The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012046	Achromobacter xylosoxidans strain MN001 chromosome, complete genome	5876049	1650920	1662398	5876049	integrase	Pseudomonas_phage(44.44%)	14	1653594:1653621	1664279:1664306
WP_049072317.1|1650920_1652081_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	4.2e-24
WP_049072318.1|1652598_1653492_+	cation transporter	NA	NA	NA	NA	NA
1653594:1653621	attL	AATTTGGTGGAGCCGGGGGGAATTGAAC	NA	NA	NA	NA
WP_049072319.1|1653663_1654887_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	38.4	6.3e-63
WP_049072320.1|1654883_1655081_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_049072321.1|1655137_1655458_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	38.1	7.5e-08
WP_049072322.1|1655457_1655910_-	hypothetical protein	NA	B5WZU9	Pseudomonas_phage	54.5	3.7e-37
WP_144419093.1|1655902_1656979_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	34.3	2.0e-20
WP_049072324.1|1656935_1657256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049072325.1|1657345_1657840_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	67.3	7.7e-36
WP_080977345.1|1657839_1658271_-	hypothetical protein	NA	A0A2I7RQG4	Vibrio_phage	32.3	3.1e-09
WP_049077567.1|1658565_1659216_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	43.8	4.2e-42
WP_144419094.1|1659216_1660248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049072326.1|1660247_1660439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158324574.1|1660421_1662398_-	acyltransferase family protein	NA	W6MVL2	Pseudomonas_phage	33.7	1.3e-54
1664279:1664306	attR	AATTTGGTGGAGCCGGGGGGAATTGAAC	NA	NA	NA	NA
>prophage 2
NZ_CP012046	Achromobacter xylosoxidans strain MN001 chromosome, complete genome	5876049	1856586	1919213	5876049	transposase,integrase,tRNA,protease	Burkholderia_phage(33.33%)	56	1882381:1882398	1918719:1918736
WP_049072501.1|1856586_1858047_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_049072502.1|1858335_1859409_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.0	7.9e-78
WP_049077588.1|1859506_1860916_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_049072499.1|1862889_1863528_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_049072500.1|1863614_1863998_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_049072501.1|1864768_1866229_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_049072502.1|1866517_1867591_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.0	7.9e-78
WP_049077588.1|1867688_1869098_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_049072499.1|1871071_1871710_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_049072500.1|1871796_1872180_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_049072501.1|1872950_1874411_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_049072502.1|1874699_1875773_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.0	7.9e-78
WP_049077588.1|1875870_1877280_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_049072504.1|1877546_1879046_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_049072506.1|1879058_1880162_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_049072507.1|1880167_1881397_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_049072508.1|1881504_1882944_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
1882381:1882398	attL	CAACAGCGCCAGCGCCAG	NA	NA	NA	NA
WP_049072509.1|1882940_1883258_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_049072510.1|1883262_1884381_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_047992307.1|1884565_1885441_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_049072511.1|1885511_1886501_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_049072512.1|1886691_1887612_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	31.8	1.8e-30
WP_049072513.1|1887624_1888743_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_049072514.1|1888867_1889686_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_049072515.1|1889748_1890360_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_049072517.1|1890521_1891898_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	4.5e-110
WP_006393799.1|1891954_1892413_+	cytochrome c	NA	NA	NA	NA	NA
WP_144419067.1|1892501_1893868_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	3.2e-76
WP_049072519.1|1893998_1894691_-	cytochrome b561	NA	NA	NA	NA	NA
WP_006393801.1|1894778_1895060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049072521.1|1896012_1896372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049072523.1|1896535_1897048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049072524.1|1897206_1897911_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_049072526.1|1898036_1899152_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_049072527.1|1899328_1899550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049072528.1|1899610_1901428_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_049072530.1|1901434_1902196_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_049072531.1|1902518_1902776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144419067.1|1902922_1904288_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	3.2e-76
WP_049072533.1|1905224_1905818_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	47.2	2.6e-46
WP_049072534.1|1905828_1907304_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.1	1.5e-111
WP_049072535.1|1907761_1908211_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	37.1	8.6e-18
WP_049072536.1|1908207_1908396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049072537.1|1908388_1910065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049072538.1|1910057_1910657_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	34.9	5.5e-20
WP_049072539.1|1910666_1910966_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.0	4.1e-16
WP_049077590.1|1910985_1911996_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	51.6	3.7e-77
WP_049072541.1|1912030_1912774_+	bacteriophage protein (fragment)	NA	A9YX06	Burkholderia_phage	63.9	2.3e-84
WP_049072542.1|1912782_1913136_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	64.1	6.7e-34
WP_049072544.1|1913132_1914314_+	bacteriophage protein	NA	A9YX12	Burkholderia_phage	63.4	3.1e-131
WP_049072545.1|1914315_1914981_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	59.7	6.2e-73
WP_080977351.1|1914995_1915946_+	hypothetical protein	NA	E5E3Q7	Burkholderia_phage	27.3	2.5e-06
WP_049072548.1|1916667_1917018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049072549.1|1917021_1918044_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.0	8.2e-24
WP_049072550.1|1918231_1918693_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	36.5	1.3e-13
WP_049072551.1|1918682_1919213_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	54.9	9.4e-40
1918719:1918736	attR	CTGGCGCTGGCGCTGTTG	NA	NA	NA	NA
>prophage 3
NZ_CP012046	Achromobacter xylosoxidans strain MN001 chromosome, complete genome	5876049	3056494	3064352	5876049	tRNA	Moraxella_phage(33.33%)	9	NA	NA
WP_049073454.1|3056494_3057082_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.6	1.2e-19
WP_049073455.1|3057114_3057489_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	26.8	7.1e-10
WP_049073456.1|3057681_3058704_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049073457.1|3059018_3059375_+	VOC family protein	NA	NA	NA	NA	NA
WP_049073458.1|3059459_3060752_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	7.1e-65
WP_049073459.1|3060860_3061892_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	7.1e-92
WP_049073460.1|3061964_3062606_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_049073461.1|3062784_3063543_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	1.2e-67
WP_049073462.1|3063527_3064352_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	3.9e-32
>prophage 4
NZ_CP012046	Achromobacter xylosoxidans strain MN001 chromosome, complete genome	5876049	5257761	5326350	5876049	integrase,tail,transposase	Burkholderia_virus(29.41%)	60	5250595:5250649	5299400:5299454
5250595:5250649	attL	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_144419241.1|5257761_5258046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158324582.1|5258033_5258378_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_158324583.1|5259929_5260061_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_049076431.1|5262728_5263226_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_049076433.1|5263222_5264938_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_049076434.1|5264941_5265382_-	heat resistance system thioredoxin Trx-GI	NA	V5L6J2	Insectomime_virus	32.4	5.8e-11
WP_049076437.1|5265371_5266517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049076439.1|5266596_5267208_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_049076441.1|5267304_5268192_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_049076443.1|5268294_5269209_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|5269231_5269690_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_049076445.1|5269768_5271598_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	6.9e-106
WP_049076447.1|5271625_5273056_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_049076449.1|5276016_5276586_-	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.1	4.7e-05
WP_049076450.1|5276621_5276903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080977596.1|5278424_5279219_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_049076451.1|5279721_5280726_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_049076452.1|5280774_5282403_-	2-polyprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
WP_049076453.1|5282500_5283391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049076454.1|5283382_5284693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049076456.1|5284824_5285985_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_049076458.1|5285981_5286299_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_049076460.1|5286308_5287535_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144419170.1|5287770_5289147_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_049076465.1|5289639_5289960_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_049076467.1|5289956_5292179_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_080977503.1|5292563_5292794_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_080977504.1|5293058_5295311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144419171.1|5295814_5296612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080977505.1|5296604_5299115_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_049076473.1|5299505_5299808_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.2	2.7e-15
5299400:5299454	attR	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_049076475.1|5299804_5300113_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.9	6.9e-19
WP_049076477.1|5300259_5300622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010562.1|5300759_5301059_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_049076481.1|5301376_5302393_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.0	5.0e-66
WP_080977506.1|5302439_5303024_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_144419172.1|5303036_5303375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006385706.1|5303515_5303797_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_049076483.1|5304026_5304797_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	9.9e-14
WP_049076484.1|5304842_5305802_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049076486.1|5305816_5306761_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049076488.1|5306908_5308468_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_049076490.1|5308819_5309755_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_049076492.1|5309811_5311011_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049076493.1|5311042_5311861_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.6e-09
WP_049076494.1|5311916_5312846_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049076496.1|5312975_5313572_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.3	1.1e-49
WP_049076499.1|5313568_5313784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144419173.1|5313764_5314130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053086028.1|5314134_5317758_-	host specificity protein J	NA	A0A2R3UA88	Siphoviridae_environmental_samples	45.3	2.1e-268
WP_049076500.1|5317754_5318360_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	55.7	9.4e-52
WP_049076502.1|5318356_5319136_-	C40 family peptidase	NA	A4JX14	Burkholderia_virus	50.2	1.9e-65
WP_049076505.1|5319138_5319867_-|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	57.0	2.7e-69
WP_080977507.1|5320051_5320396_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	50.0	7.0e-28
WP_049076506.1|5321732_5322023_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.8	5.3e-13
WP_049076508.1|5322022_5322496_-|tail	tail protein	tail	A4JX08	Burkholderia_virus	43.5	1.8e-26
WP_049076510.1|5322501_5322969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080977597.1|5323220_5323814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049076513.1|5324087_5324786_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053086029.1|5324880_5326350_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	34.2	1.1e-58
>prophage 5
NZ_CP012046	Achromobacter xylosoxidans strain MN001 chromosome, complete genome	5876049	5689284	5696962	5876049		Enterobacteria_phage(66.67%)	8	NA	NA
WP_049077088.1|5689284_5690346_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.2	4.9e-88
WP_080977528.1|5690515_5691439_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_049077092.1|5691446_5692349_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.1	3.7e-28
WP_049077094.1|5692341_5693220_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.0	1.7e-102
WP_049077097.1|5693219_5693768_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.8	6.3e-47
WP_049077099.1|5693764_5694778_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.8	4.2e-81
WP_049077101.1|5694789_5695611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_049077103.1|5695600_5696962_+	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	27.5	1.8e-05
