The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	1466156	1522726	4678046	integrase,transposase	Streptococcus_phage(18.18%)	60	1480642:1480701	1503479:1503538
WP_000006255.1|1466156_1466654_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1466877_1468617_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1468561_1469347_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1469417_1470473_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1470524_1470818_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1470820_1471219_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1471228_1471681_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1471986_1472253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1472185_1472722_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1472778_1474236_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1474496_1474955_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1475046_1476291_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1476348_1476750_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1476788_1477844_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1478131_1479235_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1479246_1480500_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1480642:1480701	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1481071_1481413_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1481433_1481751_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1481769_1481991_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1481999_1482476_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1482491_1482950_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1483047_1483287_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1483363_1483831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1483853_1484297_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1484296_1484524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1484927_1485749_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1485840_1486704_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1487032_1487926_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1488346_1489498_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1491844_1492861_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1493068_1494472_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1494458_1495391_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1495499_1496546_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000388269.1|1497772_1498504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1498594_1499221_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1499492_1500191_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1500217_1501072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1501190_1501415_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1501411_1501852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1501968_1503369_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|1503653_1504064_-	hypothetical protein	NA	NA	NA	NA	NA
1503479:1503538	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|1504042_1504999_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|1505008_1507207_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|1507203_1508160_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|1508156_1508846_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1509263_1509878_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1510125_1510455_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|1510767_1511478_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|1511446_1513090_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|1513079_1515605_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|1515630_1516299_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1516356_1516944_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|1517018_1517561_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|1518384_1518612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1518646_1518787_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1518786_1519050_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|1519413_1519515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|1520629_1521517_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|1521563_1521863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1521859_1522726_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	1725411	1787171	4678046	tRNA,protease,transposase,terminase,lysis,integrase	Enterobacteria_phage(51.85%)	65	1771028:1771074	1791131:1791177
WP_001295836.1|1725411_1726035_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1726005_1726692_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1726688_1729103_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1729533_1733814_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1733853_1734222_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1734912_1735173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1736404_1737499_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1737567_1738494_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1738723_1739206_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1739283_1740099_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1740188_1741970_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1741982_1742759_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1742858_1743737_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1743905_1745360_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1745419_1746781_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1746837_1748139_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1748160_1749306_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1749533_1750319_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1750329_1751565_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1751586_1752636_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1752952_1754620_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1754629_1755889_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1755899_1756715_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1756711_1757605_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1757799_1758867_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1758863_1759373_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1759490_1760213_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1760215_1760710_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1760883_1762269_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1762304_1762826_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1762933_1763146_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1763147_1764014_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1764484_1765027_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1765246_1765939_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1765969_1768573_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1768551_1769592_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1769602_1770118_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1770120_1770753_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1771028:1771074	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1771087_1772251_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1772370_1772634_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1772956_1773052_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1773114_1773414_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1773410_1774277_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1774587_1774920_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1774967_1775117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1775174_1776701_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1777165_1777717_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1777726_1778524_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1778640_1778742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1778738_1779194_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1779193_1779364_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1779356_1779647_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1779643_1780006_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1780002_1780143_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1780228_1780612_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737280.1|1780801_1781899_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|1782471_1782687_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1782686_1783184_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1783400_1783583_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1783673_1783967_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1784257_1784668_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1784953_1785160_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1785324_1785519_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1785907_1786453_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1786427_1787171_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1791131:1791177	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	2011290	2061636	4678046	portal,capsid,protease,head,holin,terminase,lysis,tail,integrase	Enterobacteria_phage(75.0%)	69	2009568:2009583	2034369:2034384
2009568:2009583	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|2011290_2012361_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|2012338_2012557_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|2012596_2012764_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|2012852_2013134_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|2013325_2013874_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|2013870_2014092_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|2014483_2014675_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|2014647_2014830_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|2014826_2015507_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|2015503_2016289_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|2016294_2016591_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|2016665_2016809_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2016777_2016942_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|2017014_2017383_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|2017565_2017766_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|2018032_2018515_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|2018515_2018839_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|2019303_2019738_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|2019753_2020593_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|2020705_2021419_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|2021519_2021720_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2021838_2022132_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|2022164_2023064_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|2023060_2023762_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|2023758_2024049_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|2024122_2024563_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|2024559_2025432_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|2025428_2025602_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|2025568_2025751_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|2025747_2025918_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|2025910_2026522_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|2026518_2026725_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|2026702_2027368_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|2027364_2027988_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783735.1|2028664_2028988_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|2028971_2029448_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|2029664_2029847_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|2029937_2030231_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|2030521_2030932_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|2031217_2031424_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|2031588_2031783_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453611.1|2032171_2032717_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027292.1|2032691_2034617_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
2034369:2034384	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|2034613_2034820_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|2034816_2036418_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|2036398_2037718_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|2037727_2038060_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|2038115_2039141_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|2039182_2039581_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|2039592_2039946_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|2039957_2040536_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|2040532_2040928_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|2040935_2041676_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|2041691_2042114_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|2042095_2042530_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|2042522_2045084_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|2045080_2045410_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|2045409_2046108_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|2046113_2046857_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|2046793_2047426_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|2047486_2050885_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|2050946_2051567_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|2051631_2053956_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|2053955_2054540_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|2054668_2055901_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|2056491_2057382_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|2057378_2058956_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|2059811_2060288_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|2060346_2061636_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 4
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	2446003	2467396	4678046	portal,tRNA,plate,tail,integrase	Shigella_phage(25.0%)	32	2437998:2438012	2474099:2474113
2437998:2438012	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|2446003_2447110_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2447163_2447625_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2447634_2448288_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|2448459_2449710_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|2450203_2450869_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|2450869_2451574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|2452031_2452925_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|2453015_2454143_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|2454123_2454369_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|2454405_2454717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|2454833_2455175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|2455112_2455421_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|2455595_2456270_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|2456360_2456561_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|2456604_2457162_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|2457337_2457517_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|2457506_2458874_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|2458885_2459068_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|2459067_2459541_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|2459467_2460259_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|2460249_2460834_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|2460837_2461467_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|2461468_2461882_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|2461853_2462456_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|2462455_2462950_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|2463021_2463576_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|2463682_2464516_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|2464749_2464914_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|2465016_2465340_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|2465876_2465987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|2466039_2466444_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2466664_2467396_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
2474099:2474113	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	2648213	2689031	4678046	tRNA,transposase,lysis,tail,integrase	Escherichia_phage(45.16%)	43	2649360:2649378	2679735:2679753
WP_010723085.1|2648213_2649230_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2649360:2649378	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2649502_2649760_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2649809_2650760_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2650911_2651664_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2651858_2652374_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2652384_2653911_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2653947_2655393_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2655392_2656703_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2656878_2657787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2658116_2658680_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2658700_2659933_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2660187_2661171_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2661648_2663022_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2663150_2664086_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2664137_2665373_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2665374_2665590_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2665668_2665878_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2665870_2666065_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2666121_2666931_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2666923_2669524_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2669625_2669901_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2669975_2670146_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2670145_2670367_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2670808_2671297_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2671293_2671449_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2671902_2672379_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2672502_2672799_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2672821_2673244_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2673256_2674114_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2674120_2674867_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2674889_2675450_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2675537_2675723_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2675919_2677377_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2677514_2677778_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2677758_2678118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2679883_2680864_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2679735:2679753	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2681186_2684549_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885611.1|2684548_2685124_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086527.1|2685221_2685812_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2686128_2686362_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2686430_2686544_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2687322_2687757_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2687897_2689031_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	2881590	2926255	4678046	protease,tail,transposase,lysis	Enterobacteria_phage(30.0%)	61	NA	NA
WP_000527743.1|2881590_2883051_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2883139_2884423_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2885027_2885141_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2885209_2885443_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2885759_2886350_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2886447_2887023_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_001027733.1|2887022_2887985_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2887935_2888505_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2888893_2889127_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2889184_2889595_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2889746_2889920_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2890091_2890247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2890325_2890391_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2890393_2890582_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2890592_2890805_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2891167_2891665_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2891661_2892195_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2892191_2892503_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2892507_2892723_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2893476_2893692_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2893992_2894205_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2894259_2894349_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2894626_2895379_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2895392_2896442_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2896443_2896722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2896788_2897040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2897256_2897412_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2897483_2897771_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2897770_2898010_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2898034_2898340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2898542_2898875_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2899311_2899461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2899757_2899988_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2900071_2900479_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2900645_2900801_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2900960_2901179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|2901182_2901347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2901746_2901935_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2901931_2902123_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_085947917.1|2903496_2904770_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001360138.1|2906201_2906312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2906369_2907389_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2907400_2908615_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2908820_2909147_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2909281_2909623_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2909657_2910218_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2910220_2910931_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2911038_2911344_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|2911542_2913969_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|2914029_2916453_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|2916463_2917081_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|2917082_2917937_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2917979_2918594_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|2918752_2920045_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|2919997_2920693_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|2920817_2922038_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|2922172_2923066_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2923172_2924426_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|2924822_2925158_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|2925250_2925334_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|2925433_2926255_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	3447861	3457302	4678046		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|3447861_3448998_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|3448994_3450995_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3451119_3451581_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|3451620_3452091_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|3452137_3452857_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3452853_3454539_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3454760_3455492_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3455551_3455659_+	protein YohO	NA	NA	NA	NA	NA
WP_000783123.1|3455639_3456371_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|3456375_3457302_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	3705203	3716413	4678046	tail,integrase	Enterobacteria_phage(50.0%)	17	3703178:3703194	3720088:3720104
3703178:3703194	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3705203_3706136_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3706447_3707605_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3707757_3708120_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3708116_3709037_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3709033_3710365_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3710399_3710681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3710979_3711420_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3711446_3711965_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3712014_3712290_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3712289_3712784_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3712780_3713149_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3713506_3713869_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3713934_3714759_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3714886_3715423_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3715413_3715776_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3715775_3716081_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3716212_3716413_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3720088:3720104	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 9
NZ_CP011495	Escherichia coli strain NCM3722 isolate K-12 chromosome, complete genome	4678046	4099109	4106248	4678046		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|4099109_4101671_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|4101776_4102433_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|4102483_4103281_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|4103446_4104355_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|4104351_4105518_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|4105609_4106248_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
