The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	487190	544467	4936576	holin,protease,lysis,integrase,tRNA,tail	Enterobacteria_phage(37.04%)	58	526164:526210	547698:547744
WP_001295836.1|487190_487814_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|487784_488471_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_048943163.1|488467_490882_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001157933.1|491592_492687_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|492755_493682_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776385.1|493911_494394_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|494471_495287_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|495376_497158_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943556.1|497170_497947_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|498046_498925_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000006885.1|500607_501969_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_015364437.1|502025_503327_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001299453.1|503348_504494_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	1.8e-48
WP_000540949.1|504721_505507_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001391127.1|505517_506753_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000700769.1|506774_507824_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580861.1|508140_509808_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_048943166.1|509817_511077_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001298986.1|511087_511903_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|511899_512793_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815573.1|512929_513997_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|513993_514503_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212251.1|514620_515343_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|515345_515840_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|516013_517399_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|517434_517956_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|518063_518276_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|518277_519144_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|519614_520157_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|520376_521069_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|523720_524728_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001323731.1|524738_525254_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805432.1|525256_525889_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
526164:526210	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|526223_527387_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433947.1|527242_527614_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	81.9	1.6e-46
WP_000206733.1|527613_527919_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_001242748.1|527918_528281_-	hypothetical protein	NA	U5P092	Shigella_phage	99.2	1.0e-66
WP_000008200.1|528271_528808_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081308.1|528935_529760_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135682.1|529825_530188_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000453587.1|530285_530831_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|531395_531578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|531784_532111_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738425.1|532591_532885_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_001228695.1|532975_533158_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000992107.1|533374_533908_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
WP_000370549.1|534013_534286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|534251_534596_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|534600_534816_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_077790673.1|535909_536974_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.7	3.0e-202
WP_000917724.1|537120_537324_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|537643_538663_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_072310695.1|541472_541592_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	89.7	6.3e-13
WP_000086527.1|541689_542280_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|542655_542889_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|542957_543071_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000239874.1|543436_544105_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|544161_544467_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
547698:547744	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	856402	869568	4936576	tail,integrase	Salmonella_phage(82.35%)	20	849288:849301	876179:876192
849288:849301	attL	TGGTTGGGCAGGCG	NA	NA	NA	NA
WP_000290933.1|856402_857455_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|857641_857833_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|857848_858418_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001247707.1|858543_858765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|858797_859307_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|859314_859515_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|859478_859820_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_048943175.1|859887_860121_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752619.1|860120_860348_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104150.1|860344_861199_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.5	7.5e-148
WP_001420002.1|861204_862026_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_001109970.1|862025_864398_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.2	0.0e+00
WP_001154433.1|864551_864740_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217579.1|864750_864984_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.0e-35
WP_000286099.1|865359_866091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549632.1|866090_866708_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001701630.1|867224_867680_+	hypothetical protein	NA	E5G6Q1	Salmonella_phage	71.0	3.7e-45
WP_000980391.1|867676_868162_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001011758.1|868158_869259_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	3.8e-176
WP_000972391.1|869349_869568_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
876179:876192	attR	TGGTTGGGCAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	1588624	1631000	4936576	portal,terminase,integrase,lysis,tail	Enterobacteria_phage(36.36%)	48	1594787:1594801	1629922:1629936
WP_001613101.1|1588624_1589206_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
WP_071886289.1|1589205_1592736_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_032236520.1|1592800_1593400_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.7e-106
WP_048943199.1|1593467_1596947_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
1594787:1594801	attL	CAATCCGCGACGGCG	NA	NA	NA	NA
WP_000090847.1|1597007_1597610_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_130559428.1|1597546_1598794_-	hypothetical protein	NA	A0A291AWT6	Escherichia_phage	99.3	1.3e-167
WP_077688660.1|1598738_1600319_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	2.4e-288
WP_001072975.1|1600246_1600459_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001700320.1|1600455_1602558_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_000373426.1|1602557_1603052_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_023567552.1|1603623_1604316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700651.1|1604484_1605021_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	1.1e-72
WP_001101168.1|1605017_1605560_-	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_000370545.1|1605665_1605938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192451.1|1605903_1606248_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839561.1|1606252_1606468_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_072162994.1|1606719_1607094_-	tolA family protein	NA	NA	NA	NA	NA
WP_000506934.1|1607265_1607694_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|1608060_1608192_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_023567548.1|1609097_1609919_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	54.0	4.5e-81
WP_000904112.1|1609915_1610290_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_023567547.1|1610302_1611352_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_032140164.1|1611353_1611632_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980999.1|1611698_1611950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1612166_1612379_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001546200.1|1612423_1612531_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_022645725.1|1613393_1614416_-	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001151189.1|1614615_1615017_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000054505.1|1615057_1616023_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_023567544.1|1616003_1616525_-	phage regulatory protein CII	NA	NA	NA	NA	NA
WP_000476993.1|1616508_1616736_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_048943200.1|1616813_1617221_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000379589.1|1617413_1617569_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344950.1|1617570_1618146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1618632_1618821_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|1618817_1619009_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_041520819.1|1619102_1621574_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001296941.1|1621661_1621898_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001459782.1|1621932_1623213_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
WP_001389342.1|1623214_1623343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|1623400_1624420_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1624431_1625646_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1625851_1626178_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1626312_1626654_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1626688_1627249_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1627251_1627962_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1628069_1628375_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1628573_1631000_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
1629922:1629936	attR	CAATCCGCGACGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	2235727	2245169	4936576		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|2235727_2236864_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|2236860_2238861_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2238985_2239447_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2239487_2239958_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2240004_2240724_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2240720_2242406_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2242627_2243359_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2243418_2243526_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2243506_2244238_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2244242_2245169_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 5
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	2314805	2329671	4936576	tail,holin,transposase	Shigella_phage(33.33%)	19	NA	NA
WP_085947917.1|2314805_2316078_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000834400.1|2316257_2318147_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001700849.1|2318400_2318790_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	7.2e-13
WP_001106825.1|2318811_2319252_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	6.2e-53
WP_000994390.1|2319223_2319634_-|tail	phage tail assembly protein	tail	U5P0S4	Shigella_phage	80.3	8.6e-25
WP_000184049.1|2319987_2320377_+	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	65.5	1.7e-38
WP_000522147.1|2320558_2320828_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	5.3e-23
WP_001076627.1|2320835_2321450_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	5.0e-93
WP_000422365.1|2321449_2321731_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	9.7e-20
WP_001283162.1|2321717_2322104_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_000120164.1|2322212_2323007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779379.1|2323216_2323486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|2324876_2325239_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081308.1|2325304_2326129_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000008200.1|2326256_2326793_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242758.1|2326783_2327146_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	95.8	5.8e-65
WP_001096409.1|2327421_2327631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741303.1|2327633_2328836_+	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	30.2	6.2e-31
WP_000561018.1|2328819_2329671_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	36.2	4.6e-36
>prophage 6
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	2502750	2538510	4936576	integrase,head,capsid	Enterobacteria_phage(43.18%)	47	2500724:2500740	2540975:2540991
2500724:2500740	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368131.1|2502750_2503683_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_048943225.1|2503994_2505152_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	4.1e-221
WP_048943226.1|2505243_2507250_-	hypothetical protein	NA	A0A088FRU0	Escherichia_phage	63.1	5.6e-234
WP_001407254.1|2507352_2507640_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085631.1|2507654_2507876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021563791.1|2507875_2508604_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	62.7	8.0e-74
WP_048943227.1|2508691_2509402_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	71.0	8.1e-87
WP_024191015.1|2509391_2509565_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_032149107.1|2509688_2509940_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	71.4	2.8e-10
WP_048943228.1|2510651_2512484_-	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	97.3	2.2e-290
WP_023486185.1|2512480_2513896_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	80.7	1.3e-200
WP_048943229.1|2513906_2514602_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	97.4	3.4e-114
WP_000627636.1|2514604_2515060_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	2.3e-87
WP_033558932.1|2515059_2515761_-	hypothetical protein	NA	G5DA78	Enterobacteria_phage	98.3	2.5e-117
WP_021529423.1|2515760_2516255_-	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	46.0	5.1e-32
WP_048943230.1|2516257_2517676_-	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	98.7	3.9e-274
WP_000246750.1|2517684_2518167_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|2518141_2518327_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_048943231.1|2518369_2519641_-|head	head protein	head	Q716H0	Shigella_phage	99.3	2.8e-239
WP_033803105.1|2519652_2520537_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	99.7	4.0e-144
WP_000566866.1|2521818_2521989_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_016063117.1|2521985_2522168_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_048943232.1|2522164_2522692_-	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	99.4	1.2e-100
WP_039022135.1|2522688_2523111_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	80.7	4.8e-63
WP_048943233.1|2523103_2523331_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	87.1	1.0e-27
WP_021552861.1|2523419_2524856_-	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.8	1.0e-274
WP_016063113.1|2524845_2525745_-	DNA replication protein O	NA	K7PH26	Enterobacteria_phage	100.0	1.2e-164
WP_000166207.1|2525737_2525884_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000424164.1|2525918_2526197_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_000276886.1|2526305_2526491_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2526571_2527222_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_048943234.1|2527827_2528127_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	97.0	4.5e-31
WP_000972063.1|2528529_2528664_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2528648_2528801_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_033803013.1|2529055_2529763_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	1.1e-136
WP_048943236.1|2529763_2530237_+	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	96.8	2.5e-60
WP_001111280.1|2530739_2531036_+	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_001214452.1|2531046_2531211_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_048943237.1|2531207_2531669_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	72.3	4.5e-54
WP_048943238.1|2531665_2531983_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	4.7e-47
WP_048943239.1|2532038_2532710_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	84.7	2.6e-50
WP_048943240.1|2532794_2533079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336413.1|2533056_2533209_+	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_048943241.1|2533427_2533772_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	2.9e-58
WP_001163428.1|2533897_2534098_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001274871.1|2535946_2536861_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2537076_2538510_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2540975:2540991	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	2763113	2856609	4936576	portal,terminase,capsid,integrase,head,lysis,tRNA,transposase,tail,plate	Salmonella_phage(62.5%)	94	2817774:2817789	2851479:2851494
WP_001356308.1|2763113_2763851_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2763982_2765317_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2765525_2766407_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189203.1|2766509_2767097_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2767152_2767536_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2767840_2768530_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2768577_2769615_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2769821_2770241_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|2770309_2771008_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082969.1|2771039_2773700_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2773813_2775169_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|2775193_2775538_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2775534_2776833_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2782696_2785270_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040129.1|2785399_2786131_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|2786127_2787108_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2787242_2787980_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2788250_2788592_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001700969.1|2788695_2788743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200101.1|2788841_2790002_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2790044_2791166_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2791176_2792247_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2792456_2792822_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2792971_2793490_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969010.1|2793479_2794706_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2794721_2795204_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2795279_2795627_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2795668_2796436_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2796466_2797015_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2797033_2797282_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2797418_2798780_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|2798871_2799738_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2799758_2801045_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2801099_2801693_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2801815_2802694_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2802779_2804441_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2804589_2804931_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2804992_2805283_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|2805272_2805749_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2805880_2806363_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000391795.1|2807063_2807546_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
WP_000980501.1|2807572_2807791_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048943246.1|2807859_2808960_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.7e-176
WP_000980413.1|2808956_2809442_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_048943247.1|2809438_2812516_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|2812508_2812628_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2812642_2812945_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2812999_2813515_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_048943248.1|2813524_2814697_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.9e-202
WP_021566195.1|2814839_2815406_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_021579679.1|2815436_2815976_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.0	1.1e-56
WP_021549529.1|2815975_2816578_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	2.4e-100
WP_032349848.1|2816549_2816990_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.9e-44
WP_048943249.1|2816991_2818350_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.3	8.9e-151
2817774:2817789	attL	TGGGGGTTCCGGTAAA	NA	NA	NA	NA
WP_001086836.1|2818346_2818952_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268317.1|2818944_2819853_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_048943250.1|2819839_2820199_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	1.4e-50
WP_000993775.1|2820195_2820774_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829157.1|2820842_2821289_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_001039949.1|2821281_2821713_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
WP_001080916.1|2821808_2822237_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	3.8e-47
WP_000727850.1|2822233_2822611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069905.1|2822612_2823125_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|2823105_2823321_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2823324_2823528_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|2823527_2823992_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|2824087_2824738_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|2824741_2825800_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|2825815_2826649_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098431.1|2826791_2828558_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_048943251.1|2828557_2829589_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	3.1e-172
WP_047662251.1|2829634_2831416_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001217575.1|2831733_2831967_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2831977_2832166_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_048943252.1|2832320_2834735_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_043856316.1|2834731_2835589_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.9e-162
WP_000752619.1|2835585_2835813_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244207.1|2835812_2836046_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	8.3e-33
WP_000996717.1|2836113_2836455_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956191.1|2836572_2836869_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
WP_000460855.1|2836876_2837386_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	93.5	1.9e-82
WP_000102105.1|2837418_2837661_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000052558.1|2837777_2838410_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.6	5.9e-65
WP_000155498.1|2838413_2839454_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_048943253.1|2839443_2840490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062342.1|2840786_2842016_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_000135615.1|2842298_2843855_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
WP_000936465.1|2843844_2844741_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000614783.1|2844737_2845634_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000101606.1|2847230_2848778_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.6	4.2e-48
WP_001356249.1|2848774_2849968_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.7	5.4e-19
WP_001096907.1|2850026_2853266_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.5	3.7e-62
2851479:2851494	attR	TTTACCGGAACCCCCA	NA	NA	NA	NA
WP_001356251.1|2854495_2855365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2855335_2856609_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 8
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	2929445	2942628	4936576		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2929445_2932007_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2932112_2932769_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272549.1|2932819_2933617_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|2933782_2934691_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2934687_2935950_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2935946_2936585_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2936589_2937366_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|2937454_2938819_+	GntP family transporter	NA	NA	NA	NA	NA
WP_048943255.1|2938912_2939905_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_001272592.1|2939967_2941107_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2941246_2941873_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2941866_2942628_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP007442	Escherichia coli ACN001 chromosome, complete genome	4936576	4857447	4908422	4936576	portal,terminase,capsid,integrase,head,lysis,tail	Enterobacteria_phage(50.94%)	57	4856256:4856270	4869220:4869234
4856256:4856270	attL	CATTGCCCTGTACGA	NA	NA	NA	NA
WP_001218277.1|4857447_4858671_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
WP_048943335.1|4858853_4862681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206803.1|4863077_4863698_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001242723.1|4863697_4864060_-	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000008209.1|4864050_4864587_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_048943336.1|4864714_4865539_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	8.6e-149
WP_000135680.1|4865604_4865967_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|4866669_4867362_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_001191669.1|4867459_4867720_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526668.1|4867712_4868270_+	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001250269.1|4868445_4868625_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|4868614_4869556_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
4869220:4869234	attR	CATTGCCCTGTACGA	NA	NA	NA	NA
WP_074400546.1|4869552_4870047_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	93.9	1.7e-83
WP_001442792.1|4870046_4870700_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|4870696_4871023_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|4871019_4871409_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_048943343.1|4871428_4872226_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.9e-149
WP_001433852.1|4872233_4873223_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001047110.1|4873236_4873989_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000917724.1|4874242_4874446_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4874596_4875649_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4875716_4875932_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001468348.1|4875936_4876281_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000370550.1|4876246_4876519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048943344.1|4876624_4877158_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.3e-99
WP_001228702.1|4877374_4877581_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|4877609_4877762_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|4878113_4878524_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|4878580_4878814_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453611.1|4879202_4879748_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027268.1|4879722_4881648_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|4881644_4881851_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032358757.1|4881847_4883449_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_048943348.1|4883429_4884749_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
WP_001338090.1|4884758_4885091_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_048943349.1|4885146_4886172_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_048943350.1|4886213_4886609_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_000752996.1|4886620_4886974_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943351.1|4886985_4887564_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000683111.1|4887560_4887956_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943399.1|4887963_4888704_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_001357868.1|4888719_4889142_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_000459457.1|4889123_4889558_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_048943353.1|4889550_4892112_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000847345.1|4892108_4892438_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|4892437_4893136_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_048943354.1|4893141_4893885_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.8e-145
WP_000090892.1|4893821_4894454_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_048943357.1|4894513_4897996_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_032202908.1|4898062_4898662_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_071886295.1|4898726_4902077_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	39.1	7.3e-13
WP_048943362.1|4902076_4902661_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-103
WP_005025120.1|4903105_4904710_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_048943363.1|4905069_4905330_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.1	3.1e-36
WP_000202566.1|4905549_4907136_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4907528_4908134_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4908260_4908422_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
