The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	6736	13548	4171754	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_004258844.1|6736_9010_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.9e-169
WP_004258840.1|9010_9319_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.1	2.0e-13
WP_002924494.1|9710_9914_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	77.3	9.8e-22
WP_004258834.1|10067_10235_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004258827.1|10260_10497_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004258823.1|10619_11297_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_048708553.1|11388_12585_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.8	2.8e-39
WP_004258817.1|12658_13108_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.3	9.7e-46
WP_048708554.1|13107_13548_+	NUDIX domain-containing protein	NA	A0A1L2CUR5	Pectobacterium_phage	38.8	6.7e-07
>prophage 2
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	195446	203115	4171754	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_048708703.1|195446_196478_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.3	2.2e-29
WP_048708705.1|196539_198930_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_082794216.1|198931_199240_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.8e-12
WP_048708707.1|199220_199601_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004259550.1|199876_200620_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.1	2.2e-71
WP_156480749.1|200649_201270_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.5	4.6e-30
WP_048708708.1|201284_202169_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	38.2	4.3e-13
WP_048708710.1|202179_203115_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.3	4.8e-31
>prophage 3
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	297594	304554	4171754		Acidithiobacillus_phage(50.0%)	9	NA	NA
WP_004292452.1|297594_298470_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.6	2.1e-36
WP_004292454.1|298480_298972_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.1	1.6e-17
WP_048708798.1|298982_300137_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_048710445.1|300147_301200_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	39.9	2.4e-47
WP_048708800.1|301643_301985_+	addiction module protein	NA	NA	NA	NA	NA
WP_048708802.1|301986_302307_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_169800071.1|302309_302729_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	53.2	6.7e-33
WP_048708805.1|302758_304099_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	56.6	8.8e-135
WP_048708807.1|304095_304554_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	53.1	1.2e-38
>prophage 4
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	731840	798455	4171754	tail,plate,transposase,tRNA,integrase	Bacillus_phage(10.53%)	69	735640:735657	783946:783963
WP_048709258.1|731840_734648_-|plate	baseplate J/gp47 family protein	plate	J9PV89	Bacillus_phage	33.5	2.3e-15
WP_048709260.1|734647_737218_-|plate	putative baseplate assembly protein	plate	A0A1Q1PVP2	Phage_DP-2017a	36.2	3.9e-06
735640:735657	attL	GTGCATCGAGGTCGAACG	NA	NA	NA	NA
WP_004252131.1|737214_737583_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_048709262.1|737585_737906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709263.1|737992_738502_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_048709265.1|738498_739638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709266.1|739630_739993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709268.1|739989_740643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709269.1|740639_741341_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_169800050.1|741337_741754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709273.1|741765_742941_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_156480634.1|742937_743189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709277.1|743197_745135_-	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	32.0	4.5e-07
WP_048709279.1|745131_746442_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_156480635.1|746438_746762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053085861.1|747238_747946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048709282.1|747954_748479_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_048709284.1|748491_750051_-|tail	phage tail sheath family protein	tail	H8ZNA4	Synechococcus_phage	27.7	6.0e-10
WP_169800051.1|750477_751620_+	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	39.2	3.9e-06
WP_000186237.1|751843_752476_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_003159191.1|752570_753125_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_082794382.1|753244_753709_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.2	4.0e-10
WP_048705947.1|753667_754702_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	36.4	9.4e-60
WP_000845048.1|754975_755989_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004265658.1|756172_756793_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	30.1	1.9e-07
WP_048709291.1|757274_758498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048709293.1|758494_758983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048709294.1|758979_760926_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_156480636.1|761017_761707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480637.1|761977_762484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048710560.1|762670_763189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480755.1|763452_764523_-	class C beta-lactamase	NA	NA	NA	NA	NA
WP_013521165.1|764833_765118_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_011342941.1|765114_765393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001470697.1|766154_766808_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_001747814.1|767034_768567_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001253717.1|768658_769450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|769470_770646_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|770749_771376_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|771372_771555_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|771582_772797_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259026.1|773013_773985_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|773978_774326_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|774489_775281_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_032084014.1|775365_776586_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_048707283.1|776994_778179_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048707287.1|778191_779040_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_048709318.1|779294_779963_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.0	7.5e-26
WP_001389365.1|779934_780699_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_011342941.1|780773_781052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041716419.1|781290_781884_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	2.8e-40
WP_013521167.1|781880_784910_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
783946:783963	attR	CGTTCGACCTCGATGCAC	NA	NA	NA	NA
WP_082794240.1|784878_785235_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004252084.1|785335_785830_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_048709327.1|785826_787032_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004252068.1|787059_787314_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_048709329.1|787317_787800_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_004252063.1|787923_788427_-	phasin family protein	NA	NA	NA	NA	NA
WP_048709332.1|788670_789210_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_082794241.1|789210_790176_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_004252056.1|790188_790806_-	LemA family protein	NA	NA	NA	NA	NA
WP_048709334.1|791073_791403_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_048709335.1|791450_792005_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_169800052.1|792079_793300_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_048709339.1|793348_795034_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.8	5.5e-17
WP_048710587.1|795481_796264_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-28
WP_048709341.1|796272_797136_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	21.4	2.6e-07
WP_048709343.1|797221_797830_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_048710590.1|797990_798455_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.9	4.9e-08
>prophage 5
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1155149	1167846	4171754	terminase	Pseudomonas_phage(44.44%)	14	NA	NA
WP_048709860.1|1155149_1156118_-	hypothetical protein	NA	A0A0U1T6E0	Pseudomonas_phage	34.9	7.5e-27
WP_169800053.1|1156338_1156485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480647.1|1157008_1157602_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_048709863.1|1157598_1157976_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062450055.1|1158681_1160925_-	hypothetical protein	NA	Q5QF74	Pseudomonas_virus	54.6	8.7e-228
WP_048704803.1|1160943_1162218_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	78.4	2.2e-199
WP_156480648.1|1162217_1162850_-	hypothetical protein	NA	L7TIB4	Pseudomonas_virus	34.3	7.1e-18
WP_048704808.1|1162899_1163403_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	53.5	2.4e-32
WP_082794256.1|1163399_1163999_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	51.4	3.7e-32
WP_048704811.1|1164076_1164736_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	52.9	3.3e-58
WP_082794257.1|1164740_1165568_-	YdaU family protein	NA	A0A2H4FS76	Methylophilaceae_phage	41.1	2.3e-16
WP_048704814.1|1165977_1166289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048704816.1|1166378_1166627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169800054.1|1167066_1167846_+	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	39.7	9.1e-07
>prophage 6
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1172659	1179644	4171754		Pseudomonas_phage(50.0%)	7	NA	NA
WP_062450059.1|1172659_1173481_+	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	62.0	3.0e-93
WP_048703854.1|1173494_1173899_+	HNH endonuclease	NA	J7I0T2	Pseudomonas_phage	48.3	1.7e-12
WP_048703857.1|1175174_1175375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703860.1|1175378_1176635_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	34.6	3.0e-44
WP_048703863.1|1176631_1178437_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	34.3	1.3e-67
WP_048703866.1|1178433_1179042_+	hypothetical protein	NA	A0A2I7RQ48	Vibrio_phage	54.8	1.4e-34
WP_048703869.1|1179038_1179644_+	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	48.8	5.0e-45
>prophage 7
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1383709	1396082	4171754	terminase	Pseudomonas_virus(30.0%)	15	NA	NA
WP_048704223.1|1383709_1385005_-	DUF4043 family protein	NA	Q5QF42	Pseudomonas_virus	59.3	8.8e-140
WP_048704225.1|1385025_1385994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048704228.1|1386191_1386557_-	phage family protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	60.7	2.0e-33
WP_062450067.1|1386553_1388803_-	hypothetical protein	NA	Q5QF74	Pseudomonas_virus	54.7	5.1e-228
WP_048704803.1|1388821_1390096_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	78.4	2.2e-199
WP_156480648.1|1390095_1390728_-	hypothetical protein	NA	L7TIB4	Pseudomonas_virus	34.3	7.1e-18
WP_048704808.1|1390777_1391281_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	53.5	2.4e-32
WP_082794256.1|1391277_1391877_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	51.4	3.7e-32
WP_048704811.1|1391954_1392614_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	52.9	3.3e-58
WP_082794257.1|1392618_1393446_-	YdaU family protein	NA	A0A2H4FS76	Methylophilaceae_phage	41.1	2.3e-16
WP_048704814.1|1393855_1394167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048704816.1|1394256_1394505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703119.1|1394725_1395010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062450069.1|1395112_1395346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169800057.1|1395419_1396082_+	helix-turn-helix domain-containing protein	NA	Q6J1N3	Burkholderia_virus	41.3	1.3e-38
>prophage 8
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1399368	1409878	4171754		Pseudomonas_phage(25.0%)	14	NA	NA
WP_048703096.1|1399368_1400190_+	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	62.4	8.7e-93
WP_169800058.1|1400210_1401389_+	recombinase RecT	NA	Q858E1	Salmonella_phage	47.5	3.8e-57
WP_048703093.1|1401408_1401621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703089.1|1401740_1402121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703086.1|1402134_1403070_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	35.4	1.4e-49
WP_062450072.1|1403066_1404872_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	34.8	7.3e-68
WP_048703084.1|1404868_1405474_+	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	48.8	6.5e-45
WP_048703083.1|1405470_1405698_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_082794394.1|1405804_1406197_+	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	50.4	1.5e-21
WP_156480662.1|1406193_1406646_+	hypothetical protein	NA	A0A2H4JEZ6	uncultured_Caudovirales_phage	45.9	8.1e-16
WP_156480663.1|1406695_1407691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703077.1|1407690_1408449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703074.1|1408445_1408970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480664.1|1408966_1409878_+	hypothetical protein	NA	A1YZU8	Burkholderia_virus	46.9	7.1e-11
>prophage 9
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1884468	1909536	4171754	integrase,transposase	Paenibacillus_phage(33.33%)	26	1883759:1883776	1916044:1916061
1883759:1883776	attL	CTGGCGGAGACGGAGGGA	NA	NA	NA	NA
WP_156480675.1|1884468_1885668_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	51.8	3.2e-104
WP_048705349.1|1886570_1886870_-	CcdB family protein	NA	NA	NA	NA	NA
WP_082794283.1|1886869_1887118_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_048705352.1|1887248_1888289_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_048705354.1|1888298_1888571_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_156480676.1|1888632_1888827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082794284.1|1888809_1889217_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	37.0	8.6e-17
WP_048705359.1|1889487_1890957_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_048705361.1|1891045_1893559_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_048705364.1|1893583_1893961_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_048705372.1|1895159_1895969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048705375.1|1896062_1897196_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156480677.1|1897749_1898187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480678.1|1898313_1898967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062450091.1|1899651_1900272_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	31.4	3.2e-07
WP_156480679.1|1900552_1901311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480680.1|1901793_1902573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480681.1|1902841_1903051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048705382.1|1903169_1903433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480682.1|1903469_1903625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048705387.1|1903824_1904019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480683.1|1904523_1905280_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	5.7e-22
WP_156480684.1|1905570_1906008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062450093.1|1906506_1907877_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	1.1e-28
WP_082794286.1|1907957_1908257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480685.1|1908355_1909536_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	1.7e-60
1916044:1916061	attR	CTGGCGGAGACGGAGGGA	NA	NA	NA	NA
>prophage 10
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	1977578	2006335	4171754	terminase,tail,capsid,portal,tRNA,integrase,head	Escherichia_phage(15.38%)	34	1982146:1982161	1999191:1999206
WP_048705507.1|1977578_1978418_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004261564.1|1978514_1978916_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_038011844.1|1979036_1980113_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_004261558.1|1980109_1981192_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004261556.1|1981304_1982804_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.0	2.8e-49
1982146:1982161	attL	AGCCCGCCGCCGAAAT	NA	NA	NA	NA
WP_004261554.1|1982818_1983259_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004261552.1|1983255_1983924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004261550.1|1984034_1987019_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.0	9.1e-124
WP_004261548.1|1987250_1987481_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004261546.1|1987583_1989017_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_048705515.1|1989129_1989621_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_048705517.1|1989740_1990724_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	41.2	5.6e-62
WP_048705519.1|1990845_1991178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048705521.1|1991417_1992431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048705523.1|1993369_1993555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169800062.1|1993837_1994047_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_048705525.1|1994043_1994415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082794292.1|1994528_1994837_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	56.8	2.2e-20
WP_048705528.1|1994833_1995046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082794293.1|1995020_1995341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480688.1|1995337_1995697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480689.1|1995976_1996456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048705538.1|1996452_1997964_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	65.7	5.4e-181
WP_048705540.1|1998043_1999834_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	42.5	4.5e-110
1999191:1999206	attR	AGCCCGCCGCCGAAAT	NA	NA	NA	NA
WP_048709937.1|1999882_2001112_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	45.2	3.9e-89
WP_048705543.1|2001108_2001375_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_082794407.1|2001377_2001704_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	50.5	1.7e-23
WP_048705548.1|2001703_2002117_+	HK97 gp10 family phage protein	NA	A0A1J0GUY2	Halomonas_phage	35.1	3.8e-12
WP_048705551.1|2002113_2002470_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_048705553.1|2002476_2002932_+	hypothetical protein	NA	A0A1V0E8B3	Vibrio_phage	46.5	1.0e-26
WP_048705555.1|2002934_2003237_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_048705561.1|2003532_2005626_+	hypothetical protein	NA	Q9MCU6	Escherichia_phage	25.3	1.9e-19
WP_048705563.1|2005622_2005988_+	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	38.3	2.0e-12
WP_048705565.1|2005990_2006335_+|tail	phage tail protein	tail	D6PEV9	uncultured_phage	41.1	1.4e-12
>prophage 11
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	3234793	3280788	4171754	integrase,transposase	uncultured_virus(33.33%)	47	3255003:3255062	3280789:3280907
WP_156480729.1|3234793_3236521_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_082794343.1|3236522_3237776_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169800067.1|3237806_3237989_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_053085830.1|3238064_3238496_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	47.7	1.7e-07
WP_156480730.1|3238512_3238830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048707257.1|3240348_3240678_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_053085832.1|3240739_3241246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480731.1|3242153_3242867_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_048707261.1|3243193_3243433_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156480732.1|3243964_3245596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480733.1|3245811_3246591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048707270.1|3248028_3248349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048707272.1|3248379_3248646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048707274.1|3248645_3249068_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_048707276.1|3249970_3250225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048707278.1|3250342_3250795_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_048707280.1|3250899_3251589_+	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	40.2	2.9e-33
WP_082794347.1|3252002_3252563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048707283.1|3252956_3254141_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048707287.1|3254153_3255002_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3255003:3255062	attL	GACACTTCTCCTTGAACGCGGGGACATCCCCGGTTTCAAGGTAGGTCGTCGTCGCAGACG	NA	NA	NA	NA
WP_031347446.1|3255178_3255481_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_031347445.1|3255551_3256427_+	universal stress protein	NA	NA	NA	NA	NA
WP_002937768.1|3256423_3257314_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002931390.1|3257317_3257803_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_031347444.1|3257878_3260587_-	cation-transporting P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	28.8	3.4e-69
WP_037982496.1|3260799_3261171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002924842.1|3263143_3263779_-	cation transporter	NA	NA	NA	NA	NA
WP_002940122.1|3263882_3264317_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002924845.1|3264426_3264765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002930998.1|3264856_3265333_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_002940125.1|3265329_3265986_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_037982747.1|3265985_3266321_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	59.4	2.2e-26
WP_002940144.1|3266369_3266867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004367291.1|3266989_3267391_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A218MNF3	uncultured_virus	36.2	1.6e-07
WP_037983370.1|3267555_3267942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248730.1|3267983_3271103_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_002924861.1|3271118_3272231_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002924863.1|3272227_3272791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039921668.1|3272808_3274077_-	TolC family protein	NA	NA	NA	NA	NA
WP_082794348.1|3274207_3274558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248732.1|3274691_3275030_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_002924878.1|3275199_3275886_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	4.2e-32
WP_048707302.1|3275888_3277226_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_048707304.1|3277433_3277970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082794349.1|3278074_3278392_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_048707283.1|3278742_3279927_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048707287.1|3279939_3280788_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3280789:3280907	attR	GACACTTCTCCTTGAACGCGGGGACATCCCCGGTTTCAAGGTAGGTCGTCGTCGCAGACGTCATGAAAAACGCGGTGGCGCTTGGGTTCGCGGCCACCGCGTCAGCGGTTTAGTTCAAC	NA	NA	NA	NA
>prophage 12
NZ_CP014646	Thauera humireducens strain SgZ-1 chromosome, complete genome	4171754	3333239	3344167	4171754		Bacillus_phage(33.33%)	6	NA	NA
WP_048707377.1|3333239_3337073_+	exodeoxyribonuclease V subunit beta	NA	S5M596	Bacillus_phage	30.4	1.3e-05
WP_053085837.1|3337069_3339058_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.4	1.9e-21
WP_038012551.1|3339305_3340403_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	8.2e-22
WP_048707378.1|3340478_3341378_+	LOG family protein	NA	A0A1D8KU27	Synechococcus_phage	34.2	2.3e-14
WP_048710231.1|3341381_3342176_-	caspase family protein	NA	A0A1V0SH21	Hokovirus	36.8	1.1e-15
WP_048710233.1|3342475_3344167_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.3	3.6e-16
