The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	990994	1034697	4786155	protease,bacteriocin,transposase,tRNA	Acinetobacter_phage(25.0%)	48	NA	NA
WP_000421096.1|990994_991273_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|991515_991782_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|991778_992096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525158.1|993216_993396_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001681938.1|993745_994030_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|994371_995079_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|997689_998946_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|999162_1000248_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|1000360_1000636_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|1000663_1001716_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|1001870_1002590_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|1002589_1002916_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|1002965_1003685_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|1003807_1004266_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|1004584_1005631_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|1005763_1006771_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|1006861_1007998_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|1007990_1008584_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|1008591_1008882_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|1008878_1009445_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|1009463_1010168_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|1010185_1011166_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|1011295_1011982_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|1012028_1012445_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_162778977.1|1012444_1013080_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|1013223_1014171_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|1014190_1014922_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286121.1|1014998_1015706_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|1015801_1016299_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|1016377_1017772_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062140.1|1018264_1019419_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|1019474_1019774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905074.1|1019770_1019935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|1020068_1020200_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|1020208_1022185_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|1022412_1023333_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|1023433_1024192_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|1024467_1026459_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|1026647_1027106_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000956919.1|1027210_1027867_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_001775599.1|1027860_1028538_-	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000553254.1|1028525_1029233_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124001.1|1029233_1029812_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000218564.1|1029837_1030263_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218338.1|1030636_1031683_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000111274.1|1031704_1032868_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034386.1|1032969_1034049_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001204111.1|1034238_1034697_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	1300881	1438541	4786155	plate,tail,transposase,tRNA	Salmonella_phage(25.81%)	103	NA	NA
WP_000047238.1|1300881_1303512_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1303746_1303932_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1305330_1305897_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1305893_1306319_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1306395_1307952_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1308101_1308617_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1308962_1310333_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187289.1|1310381_1311920_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1311936_1313109_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1313235_1313766_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1314262_1315447_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1315611_1316607_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1316676_1317741_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1319287_1320247_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1320257_1322402_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1322374_1322785_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1322781_1323027_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209805.1|1323298_1323730_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1325236_1325563_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1325724_1326075_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1326109_1326559_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1327258_1327660_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1328008_1328536_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1328545_1328845_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1329027_1329186_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1329756_1330434_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001095643.1|1332005_1333289_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1333303_1334752_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1334773_1336042_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993092.1|1336067_1337045_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1337347_1338862_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1338872_1339307_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1339318_1340128_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1340282_1340957_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1340943_1342359_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1342599_1343505_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1344226_1345123_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1345416_1346346_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1346862_1347915_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1348936_1351117_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1351176_1352094_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1352125_1353370_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1353479_1357136_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1357216_1358332_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000905046.1|1359015_1359582_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1359724_1360897_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1360906_1361422_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1361476_1361779_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1361793_1361913_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|1361905_1364983_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|1364979_1365465_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1365461_1366562_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1366652_1366871_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000151542.1|1367274_1368048_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001067855.1|1369544_1370249_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|1371004_1371856_+	replication protein	NA	NA	NA	NA	NA
WP_024261901.1|1373037_1373841_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1373840_1374677_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|1374737_1375442_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1375488_1375890_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|1376039_1376900_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|1377399_1378104_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094573231.1|1378468_1380655_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533850.1|1380620_1382030_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001518569.1|1393585_1394068_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1394217_1394694_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1394683_1394974_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1395139_1395478_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880973.1|1395626_1397288_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1397373_1398252_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001682111.1|1399045_1399603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1399723_1401010_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1401029_1401821_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1401986_1403348_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1403691_1403940_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1403958_1404507_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469802.1|1404551_1405319_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1405359_1405707_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030993.1|1405863_1407084_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_001212373.1|1407076_1407595_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1408034_1409105_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1409114_1410236_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210976.1|1410293_1411202_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200079.1|1411162_1412323_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1412422_1412470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1412573_1412912_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197667.1|1413183_1413921_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1414052_1415033_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992642.1|1415029_1415761_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1415890_1418464_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000154870.1|1424496_1425300_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_000648539.1|1425320_1426235_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127546.1|1426339_1427515_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230964.1|1427646_1428447_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207227.1|1428524_1429295_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|1429350_1430718_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052766.1|1430789_1431545_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801233.1|1431579_1432302_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|1432298_1432766_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|1432829_1433561_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000145233.1|1435155_1436151_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371495.1|1436147_1438031_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108006.1|1438046_1438541_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	2061965	2069277	4786155	protease,integrase	Dickeya_phage(16.67%)	7	2063216:2063230	2074395:2074409
WP_001201759.1|2061965_2063084_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|2063080_2065027_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2063216:2063230	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|2065156_2065378_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2065701_2066022_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|2066052_2068329_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|2068540_2068738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2068899_2069277_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2074395:2074409	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	2140415	2214515	4786155	terminase,holin,tail,integrase,head,protease,transposase	Salmonella_phage(73.68%)	86	2122481:2122500	2193088:2193107
2122481:2122500	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|2140415_2141708_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|2141752_2142001_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|2142041_2142281_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|2142286_2143168_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|2143164_2144229_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|2144306_2144987_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|2144983_2145769_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|2145774_2146071_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|2146161_2146362_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|2146650_2147055_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|2147184_2147421_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|2147386_2147761_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|2147845_2148829_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|2148831_2149581_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|2149591_2149939_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|2149935_2150460_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|2150459_2150933_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|2150936_2151509_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|2152354_2152534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|2152544_2153042_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|2153226_2153466_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|2153800_2154403_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|2154611_2155223_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|2155219_2155366_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|2155355_2156153_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|2156551_2156677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|2156812_2157262_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|2157478_2157868_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|2157854_2158136_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|2158135_2158750_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000495544.1|2159327_2159705_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|2159801_2160029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|2160118_2160871_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|2160836_2162240_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|2162239_2163709_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|2163593_2164331_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|2164345_2165578_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|2165582_2166080_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|2166091_2167033_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|2167074_2167443_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|2167408_2167816_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|2167812_2168367_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|2168353_2168743_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|2168717_2169281_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|2169284_2170430_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|2170441_2170882_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|2170885_2171338_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|2171515_2173468_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|2173467_2174118_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|2174121_2174424_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|2174426_2175458_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|2175454_2175790_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|2175984_2176716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|2176715_2177144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|2177202_2177958_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001270647.1|2178198_2178552_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|2178552_2179752_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|2179748_2180429_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|2180428_2181940_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|2181954_2182473_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|2183394_2184096_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000193884.1|2185112_2187725_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|2187932_2188943_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2189108_2189651_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|2189647_2190757_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|2190855_2192964_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|2192976_2194884_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2193088:2193107	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|2194898_2196152_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|2196156_2197797_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2197793_2198357_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|2198610_2198778_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2198877_2199396_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|2199464_2201225_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|2201410_2201863_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|2201934_2202987_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2203341_2203851_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|2204067_2204673_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|2204659_2206813_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2206831_2207278_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|2207401_2209456_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|2209491_2209950_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2210044_2210707_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2210880_2211294_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2211338_2211656_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|2211713_2212925_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502118.1|2214056_2214515_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	2661883	2734925	4786155	tail,integrase,plate,protease,tRNA,transposase,capsid	Burkholderia_virus(39.02%)	88	2652213:2652228	2707530:2707545
2652213:2652228	attL	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000502118.1|2661883_2662342_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|2662298_2662481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001766314.1|2662874_2663126_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|2663394_2664216_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2664250_2664580_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2664566_2664929_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118268.1|2665345_2666380_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2666554_2667943_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2667953_2669483_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2670009_2670954_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2671135_2671525_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|2671496_2671949_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|2671938_2672154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2672143_2672374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2672370_2673054_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000132655.1|2673050_2673266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2673258_2673642_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2673638_2673941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2673950_2674223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2674511_2675042_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2675069_2675339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2675341_2676508_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|2676518_2678288_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_001765083.1|2678465_2678897_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
WP_100208317.1|2678892_2679489_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2679732_2680083_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2680085_2680814_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2680797_2681448_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2681444_2681771_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2681770_2682082_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2682081_2682627_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_029246253.1|2682686_2684219_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000090679.1|2684218_2685715_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2685695_2686517_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2686519_2686978_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2687192_2688308_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2688322_2689276_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|2689285_2689624_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2689625_2690072_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2690071_2690536_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_001789770.1|2690532_2690787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2690776_2692204_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000034292.1|2692203_2692725_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110118.1|2692727_2693009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2693106_2693442_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2693386_2693524_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2693617_2696083_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2696082_2696967_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_010989167.1|2696963_2697179_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2697166_2698321_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2698317_2698845_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2698901_2699249_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2699239_2700343_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2700335_2700914_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_000002041.1|2700916_2701885_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	54.8	2.2e-63
WP_001057643.1|2701891_2702509_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_001802272.1|2702508_2703012_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_061388630.1|2703022_2703484_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	54.5	1.2e-38
WP_050151660.1|2703494_2703956_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	54.5	9.0e-39
WP_001165548.1|2704027_2704600_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2704880_2706263_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2706324_2706660_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2706786_2707518_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000924582.1|2707582_2707882_-	hypothetical protein	NA	NA	NA	NA	NA
2707530:2707545	attR	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000824321.1|2707998_2709150_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2709302_2711009_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|2711119_2712421_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2712496_2713426_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2713422_2714826_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2714993_2716640_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2716839_2718015_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2718117_2719626_+	YdgA family protein	NA	NA	NA	NA	NA
WP_077949083.1|2719746_2719965_+	PTS maltose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000565566.1|2720331_2721333_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_000998242.1|2721406_2722447_-	oxidoreductase	NA	NA	NA	NA	NA
WP_031608772.1|2722654_2722780_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2723078_2723294_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2723382_2723823_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2723899_2724481_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2724480_2725059_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2725051_2727073_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2727073_2728132_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2728135_2728756_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2728758_2729451_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2729450_2730086_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2730686_2732192_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2732296_2732902_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2733650_2734925_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 6
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	2917300	2921712	4786155		Escherichia_phage(50.0%)	7	NA	NA
WP_000497459.1|2917300_2917540_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
WP_001036668.1|2917751_2917916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2918412_2919222_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2919294_2919672_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2919819_2920362_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2920553_2921282_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2921298_2921712_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 7
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	3125565	3132799	4786155		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|3125565_3126996_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|3127069_3127765_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|3127844_3128156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|3128806_3129991_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|3130251_3130440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|3130450_3130663_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|3131108_3132377_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|3132379_3132799_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	3239099	3249606	4786155		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|3239099_3240413_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|3240439_3241519_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|3241523_3242297_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|3242312_3243287_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|3243292_3243844_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|3243844_3244723_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|3244770_3245670_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|3245669_3246755_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3247131_3248025_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3248202_3249606_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 9
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	3325497	3334668	4786155	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3325497_3327531_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3327771_3328230_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3328401_3328932_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3328988_3329456_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3329502_3330222_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3330218_3331904_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3332126_3332858_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3332917_3333025_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3333005_3333737_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3333720_3334668_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 10
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	3569177	3575208	4786155		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3569177_3570119_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3571361_3571751_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3571719_3571974_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|3571990_3573913_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|3574902_3575046_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3575061_3575208_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 11
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	4231489	4241254	4786155	integrase	Enterobacteria_phage(50.0%)	11	4228060:4228073	4239463:4239476
4228060:4228073	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_015701354.1|4231489_4232041_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556589.1|4231973_4232297_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
WP_071525138.1|4232368_4232554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082774.1|4232770_4233580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468230.1|4233583_4233823_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|4233838_4234405_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|4234680_4235844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700163.1|4235833_4236892_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000573583.1|4236888_4237965_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|4238027_4239293_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4239763_4241254_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4239463:4239476	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 12
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	4380217	4464403	4786155	lysis,terminase,portal,tail,integrase,plate,head,transposase,capsid	Salmonella_phage(78.43%)	92	4410555:4410570	4433558:4433573
WP_000954536.1|4380217_4381477_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4381787_4383071_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4384051_4384834_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_162009227.1|4385103_4385298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193665.1|4385690_4385912_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4385908_4386370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4386916_4388590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989300.1|4388670_4390956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905294.1|4391247_4391511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4391592_4392045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4392224_4392713_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4392709_4393003_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4393429_4394443_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4394606_4396196_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4396179_4397691_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4398544_4399084_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4399328_4400606_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4400608_4401655_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4401678_4404174_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4404173_4405910_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4405954_4407022_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4407031_4407826_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4407851_4408547_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4408569_4409874_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4409893_4411864_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
4410555:4410570	attL	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_000354257.1|4412165_4412912_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4412911_4413802_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681810.1|4413812_4414070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902197.1|4414716_4415070_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
WP_000027757.1|4415176_4416202_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4416205_4416838_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4416954_4417197_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4417229_4417739_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4417746_4417947_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4417910_4418252_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4418319_4418553_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4418552_4418780_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4418776_4419361_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4419357_4420218_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001154438.1|4422771_4422960_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4422971_4423205_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4423300_4423519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4423528_4424593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4424589_4425654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4425673_4426369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4426417_4427461_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4427460_4429227_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4429369_4430203_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4430219_4431284_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4431287_4431938_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4432031_4432496_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4432495_4432699_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4432702_4432918_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4432898_4433408_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4433412_4433790_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
4433558:4433573	attR	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_024131238.1|4433786_4434215_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_001039966.1|4434310_4434742_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_000343944.1|4434734_4435181_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4435249_4435828_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4435824_4436184_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4436170_4437079_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4437071_4437677_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4437673_4439293_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4439299_4439707_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4439904_4440627_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4440840_4441059_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4441161_4442334_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4442343_4442859_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4442913_4443216_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4443230_4443350_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_161976233.1|4443576_4446123_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000980405.1|4446122_4446608_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4446604_4447705_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4447772_4447991_+	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4448077_4448455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4448674_4449949_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4450080_4450350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|4450449_4450776_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022216.1|4450850_4451750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4451823_4452732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4452803_4454753_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000115421.1|4454841_4455300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|4455377_4455674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|4455670_4456123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018145.1|4456140_4456350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|4456720_4457101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020123.1|4457196_4457499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907593.1|4458222_4459143_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010989295.1|4460408_4460951_+	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_000502502.1|4461161_4461803_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	1.1e-55
WP_001283066.1|4461787_4463035_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	6.0e-61
WP_001339197.1|4463194_4464403_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 13
NZ_LT904869	Salmonella enterica subsp. enterica serovar Typhi strain ERL052042 chromosome 1	4786155	4756729	4785896	4786155	lysis,terminase,portal,tail,integrase,plate,head,transposase,capsid	Salmonella_phage(76.47%)	39	4751693:4751707	4763859:4763873
4751693:4751707	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4756729_4758376_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4758515_4758614_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4759239_4760292_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4760480_4760672_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4760687_4761257_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4761382_4761604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4761636_4762146_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4762153_4762450_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4762567_4762909_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4762976_4763210_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4763209_4763437_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4763433_4764291_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4763859:4763873	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4764287_4766702_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4766855_4767044_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4767111_4767411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4767519_4768398_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4769011_4769926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4769922_4770663_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4770697_4771735_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4771734_4773501_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4773643_4774477_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4774493_4775552_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4775555_4776206_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4776301_4776766_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4776765_4776969_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4776972_4777188_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4777168_4777681_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4777682_4778060_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4778056_4778485_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4778580_4779012_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4779004_4779451_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4779519_4780098_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4780094_4780454_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4780440_4781349_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4781341_4781947_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|4781943_4783458_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|4783457_4784051_+|tail	tail assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4784022_4784463_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_001339197.1|4784687_4785896_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
