2318907_2319504_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_124682070.1|2319592_2319931_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.1	1.9e-22
WP_000567456.1|2319940_2320105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990529.1|2320108_2321878_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000960673.1|2321888_2323055_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000843446.1|2323057_2323327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2323354_2323885_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000632575.1|2324173_2324446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197790.1|2324455_2324758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2324754_2325138_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_153781233.1|2325145_2325346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2325342_2326026_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000631816.1|2326022_2326253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989166.1|2326242_2326458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315282.1|2326450_2326900_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_001281695.1|2326871_2327261_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000769298.1|2327442_2328387_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001219360.1|2328913_2330443_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014056.1|2330453_2331842_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118268.1|2332016_2333051_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000500278.1|2333467_2333830_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001183821.1|2333816_2334146_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000549642.1|2334180_2335002_-|protease	serine protease	protease	NA	NA	NA	NA
WP_001766314.1|2335270_2335522_-	acid shock protein	NA	NA	NA	NA	NA
2335421:2335437	attR	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_000431187.1|2335915_2336098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2336054_2336513_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	2780540	2858741	4800835	tail,transposase,plate,terminase,holin,head,protease	Salmonella_phage(70.49%)	94	NA	NA
WP_000938184.1|2780540_2781221_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.1	4.1e-80
WP_000502118.1|2781428_2781887_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|2781843_2782026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000374046.1|2782550_2783210_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2783296_2783626_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2783622_2783904_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000502118.1|2784640_2785099_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000140485.1|2786230_2787442_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2787499_2787817_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2787861_2788275_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2788448_2789111_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2789205_2789664_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420526.1|2789699_2791754_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2791877_2792324_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950867.1|2792342_2794496_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202371.1|2794482_2795088_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2795304_2795814_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_010989142.1|2796168_2797221_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877174.1|2797292_2797745_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156455.1|2797930_2799691_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2799759_2800278_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001764860.1|2800377_2800545_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2800798_2801362_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2801358_2802999_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2803003_2804257_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053045.1|2804271_2806179_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086472.1|2806191_2808300_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000224084.1|2808398_2809508_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2809504_2810047_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291724.1|2810212_2811223_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193884.1|2811430_2814043_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000480169.1|2815059_2815761_+	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000421106.1|2816682_2817201_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_001681975.1|2817215_2818727_-	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000049938.1|2818726_2819407_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001197092.1|2819403_2820603_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_001270647.1|2820603_2820957_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001685627.1|2821197_2821953_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001144794.1|2822011_2822440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050472.1|2822439_2823171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826019.1|2823365_2823701_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042301.1|2823697_2824729_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000388505.1|2824731_2825034_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346974.1|2825037_2825688_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000990867.1|2825687_2827640_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000389047.1|2827817_2828270_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000257259.1|2828273_2828714_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_001135544.1|2828725_2829871_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000389379.1|2829874_2830438_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|2830412_2830802_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000008737.1|2830788_2831343_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001125675.1|2831339_2831747_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_001040702.1|2831712_2832081_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|2832122_2833064_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128060.1|2833075_2833573_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873182.1|2833577_2834810_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_138010671.1|2834824_2835562_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000113511.1|2835446_2836916_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_000204794.1|2836915_2838319_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_001118118.1|2838284_2839037_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_001070544.1|2839126_2839354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495544.1|2839450_2839828_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001050879.1|2839870_2840410_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	38.4	2.5e-08
WP_001075998.1|2840406_2841021_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000226307.1|2841020_2841302_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294876.1|2841288_2841678_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000798706.1|2841894_2842344_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2842479_2842605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047634.1|2843003_2843801_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001617856.1|2843790_2843937_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096560.1|2843933_2844545_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_000929790.1|2844753_2845356_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001804676.1|2845395_2845635_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_001217670.1|2845690_2845930_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000963896.1|2846114_2846612_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000509711.1|2846622_2846802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208074.1|2847647_2848220_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000445792.1|2848223_2848697_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2848696_2849221_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2849217_2849565_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2849575_2850325_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001681803.1|2850327_2851311_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_001574095.1|2851395_2851770_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869365.1|2851735_2851972_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001009036.1|2852101_2852506_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000186242.1|2852794_2852995_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995349.1|2853085_2853382_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_001764962.1|2853387_2854173_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000187053.1|2854169_2854850_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_000034527.1|2854927_2855992_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_010989138.1|2855988_2856870_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_001754984.1|2856875_2857115_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000065276.1|2857155_2857404_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262313.1|2857448_2858741_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
>prophage 11
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	2930988	2938300	4800835	integrase,protease	Ralstonia_phage(16.67%)	7	2924735:2924749	2937036:2937050
2924735:2924749	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2930988_2931366_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2931527_2931725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934058.1|2931936_2934213_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_000520789.1|2934243_2934564_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2934887_2935109_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125880.1|2935238_2937185_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2937036:2937050	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|2937181_2938300_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 12
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	3550786	3597427	4800835	tRNA,transposase,plate	Vibrio_phage(16.67%)	41	NA	NA
WP_000118732.1|3550786_3552130_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007105.1|3552133_3552670_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000312802.1|3552736_3553222_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001171575.1|3553458_3553884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147174.1|3553855_3554257_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_000996818.1|3555841_3556384_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175184.1|3556447_3556738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449770.1|3556823_3559487_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.8	9.8e-77
WP_000806676.1|3559854_3560757_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750542.1|3560743_3561568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108006.1|3561564_3562059_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371495.1|3562074_3563958_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145233.1|3563954_3564950_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001670675.1|3566544_3567276_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3567339_3567807_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801233.1|3567803_3568526_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052766.1|3568560_3569316_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3569387_3570755_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207227.1|3570810_3571581_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230964.1|3571658_3572459_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127546.1|3572590_3573766_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648539.1|3573870_3574785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154870.1|3574805_3575609_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_001140158.1|3581394_3581961_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594016.1|3582150_3583182_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
WP_001287483.1|3583174_3583828_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874217.1|3583866_3584682_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3584800_3585205_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093978.1|3585201_3585909_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|3586019_3587738_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000431187.1|3587817_3588000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502118.1|3587956_3588415_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000252574.1|3588522_3589224_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560526.1|3589255_3589678_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3589674_3590220_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_001518678.1|3590417_3590618_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3590604_3590865_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210062.1|3590948_3592241_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901086.1|3592303_3592693_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021059.1|3592748_3594890_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000502118.1|3596968_3597427_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	3982998	3995652	4800835	integrase	Enterobacteria_phage(50.0%)	12	3982457:3982470	3993861:3993874
3982457:3982470	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_000783716.1|3982998_3985332_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	86.5	0.0e+00
WP_000795388.1|3985346_3985667_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|3985663_3985891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|3985887_3986439_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001779443.1|3987234_3987978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468230.1|3987981_3988221_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|3988236_3988803_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|3989078_3990242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700163.1|3990231_3991290_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000573583.1|3991286_3992363_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|3992425_3993691_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|3994161_3995652_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
3993861:3993874	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 14
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	4134616	4213450	4800835	lysis,tail,terminase,plate,portal,capsid,integrase,head	Salmonella_phage(83.33%)	89	4141769:4141784	4214545:4214560
WP_000954536.1|4134616_4135876_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4136186_4137470_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4138450_4139233_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_162009227.1|4139502_4139697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193665.1|4140089_4140311_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4140307_4140769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4141315_4142989_+	hypothetical protein	NA	NA	NA	NA	NA
4141769:4141784	attL	GAAGAAGACTTCTTTG	NA	NA	NA	NA
WP_010989300.1|4143069_4145355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131240.1|4145658_4145910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4145991_4146444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4146623_4147112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4147108_4147402_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4147828_4148842_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4149005_4150595_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4150578_4152090_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001764200.1|4152214_4152403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001210944.1|4152943_4153483_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4153727_4155005_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4155007_4156054_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4156077_4158573_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4158572_4160309_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4160353_4161421_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4161430_4162225_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4162250_4162946_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4162968_4164273_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_050187470.1|4164292_4166263_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
WP_000354257.1|4166564_4167311_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4167310_4168201_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001681810.1|4168211_4168469_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_000027757.1|4169575_4170601_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4170604_4171237_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4171353_4171596_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4171628_4172138_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4172145_4172346_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4172309_4172651_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4172718_4172952_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4172951_4173179_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4173175_4173760_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4173756_4174617_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_000301193.1|4174607_4177016_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
WP_001154438.1|4177183_4177372_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4177383_4177617_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4177712_4177931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4177940_4179005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4179001_4180066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4180085_4180781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4180829_4181873_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4181872_4183639_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4183781_4184615_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4184631_4185696_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4185699_4186350_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4186443_4186908_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4186907_4187111_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4187114_4187330_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4187310_4187820_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4187824_4188202_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_024131238.1|4188198_4188627_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_001039961.1|4188722_4189154_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343944.1|4189146_4189593_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4189661_4190240_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4190236_4190596_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4190582_4191491_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4191483_4192089_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4192085_4193705_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4193711_4194119_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4194316_4195039_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4195252_4195471_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4195573_4196746_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4196755_4197271_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4197325_4197628_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4197642_4197762_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_161976233.1|4197988_4200535_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000980405.1|4200534_4201020_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4201016_4202117_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4202184_4202403_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4202489_4202867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4203086_4204361_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4204492_4204762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|4204861_4205188_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022217.1|4205262_4206162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4206235_4207144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4207215_4209165_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000115421.1|4209253_4209712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|4209789_4210086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|4210082_4210535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046598522.1|4210552_4210762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|4211027_4211408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020123.1|4211503_4211806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907593.1|4212529_4213450_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
4214545:4214560	attR	GAAGAAGACTTCTTTG	NA	NA	NA	NA
>prophage 15
NZ_LT904884	Salmonella enterica subsp. enterica serovar Typhi strain ERL041834 chromosome 1	4800835	4508762	4546819	4800835	lysis,tail,transposase,terminase,plate,portal,capsid,integrase,head	Salmonella_phage(78.57%)	49	4503726:4503740	4515892:4515906
4503726:4503740	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4508762_4510409_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4510548_4510647_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4511272_4512325_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4512513_4512705_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4512720_4513290_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4513415_4513637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4513669_4514179_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4514186_4514483_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4514600_4514942_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4515009_4515243_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4515242_4515470_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4515466_4516324_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4515892:4515906	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4516320_4518735_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4518888_4519077_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4519144_4519444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4519552_4520431_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4521044_4521959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4521955_4522696_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4522730_4523768_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4523767_4525534_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4525676_4526510_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4526526_4527585_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4527588_4528239_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4528334_4528799_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4528798_4529002_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4529005_4529221_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4529201_4529714_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4529715_4530093_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4530089_4530518_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4530613_4531045_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4531037_4531484_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4531552_4532131_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4532127_4532487_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4532473_4533382_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4533374_4533980_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000805568.1|4535489_4536083_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4536054_4536495_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_072075000.1|4536497_4536896_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.5	1.3e-12
WP_000905046.1|4536923_4537490_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4537632_4538805_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4538814_4539330_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4539384_4539687_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4539701_4539821_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|4539813_4542891_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|4542887_4543373_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4543369_4544470_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4544560_4544779_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000431187.1|4546221_4546404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502114.1|4546360_4546819_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
