The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	492960	585316	4653627	plate,protease,lysis,tRNA,integrase,capsid,terminase,portal,tail,head,holin	Escherichia_phage(35.56%)	102	525766:525812	555414:555460
WP_000560975.1|492960_493398_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|493442_494384_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259009.1|494398_494845_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558160.1|494841_495153_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001162859.1|495238_496168_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001523745.1|496372_496615_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000238494.1|496614_496989_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000027727.1|497026_497956_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|497952_498588_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331359.1|498584_499487_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989259.1|499499_502550_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059746.1|502744_503581_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710970.1|503856_504888_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828046.1|505069_506170_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|506835_507495_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989258.1|507577_508144_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|508232_508547_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009255.1|508543_509692_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000211475.1|510702_511962_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143961.1|511958_513428_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|513715_514552_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|514704_515553_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063537.1|515549_516584_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|517202_517886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566798.1|518041_519349_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091409.1|519341_519857_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000122632.1|521186_521807_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559225.1|521876_522566_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133445.1|522577_522973_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|523023_524397_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033727.1|524393_525092_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	6.9e-06
WP_001233466.1|525242_525743_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
525766:525812	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023386.1|525927_526908_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192857.1|526977_527271_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|527423_527696_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001333116.1|527671_527869_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.5	3.6e-29
WP_000217679.1|527865_528366_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557701.1|528429_528654_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277945.1|528653_528953_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	93.9	5.6e-42
WP_001113276.1|528955_529180_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_000027664.1|529176_529452_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_048659689.1|529441_531724_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.3	0.0e+00
WP_016236400.1|531900_532098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556577.1|532094_533201_-	Fic family protein	NA	S4TP71	Salmonella_phage	78.0	7.2e-159
WP_000038161.1|533751_534786_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156853.1|534785_536558_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|536731_537586_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248583.1|537644_538718_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_016239051.1|538721_539465_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_000988633.1|539564_540074_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001773438.1|540073_540277_+|tail	tail protein X	tail	A0A0F7LCK1	Escherichia_phage	98.5	8.8e-31
WP_000123124.1|540280_540562_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144098.1|540561_541059_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_000736558.1|541073_541499_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	97.2	2.3e-60
WP_000040653.1|541486_541912_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	2.7e-66
WP_000917182.1|542019_542487_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001771.1|542479_542932_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	1.0e-74
WP_001093738.1|542998_543634_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.9e-113
WP_000127160.1|543630_543978_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
WP_001121475.1|543982_544891_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_001000067.1|544883_545414_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	97.7	9.5e-101
WP_000104690.1|545424_547242_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	61.4	8.9e-122
WP_001761804.1|547241_547820_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.0	1.5e-67
WP_001286727.1|547948_549139_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|549151_549670_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|549726_550002_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|550034_550154_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069969.1|550146_552594_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.4	0.0e+00
WP_000978916.1|552608_553088_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_000882956.1|553087_554251_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	4.1e-205
WP_000468308.1|554331_554550_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|554818_555331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077323.1|555538_556435_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
555414:555460	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|556619_557582_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_050159237.1|557785_558775_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750765.1|558875_559631_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000646490.1|561241_562201_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557877.1|562210_563251_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001764005.1|563313_564036_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061016.1|564133_564304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173084.1|564609_564891_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113082.1|564904_566497_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|566583_567543_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167253.1|567798_569334_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.7e-20
WP_000911130.1|569327_570371_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981827.1|570367_571369_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090739.1|571397_572420_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774152.1|572448_573324_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|573406_573697_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088043.1|573706_574471_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001216342.1|574562_575330_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|575442_576039_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|576139_576568_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796307.1|576674_577421_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|577517_578528_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000137244.1|578639_580145_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084284.1|580165_581011_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051368.1|581409_581649_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|581870_582356_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139635.1|582448_583378_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293355.1|583444_584776_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.5	6.4e-45
WP_000208240.1|584785_585316_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	917455	953567	4653627	transposase,protease,tRNA,integrase,bacteriocin	Acinetobacter_phage(33.33%)	39	907088:907102	940845:940859
907088:907102	attL	CCATGCCAGCATCAA	NA	NA	NA	NA
WP_000421096.1|917455_917734_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|917976_918243_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|918239_918557_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014341481.1|919677_920022_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001681938.1|920206_920491_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|920832_921540_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|924150_925407_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|925623_926709_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|926821_927097_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|927124_928177_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|928331_929051_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|929050_929377_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|929426_930146_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|930268_930727_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|931045_932092_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|932224_933232_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|933322_934459_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|934451_935045_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|935052_935343_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|935339_935906_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|935924_936629_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|936646_937627_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|937756_938443_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|938489_938906_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|938905_939469_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|939684_940632_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|940651_941383_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
940845:940859	attR	TTGATGCTGGCATGG	NA	NA	NA	NA
WP_000286121.1|941459_942167_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|942262_942760_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|942838_944233_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062140.1|944725_945880_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|945935_946235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905074.1|946231_946396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|946529_946661_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|946669_948646_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|948873_949794_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|949894_950653_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|950928_952920_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|953108_953567_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	1226579	1292570	4653627	tRNA,tail	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1226579_1229210_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1229444_1229630_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1231028_1231595_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1231591_1232017_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1232093_1233650_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1233799_1234315_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1234660_1236031_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187289.1|1236079_1237618_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1237634_1238807_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1238933_1239464_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1239960_1241145_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1241309_1242305_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1242374_1243439_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1244987_1245947_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1245957_1248102_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1248074_1248485_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1248481_1248727_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209805.1|1248998_1249430_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1250936_1251263_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1251424_1251775_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1251809_1252259_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1252957_1253359_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1253707_1254235_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1254244_1254544_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1254726_1254885_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1255455_1256133_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531291.1|1256174_1257575_-	GABA permease	NA	NA	NA	NA	NA
WP_001095643.1|1257704_1258988_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1259002_1260451_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1260472_1261741_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993092.1|1261766_1262744_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1263046_1264561_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1264571_1265006_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1265017_1265827_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1265981_1266656_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1266642_1268058_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1268298_1269204_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1269925_1270822_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1271115_1272045_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1272561_1273614_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1274635_1276816_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1276875_1277793_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1277824_1279069_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1279178_1282835_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1282915_1284031_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000905046.1|1284714_1285281_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1285423_1286596_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1286605_1287121_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1287175_1287478_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1287492_1287612_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|1287604_1290682_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|1290678_1291164_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1291160_1292261_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1292351_1292570_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 4
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	1978771	1986083	4653627	integrase,protease	Dickeya_phage(16.67%)	7	1980022:1980036	1991201:1991215
WP_001201759.1|1978771_1979890_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|1979886_1981833_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1980022:1980036	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1981962_1982184_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1982507_1982828_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|1982858_1985135_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|1985346_1985544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1985705_1986083_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1991201:1991215	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 5
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	2055046	2097105	4653627	plate,terminase,tail,head,holin	Salmonella_phage(77.78%)	61	NA	NA
WP_001262313.1|2055046_2056339_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|2056383_2056632_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|2056672_2056912_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|2056917_2057799_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|2057795_2058860_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|2058937_2059618_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|2059614_2060400_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|2060405_2060702_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|2060792_2060993_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|2061281_2061686_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|2061815_2062052_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|2062017_2062392_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|2062476_2063460_+	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|2063462_2064212_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|2064222_2064570_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|2064566_2065091_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|2065090_2065564_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|2065567_2066140_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|2066985_2067165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|2067175_2067673_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|2067857_2068097_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|2068431_2069034_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|2069242_2069854_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|2069850_2069997_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|2069986_2070784_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|2071182_2071308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|2071443_2071893_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|2072109_2072499_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|2072485_2072767_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|2072766_2073381_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_001050879.1|2073377_2073917_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	38.4	2.5e-08
WP_000495544.1|2073959_2074337_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|2074433_2074661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|2074750_2075503_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|2075468_2076872_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|2076871_2078341_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|2078225_2078963_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|2078977_2080210_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|2080214_2080712_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|2080723_2081665_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|2081706_2082075_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|2082040_2082448_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|2082444_2082999_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|2082985_2083375_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|2083349_2083913_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|2083916_2085062_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|2085073_2085514_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|2085517_2085970_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|2086147_2088100_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|2088099_2088750_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|2088753_2089056_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|2089058_2090090_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|2090086_2090422_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|2090616_2091348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|2091347_2091776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|2091834_2092590_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001270647.1|2092830_2093184_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|2093184_2094384_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|2094380_2095061_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|2095060_2096572_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|2096586_2097105_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
>prophage 6
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	2577283	2650397	4653627	transposase,plate,protease,tRNA,capsid,tail	Burkholderia_virus(40.0%)	86	NA	NA
WP_000502119.1|2577283_2577742_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|2577698_2577881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048659080.1|2578274_2578526_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|2578794_2579616_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2579650_2579980_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2579966_2580329_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118268.1|2580745_2581780_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2581954_2583343_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2583353_2584883_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2585409_2586354_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2586535_2586925_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_001315282.1|2586896_2587346_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_010989166.1|2587338_2587554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2587543_2587774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2587770_2588454_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_153781233.1|2588450_2588651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2588658_2589042_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2589038_2589341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2589350_2589623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2589911_2590442_-	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2590469_2590739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2590741_2591908_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000567463.1|2593691_2593856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001765083.1|2593865_2594297_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
WP_100208317.1|2594292_2594889_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2595132_2595483_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2595485_2596214_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2596197_2596848_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2596844_2597171_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2597170_2597482_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2597481_2598027_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_170825686.1|2598077_2599619_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000090679.1|2599618_2601115_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2601095_2601917_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2601919_2602378_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2602592_2603708_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2603722_2604676_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|2604685_2605024_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2605025_2605472_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2605471_2605936_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666498.1|2605935_2606187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2606176_2607604_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_162828734.1|2607600_2608125_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000110118.1|2608127_2608409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2608506_2608842_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2608786_2608924_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2609017_2611483_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2611482_2612367_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000478221.1|2612366_2612579_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2612566_2613721_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2613717_2614245_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2614301_2614649_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2614639_2615743_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2615735_2616314_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_072074997.1|2616316_2617312_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	55.5	3.9e-63
WP_001057643.1|2617311_2617929_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_024131174.1|2617935_2618412_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_024135352.1|2618422_2618884_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	53.9	4.5e-38
WP_024131175.1|2618894_2619428_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.8	2.8e-44
WP_001165548.1|2619499_2620072_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2620352_2621735_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2621796_2622132_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2622258_2622990_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000824321.1|2623470_2624622_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2624774_2626481_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|2626591_2627893_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2627968_2628898_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2628894_2630298_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2630465_2632112_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2632311_2633487_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2633589_2635098_+	YdgA family protein	NA	NA	NA	NA	NA
WP_000565566.1|2635803_2636805_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_000998242.1|2636878_2637919_-	oxidoreductase	NA	NA	NA	NA	NA
WP_031608772.1|2638126_2638252_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2638550_2638766_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2638854_2639295_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2639371_2639953_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2639952_2640531_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2640523_2642545_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2642545_2643604_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2643607_2644228_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2644230_2644923_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2644922_2645558_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2646158_2647664_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2647768_2648374_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2649122_2650397_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 7
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	2831435	2835847	4653627		Escherichia_phage(50.0%)	6	NA	NA
WP_000497451.1|2831435_2831675_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001529135.1|2832547_2833357_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2833429_2833807_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2833954_2834497_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2834688_2835417_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2835433_2835847_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 8
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	3039769	3047003	4653627		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|3039769_3041200_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|3041273_3041969_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|3042048_3042360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|3043010_3044195_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|3044455_3044644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|3044654_3044867_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|3045312_3046581_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|3046583_3047003_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 9
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	3130745	3141252	4653627		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|3130745_3132059_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|3132085_3133165_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|3133169_3133943_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|3133958_3134933_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|3134938_3135490_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|3135490_3136369_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|3136416_3137316_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|3137315_3138401_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3138777_3139671_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3139848_3141252_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 10
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	3217144	3226315	4653627	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3217144_3219178_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3219418_3219877_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3220048_3220579_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3220635_3221103_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3221149_3221869_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3221865_3223551_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3223773_3224505_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3224564_3224672_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3224652_3225384_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3225367_3226315_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 11
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	3460824	3466855	4653627		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3460824_3461766_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3463008_3463398_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3463366_3463621_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|3463637_3465560_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|3466549_3466693_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3466708_3466855_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 12
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	4120449	4133103	4653627	integrase	Enterobacteria_phage(50.0%)	12	4119908:4119921	4131312:4131325
4119908:4119921	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_000783716.1|4120449_4122783_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	86.5	0.0e+00
WP_000795388.1|4122797_4123118_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|4123114_4123342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|4123338_4123890_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001779443.1|4124685_4125429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468230.1|4125432_4125672_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|4125687_4126254_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|4126529_4127693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700163.1|4127682_4128741_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000573583.1|4128737_4129814_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|4129876_4131142_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4131612_4133103_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4131312:4131325	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 13
NZ_LT904877	Salmonella enterica subsp. enterica serovar Typhi strain SGB92 chromosome 1	4653627	4510465	4548523	4653627	transposase,plate,lysis,integrase,capsid,terminase,portal,tail,head	Salmonella_phage(78.57%)	48	4505430:4505444	4517595:4517609
4505430:4505444	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012546.1|4510465_4512112_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.5e-64
WP_001311244.1|4512251_4512350_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4512975_4514028_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4514216_4514408_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4514423_4514993_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4515118_4515340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4515372_4515882_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4515889_4516186_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4516303_4516645_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4516712_4516946_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4516945_4517173_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4517169_4518027_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4517595:4517609	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4518023_4520438_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4520591_4520780_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4520847_4521147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4521255_4522134_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4522747_4523662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4523658_4524399_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4524433_4525471_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4525470_4527237_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4527379_4528213_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4528229_4529288_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4529291_4529942_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4530037_4530502_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4530501_4530705_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4530708_4530924_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4530904_4531417_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4531418_4531796_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4531792_4532221_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4532316_4532748_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4532740_4533187_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4533255_4533834_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4533830_4534190_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4534176_4535085_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4535077_4535683_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|4535679_4537194_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|4537193_4537787_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4537758_4538199_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_000905027.1|4538627_4539194_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4539336_4540509_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4540518_4541034_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4541088_4541391_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4541405_4541525_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|4541517_4544595_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|4544591_4545077_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4545073_4546174_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4546264_4546483_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502114.1|4548064_4548523_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
